ID: 1035944959

View in Genome Browser
Species Human (GRCh38)
Location 8:3952240-3952262
Sequence CAGGAGAATAAGAGTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 830
Summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 758}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035944959_1035944962 2 Left 1035944959 8:3952240-3952262 CCTTCCTCACTCTTATTCTCCTG 0: 1
1: 0
2: 6
3: 65
4: 758
Right 1035944962 8:3952265-3952287 CACACAGTAAATACTTCTAGAGG No data
1035944959_1035944963 14 Left 1035944959 8:3952240-3952262 CCTTCCTCACTCTTATTCTCCTG 0: 1
1: 0
2: 6
3: 65
4: 758
Right 1035944963 8:3952277-3952299 ACTTCTAGAGGCTACGCGAAAGG No data
1035944959_1035944964 22 Left 1035944959 8:3952240-3952262 CCTTCCTCACTCTTATTCTCCTG 0: 1
1: 0
2: 6
3: 65
4: 758
Right 1035944964 8:3952285-3952307 AGGCTACGCGAAAGGTGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035944959 Original CRISPR CAGGAGAATAAGAGTGAGGA AGG (reversed) Intronic
900721083 1:4176183-4176205 CAGGAGAAGAATAGAGAGGGAGG - Intergenic
901264406 1:7899071-7899093 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
902038606 1:13475813-13475835 CTGGAGAGTAAGAGGCAGGAGGG + Exonic
903635434 1:24811335-24811357 GAGGAGAATGAGAGTGAAAAAGG + Intronic
903844756 1:26272297-26272319 CAGGAGAGTCAGTGGGAGGAAGG + Intronic
903880164 1:26502731-26502753 CAGGAGAATGAGATGGAGAAAGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904319951 1:29690083-29690105 GAGGAGAAGGAAAGTGAGGAAGG + Intergenic
904465680 1:30705938-30705960 CAGGAGAATAAGAATTAGGGAGG - Intergenic
904813291 1:33178146-33178168 CAGGAGAGGGAGAGGGAGGAAGG - Intronic
905170492 1:36106936-36106958 GAGGAGGGTATGAGTGAGGAGGG + Intronic
905560027 1:38919112-38919134 GAGGAGAAAATGAGAGAGGATGG - Exonic
906180896 1:43817827-43817849 AAGGAGAAGAAGAAGGAGGAAGG - Intronic
906373705 1:45276476-45276498 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
906469155 1:46113099-46113121 GAGGAGAATAAGATTAAAGAAGG - Intronic
907195601 1:52684072-52684094 CAGGAGCAAGAGAGTGAGCAAGG - Intergenic
907254360 1:53167255-53167277 CAGGTGAATAAGGGAGAGAATGG + Intergenic
907466371 1:54640456-54640478 CTGGAGATAAAGAGTGAGGGAGG + Intergenic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
908269699 1:62410985-62411007 CTGGAGAATAAGAGTCAGACAGG - Intergenic
908478040 1:64508096-64508118 CAGGAGGACAAGAGAGAGAAGGG + Intronic
909399008 1:75205027-75205049 AAGGAGAATAAGAATGCAGAAGG + Exonic
910538162 1:88323620-88323642 CAGGAGGAAGAGAGTGAAGAGGG + Intergenic
910785340 1:90991657-90991679 CAGGAGAATAAGAGTGAAGGGGG + Intronic
911603775 1:99877025-99877047 CAAGACACTAAGAGTGAGGGGGG - Intronic
911630212 1:100174995-100175017 CAGGAGCAAAAGAGGGAGCAGGG - Intronic
911779518 1:101858693-101858715 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
