ID: 1035942165

View in Genome Browser
Species Human (GRCh38)
Location 8:3913459-3913481
Sequence GACTGGAAGAAGCAAGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035942161_1035942165 2 Left 1035942161 8:3913434-3913456 CCAGCGAAGGGAAATGTAACCTC No data
Right 1035942165 8:3913459-3913481 GACTGGAAGAAGCAAGCCCTTGG No data
1035942156_1035942165 27 Left 1035942156 8:3913409-3913431 CCACTGGGATGTGTCCCAGAAGC No data
Right 1035942165 8:3913459-3913481 GACTGGAAGAAGCAAGCCCTTGG No data
1035942160_1035942165 12 Left 1035942160 8:3913424-3913446 CCAGAAGCAACCAGCGAAGGGAA No data
Right 1035942165 8:3913459-3913481 GACTGGAAGAAGCAAGCCCTTGG No data
1035942159_1035942165 13 Left 1035942159 8:3913423-3913445 CCCAGAAGCAACCAGCGAAGGGA No data
Right 1035942165 8:3913459-3913481 GACTGGAAGAAGCAAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035942165 Original CRISPR GACTGGAAGAAGCAAGCCCT TGG Intronic