ID: 1035942162

View in Genome Browser
Species Human (GRCh38)
Location 8:3913442-3913464
Sequence GGGAAATGTAACCTCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035942152_1035942162 29 Left 1035942152 8:3913390-3913412 CCAGACCAGAAGAAGCAAACCAC No data
Right 1035942162 8:3913442-3913464 GGGAAATGTAACCTCCAGACTGG No data
1035942156_1035942162 10 Left 1035942156 8:3913409-3913431 CCACTGGGATGTGTCCCAGAAGC No data
Right 1035942162 8:3913442-3913464 GGGAAATGTAACCTCCAGACTGG No data
1035942160_1035942162 -5 Left 1035942160 8:3913424-3913446 CCAGAAGCAACCAGCGAAGGGAA No data
Right 1035942162 8:3913442-3913464 GGGAAATGTAACCTCCAGACTGG No data
1035942155_1035942162 24 Left 1035942155 8:3913395-3913417 CCAGAAGAAGCAAACCACTGGGA No data
Right 1035942162 8:3913442-3913464 GGGAAATGTAACCTCCAGACTGG No data
1035942159_1035942162 -4 Left 1035942159 8:3913423-3913445 CCCAGAAGCAACCAGCGAAGGGA No data
Right 1035942162 8:3913442-3913464 GGGAAATGTAACCTCCAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035942162 Original CRISPR GGGAAATGTAACCTCCAGAC TGG Intronic