912438520 1:109679922-109679944 GAGGAGAAAAAGACAGAGGAAGG + Intronic
913577664 1:120193485-120193507 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
913630506 1:120704855-120704877 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914559577 1:148804916-148804938 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
914613256 1:149325307-149325329 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914984824 1:152447543-152447565 CAGCACGATAAGTGTGAGGAAGG + Intergenic
915309537 1:155000356-155000378 CAGGAGAAAAAGAGAGACAAGGG + Intergenic
915805340 1:158842979-158843001 TAGGAGAACAAGACTGAGAAAGG + Intronic
916040947 1:160960950-160960972 CAGGAGAGAAAGAGTGAGGCAGG + Intergenic
916059028 1:161086422-161086444 CAGGAGTAGAAAAGTAAGGATGG + Intronic
916287900 1:163131229-163131251 CAGGAGAAAGAGAGAGAGAAGGG - Intronic
916325081 1:163547723-163547745 CAGGAGAAAAAGAGAGGGAATGG - Intergenic
916645195 1:166777860-166777882 CAGGAGAGAGAGAGAGAGGAAGG - Intergenic
916759312 1:167802295-167802317 CAGGAGAGAGAGAGTGAGGGTGG + Intergenic
917133795 1:171768632-171768654 CAGGAGGAAAAGAGTGAAGCAGG + Intergenic
917205237 1:172564464-172564486 CAGGAGAAAGAGAGTGAAGGGGG - Intronic
917219401 1:172711608-172711630 TGGGGGAATGAGAGTGAGGATGG + Intergenic
918491695 1:185088321-185088343 CAGGAGATTGAGAGAGAGGGGGG + Intronic
918784748 1:188750933-188750955 CAGTAGAAAAAGGGAGAGGAGGG - Intergenic
919196928 1:194298022-194298044 AAGGAGAAGAAGAGGGAAGAAGG + Intergenic
919593269 1:199530588-199530610 AAAGGGAACAAGAGTGAGGATGG - Intergenic
919950788 1:202361410-202361432 CAGGAGAAAGAGAGAGAGGTGGG + Intronic
920162604 1:204010805-204010827 CAGGAGCAAGAGAGTGAGGGAGG - Intergenic
920183470 1:204146811-204146833 CAGGAGGAAATGAGTGGGGAAGG - Intronic
920192467 1:204202367-204202389 CAGGAGAAAAGGTGTGGGGAAGG - Intronic
920384442 1:205559155-205559177 TAGTTGAATAAGAGTGATGAGGG - Intergenic
920584222 1:207141899-207141921 CAGGAGAATAATAGTCAAGAAGG + Intronic
920763692 1:208810807-208810829 CTGGGGTATAAGAGTGAGTAGGG - Intergenic
920942806 1:210499889-210499911 CATGAGAATAAAACTGAGAAAGG + Intronic
921004001 1:211075077-211075099 TAGCCGAATAAGAGTGAGCAAGG + Intronic
921808010 1:219478094-219478116 CTGGAGAATGAGGGTGGGGAGGG + Intergenic
923037214 1:230292638-230292660 CAAGAGAAGGAGAGAGAGGAAGG - Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
924146009 1:241075411-241075433 GAGGAGAAAAAGAGAGAGAAAGG + Intronic
924270045 1:242322706-242322728 CAGGAGAGAAAGAGTGAAGTAGG - Intronic
924290353 1:242529852-242529874 AAGGAGAAAGAGAGAGAGGAAGG - Intergenic
924918193 1:248596446-248596468 CAGGAGAACAAAAGTGAGAGTGG + Intergenic
924931268 1:248734254-248734276 TCTGAGAACAAGAGTGAGGAGGG - Intronic
1062985540 10:1765270-1765292 CAGGAGCATGAGACTGAGAATGG - Intergenic
1063700843 10:8383963-8383985 CAGGAGAGAGAGAGTGAGGGGGG + Intergenic
