ID: 1035942161 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:3913434-3913456 |
Sequence | GAGGTTACATTTCCCTTCGC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1035942161_1035942165 | 2 | Left | 1035942161 | 8:3913434-3913456 | CCAGCGAAGGGAAATGTAACCTC | No data | ||
Right | 1035942165 | 8:3913459-3913481 | GACTGGAAGAAGCAAGCCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1035942161 | Original CRISPR | GAGGTTACATTTCCCTTCGC TGG (reversed) | Intronic | ||