1063950202 10:11214944-11214966 CAGGTGAATAGGAGAAAGGAAGG - Intronic
1064242892 10:13646808-13646830 CAGGAGAAAAAAAGTGCTGAGGG + Exonic
1064416728 10:15156294-15156316 GAGAAGAATGAGAGTGAGGGGGG - Intronic
1065148288 10:22795440-22795462 CAAGAGAAAGAGAGTGAGGGAGG - Intergenic
1065170004 10:23017670-23017692 CAGGAGAATCAGCTTGAGGCTGG + Intronic
1065199495 10:23299674-23299696 CAGGAGAGTAAGACTGAGAAGGG + Intronic
1065359818 10:24878947-24878969 CAGGAGAATAGCTGAGAGGAAGG - Intronic
1065995412 10:31055532-31055554 CAGGAGAGACAGAGTGAGGGGGG + Intergenic
1067138445 10:43632992-43633014 CACTATAAAAAGAGTGAGGAAGG - Intergenic
1067191676 10:44075109-44075131 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1067222157 10:44352221-44352243 AGGGAGACAAAGAGTGAGGAGGG - Intergenic
1067251196 10:44588293-44588315 CAGAAAAATAAGAGTGAAGGAGG + Intergenic
1067701328 10:48575097-48575119 CAGGAGCAAAAGAGAGAGCAGGG - Intronic
1068410794 10:56651713-56651735 CAGGAGAATAAAAGTGGGAAAGG - Intergenic
1068434400 10:56972131-56972153 CAGGAGAGTAAAAGTGGGGGGGG + Intergenic
1068658949 10:59603676-59603698 CAGGAGCAAGAGAGTGAGGGGGG + Intergenic
1069231252 10:66011355-66011377 CAGGAGAATAGAAGGGAGTAAGG - Intronic
1069251126 10:66268474-66268496 AAGGAGTAGAAGACTGAGGAAGG - Intronic
1070167031 10:73906694-73906716 AGGCAGAAAAAGAGTGAGGAAGG + Intergenic
1070324309 10:75377982-75378004 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1070523247 10:77273217-77273239 AGGGAGAATAAGAGAGAGGCAGG - Intronic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070843607 10:79504941-79504963 AAGGAGACTAACAATGAGGATGG - Intergenic
1070930059 10:80254659-80254681 AAGGAGACTAACAATGAGGATGG + Intergenic
1071279737 10:84089806-84089828 CAAGAGAGAAAGAGTGAGGGGGG - Intergenic
1071930036 10:90458679-90458701 CACAGGAATAAGAGTGAGGACGG - Intergenic
1072014709 10:91335418-91335440 CAGGAGAAAAAGAGAGAGTGGGG - Intergenic
1073667296 10:105547868-105547890 CAGGAGAAAGAGAGAGAAGAGGG - Intergenic
1073906353 10:108285172-108285194 CAAGAGAACAAGTGTGAAGAAGG - Intergenic
1074006156 10:109426545-109426567 CAGGAAAAAAAGAGACAGGAGGG + Intergenic
1074056216 10:109924485-109924507 CAGCTGAAGAAGAGTGAGGAAGG - Intergenic
1074969651 10:118525630-118525652 CAGGAGGAAGAGAGAGAGGAAGG - Intergenic
1075188774 10:120286917-120286939 CAGGAATATAAGAGTATGGAAGG - Intergenic
1075759581 10:124845907-124845929 CTGGAGAATGAGGATGAGGATGG - Intergenic
1075769803 10:124923711-124923733 CAGGAGAGAGAGAGTGAGCAGGG + Intergenic
1075963025 10:126585560-126585582 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1077203266 11:1325053-1325075 TGGAAGAATAAGAGTGAGGTAGG + Intergenic
1077564942 11:3291716-3291738 AAGGAGACTAACAGTGAGGATGG - Intergenic
1077570828 11:3337533-3337555 AAGGAGACTAACAGTGAGGATGG - Intergenic
1078916633 11:15784398-15784420 CAGCTGAATGAGAGTTAGGAGGG - Intergenic
1079043284 11:17078260-17078282 CAGGGGAATTCGAGTGCGGAGGG - Intronic
1079050607 11:17154704-17154726 CAGAGGAAGAAAAGTGAGGAAGG + Intronic
1079140836 11:17808400-17808422 CAGGAGCAAAAGAGCGAGCAGGG + Intronic
1080507671 11:32933055-32933077 CAGAAGAATAAGAAAGAGAAGGG - Exonic
1080627418 11:34043075-34043097 CAGGAGAGACAGAGTGAGGGTGG + Intergenic
1080812189 11:35715843-35715865 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1081777935 11:45689018-45689040 CAGGAGACTAAGAGTGAGCCAGG + Intergenic
1081894162 11:46570318-46570340 GAGGAGACTTAGAGTGGGGATGG - Intronic
1082207166 11:49451675-49451697 TAGGAGAATAAGAATTAGAAAGG - Intergenic
1082677940 11:56131591-56131613 GAGTAGAAGAAGGGTGAGGAGGG + Intergenic
1083150615 11:60789663-60789685 CTGCAAAATGAGAGTGAGGACGG + Intronic
1083784554 11:64936388-64936410 CAGGAGGCTAAGGGGGAGGATGG - Intergenic
1084646817 11:70463720-70463742 GAGGAGAATGAGGGTGAGTAGGG + Intergenic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1085674132 11:78499215-78499237 CACTAGATTAAGACTGAGGATGG - Intronic
1085804149 11:79619095-79619117 CAGGCCACTAAGAGTCAGGAAGG - Intergenic
1085814132 11:79717763-79717785 CAGGAGAGTGAGAGGGAGAAAGG + Intergenic
1085919714 11:80938178-80938200 CAGGGGAATCAGTGAGAGGAGGG - Intergenic
1086429493 11:86721540-86721562 AAGTAGACTAAGAGGGAGGAGGG + Intergenic
1086502241 11:87465328-87465350 CAGGATAATAAAATTGAGAATGG + Intergenic
1086648110 11:89250061-89250083 TAGGAGAATAAGAATTAGAAAGG + Intronic
1087677649 11:101181206-101181228 CAGGAACATAAGAATGAAGAAGG + Intergenic
1088335252 11:108696545-108696567 GAGGAGAATAACAGTGGAGAAGG - Intronic
1089061745 11:115631493-115631515 CAGGAGACTTAGAGTAAAGAAGG + Intergenic
1089106989 11:116018678-116018700 CAGGAGCAAGAGAGTGAGGTGGG + Intergenic
1089447366 11:118564224-118564246 AAGGAGAATAACAGTGAGGAAGG - Intronic
1089648739 11:119897766-119897788 CAGGAAAGAAAGAGTGAGCAGGG - Intergenic
1089679267 11:120110310-120110332 CAGGAGGGTAAGGGTGAGAAAGG - Intergenic
1090017317 11:123097749-123097771 CAGGAGGACAAGAAGGAGGAGGG + Intronic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1090832142 11:130427428-130427450 CTGGAGAAGATGAGTGGGGAGGG + Intronic
1090979755 11:131709157-131709179 CAGGATAATAAGAGTAAGGTGGG + Intronic
1090990397 11:131812225-131812247 GGGGAGAATGAGAGGGAGGAAGG - Intronic
1091407139 12:216097-216119 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407152 12:216192-216214 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407165 12:216287-216309 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407182 12:216382-216404 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407195 12:216477-216499 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091407211 12:216572-216594 TAGGAGAACTTGAGTGAGGAAGG - Intergenic
1091494872 12:963853-963875 CAGCAGAACTAGAGTGACGAGGG + Intronic
1091689604 12:2586807-2586829 CAGGAGGAGGGGAGTGAGGATGG - Intronic
1091756993 12:3060084-3060106 AAGGAGTATAAAAGTGAAGATGG - Intergenic
1092033720 12:5311965-5311987 TAGGAGAAAAAGAGTGTGAATGG - Intergenic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092562905 12:9635266-9635288 CTGGAGAATATTAGTGGGGAAGG - Intergenic
1093041585 12:14387318-14387340 CATGAAAATAAGAGTGATCAAGG - Intronic
1093689163 12:22090139-22090161 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
1093795127 12:23301978-23302000 CAGGAGGAAAAGAATGAAGAGGG - Intergenic
1093941013 12:25054441-25054463 CAAGAAAATCACAGTGAGGAAGG - Intronic
1094484496 12:30913812-30913834 CAGAAGAAAAAGAGTGAGATGGG + Intergenic
1094696833 12:32827990-32828012 TAGGAGAAGTAGAGTGAGGAAGG + Intronic
1095386198 12:41653531-41653553 CAGGAGAGAAAGAGAGAGAAAGG + Intergenic
1095926686 12:47585790-47585812 CAGGAGAGTGAGAGTGAAGGTGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096528423 12:52228139-52228161 AAGGAGAAGAAGAAGGAGGAGGG - Intergenic
1096718729 12:53505968-53505990 CTGGAGAGCAAGAGAGAGGAGGG - Intronic
1097259360 12:57707452-57707474 CAGGAGCAAAAGAGAGAGGGGGG + Intronic
1097403948 12:59165263-59165285 CAATAGAATAAAAGTAAGGATGG - Intergenic
1097928280 12:65155905-65155927 CAGGAGCAAGAGAGTGAGGGGGG + Intergenic
1098136835 12:67412108-67412130 CAGGAGAAGAGGAGTGTGGCTGG + Intergenic
1098576925 12:72053067-72053089 CAGGAGAGAAAGAGTGAAGGGGG + Intronic
1100464366 12:94832344-94832366 CAGGGGAATGAGAGTAAAGAAGG + Intergenic
1101787787 12:107900836-107900858 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1102599207 12:114016239-114016261 CAGGAGAACAGGAGGGAAGAGGG + Intergenic
1102761906 12:115394902-115394924 CAGGGAAAGAAGAGTGAGCAAGG + Intergenic
1103104385 12:118210192-118210214 AAGAAGAAAAAGAGGGAGGAAGG - Intronic
1103906060 12:124327805-124327827 CAGGAAAAAAAGGGTGGGGAGGG - Intronic
1104428372 12:128696364-128696386 AAGGAGAATCAGAGGTAGGATGG - Intronic
1104497027 12:129250489-129250511 CAGGAGGATCAGAGTTAGGAAGG - Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1104999867 12:132683285-132683307 CAGGAGAGCTAGAGTCAGGAAGG + Intronic
1105655320 13:22430408-22430430 CAGGAGAATGTGAGAGAAGAGGG + Intergenic
1105783040 13:23721014-23721036 CAGGAGAGAACGAGTGAGGGGGG + Intergenic
1106864308 13:33947298-33947320 CAGGAGAATAAGTGCAAGCAGGG - Intronic
1107037111 13:35912974-35912996 AAGGAGCATATGAGTGAGCAAGG - Intronic
1107582700 13:41808447-41808469 CAGGAGAAAGAGAGAGAGGCAGG + Intronic
1107824711 13:44318111-44318133 GAGGAGAATAACACCGAGGATGG + Intergenic
1108116590 13:47135605-47135627 TAGGAGAACAAGAGTGAAGGTGG - Intergenic
1108182448 13:47854517-47854539 CAGGACAGCAAGAGTGTGGAAGG + Intergenic
1108981927 13:56524680-56524702 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1109140678 13:58711315-58711337 CAGGAGAATTTTACTGAGGAGGG + Intergenic
1109306319 13:60645861-60645883 AAGGAGACTCAGAGTGAGGGAGG - Intergenic
1109817293 13:67602051-67602073 CAGGAGAGAAAGAGTGAAGGGGG + Intergenic
1110019529 13:70453080-70453102 CAGGAAAAAGAGAGAGAGGAGGG - Intergenic
1110092430 13:71470418-71470440 CAGGAGAATCAGGCTGAGGCAGG - Intronic
1110379918 13:74838925-74838947 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1110637552 13:77783395-77783417 GAGGAGAAGGAGAGGGAGGAGGG + Intergenic
1110819329 13:79896376-79896398 CAGGAGAAAGAGAGTGAGAGGGG + Intergenic
1110852200 13:80258646-80258668 CAGGAGAAAAAGAGGGAGAGTGG + Intergenic
1111104556 13:83628849-83628871 CAGGAGAAGGAGAGTGAGGGGGG - Intergenic
1112066900 13:95802749-95802771 CAGAAGAATGAGAGTGGGGTGGG - Intronic
1112171823 13:96980590-96980612 CATAAGAAGAAGAGTGAAGATGG + Intergenic
1112185224 13:97121648-97121670 AAAGAGAATAAGAATGTGGAAGG - Intergenic
1112239357 13:97665669-97665691 CTGGAGAACAAGAGTGAAGAGGG + Intergenic
1112422710 13:99267551-99267573 CAGGAGGATATAAGTAAGGAAGG + Intronic
1112482682 13:99791605-99791627 CTGTAAAATAAGAGTAAGGATGG + Intronic
1113268815 13:108649527-108649549 CAGGAAAATAGGAATAAGGATGG + Intronic
1113405142 13:110031931-110031953 CTGGAAATTAAGAGGGAGGAAGG + Intergenic
1113554804 13:111224207-111224229 CAAGGGAGTAAGAGTGAGGGTGG - Intronic
1113678749 13:112227132-112227154 GAGGAGGAGAGGAGTGAGGAGGG - Intergenic
1113945591 13:114042414-114042436 CACGAGAGCAGGAGTGAGGAAGG + Intronic
1114322030 14:21555034-21555056 CAAGAGATGAAGAGTGAGGCTGG + Intergenic
1114778394 14:25512491-25512513 CAGGAGAGAGAGAGTGAGCAAGG + Intergenic
1114913863 14:27236776-27236798 CAGGAGAATAAGAGCGAGCAAGG - Intergenic
1115113208 14:29849219-29849241 CAGGAGGAAAAGAAAGAGGAGGG - Intronic
1115114590 14:29864745-29864767 CAAGAGCATGAGATTGAGGAGGG + Intronic
1115718784 14:36136561-36136583 AAGAAGAATAAGAGTAAGAATGG + Intergenic
1115966418 14:38894483-38894505 CAAAAGAATAAAAGTGAGGCTGG + Intergenic
1116039978 14:39674172-39674194 CAGGAGGATAAGTGTGATGGGGG + Intergenic
1116198643 14:41761269-41761291 CAGGAGAAAGAGAGGAAGGAAGG + Intronic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116408724 14:44598306-44598328 CAAGAGAGAAAGAATGAGGAGGG + Intergenic
1116474913 14:45328631-45328653 CAGCAGGATAAGAATGAGCAAGG + Intergenic
1116852365 14:49921130-49921152 CAGGAGACCAACAGTGAGCATGG - Intergenic
1118133130 14:62990226-62990248 CATGAAAATAAGTGTGAGAAAGG + Intronic
1118502134 14:66371649-66371671 CAGGAGAGAGAGAGTGAGGGGGG + Intergenic
1118660637 14:68005962-68005984 CAGGAGGAAGAGAGAGAGGAAGG + Intronic
1118776266 14:68976268-68976290 CAGGGGAGTGAGTGTGAGGAGGG - Intronic
1118896194 14:69947645-69947667 CAAGAGGAGAAGAGAGAGGAGGG - Intronic
1119569667 14:75659678-75659700 CAAGAAAATAATAATGAGGATGG - Intronic
1120232461 14:81855256-81855278 CAGGTGAATAAGGGTGACTAAGG + Intergenic
1120668029 14:87330335-87330357 AATGAGAATAATAATGAGGATGG - Intergenic
1121319919 14:92986334-92986356 CAGGAGACTCAGTGTGAGTAGGG + Intronic
1121551624 14:94807157-94807179 AAGGAGGCTAAGAGGGAGGAAGG - Intergenic
1121664263 14:95660045-95660067 CAGCAGGATCAGAGTGAGGAAGG - Intergenic
1122672331 14:103382256-103382278 AAGGGGAAAAAGAGAGAGGAAGG + Intergenic
1124110200 15:26778147-26778169 CAGGAGGAAGAGAGAGAGGAGGG + Intronic
1124847813 15:33309389-33309411 CAGGAGAAGAAAAGAGTGGATGG + Intergenic
1125691475 15:41599527-41599549 CAGCAGAAGGAGAGTGAGGGTGG + Intergenic
1125881759 15:43201645-43201667 CAGGAGGATGGGAGTGAGGCAGG - Intronic
1126076094 15:44911250-44911272 AAGGAAAAGAAGAGAGAGGAAGG + Intergenic
1127025532 15:54801154-54801176 CAGGAGCAAAAGAGAGAGGAGGG + Intergenic
1127117016 15:55738874-55738896 CAGGAGGAAAAGACAGAGGAAGG + Intronic
1127129177 15:55844177-55844199 AAGGAGAAGAAGGGAGAGGAAGG + Intronic
1127196485 15:56591468-56591490 CAGGAGGAAGAGAGTGAGGTGGG + Intergenic
1127380513 15:58427170-58427192 CATGAGAATAAGAGTCAGCTGGG - Intronic
1127417636 15:58772204-58772226 CAGGAGCAAAACATTGAGGATGG - Exonic
1128713276 15:69887897-69887919 CAGGAGAAAAGGAAGGAGGAAGG + Intergenic
1128933833 15:71728606-71728628 CAGGAAAATACGAGGGCGGAGGG + Exonic
1129117908 15:73375480-73375502 GAGGAGGAAAAGCGTGAGGAGGG + Intergenic
1129837218 15:78717193-78717215 AAGGAGAATAAGACTGTGAATGG + Intronic
1130123195 15:81069964-81069986 CAGGAGGACAAGAATGAGGGCGG + Intronic
1130225956 15:82058687-82058709 GAGGAGGAGAAGAGGGAGGATGG - Intergenic
1130267948 15:82425939-82425961 AAGGAGAATAAGACTGTGAATGG + Intergenic
1130504076 15:84520895-84520917 AAGGAGAATAAGACTGTGAATGG - Intergenic
1130710530 15:86276615-86276637 CATGAGAATAGGAGTGATAAGGG + Intronic
1130959642 15:88651280-88651302 CAGAAAACTAACAGTGAGGAGGG - Intronic
1131292647 15:91120287-91120309 CAGGAGAGAGAGAGTGAGGGAGG + Intronic
1132183959 15:99787482-99787504 AAGGAGAATAAGACTGTGAATGG + Intergenic
1132434421 15:101785663-101785685 AAGGAGAATAAGACTGTGAATGG - Intergenic
1132537335 16:489025-489047 CACGGGAAGAAGAGGGAGGAGGG - Intronic
1133144615 16:3775284-3775306 CAGGAGGCTAAGGTTGAGGACGG - Intronic
1133537953 16:6720270-6720292 CAGGAGAAAAAGAGTGAAGGGGG - Intronic
1134605685 16:15569390-15569412 CAGGAGCAAGAGAGTGAGGCGGG + Intronic
1134781830 16:16905189-16905211 CAGGAGGAAGAGAGTGAAGAGGG - Intergenic
1135138885 16:19905044-19905066 CAAGAGTACAAGAGGGAGGAAGG + Intergenic
1135347399 16:21700849-21700871 GACGAGAATATCAGTGAGGAGGG - Intronic
1135754325 16:25083799-25083821 CAGGAGAGGAAGAGGGGGGAAGG - Intergenic
1135789963 16:25384776-25384798 CAGGAGAGAAAGTGTGAGGGAGG - Intergenic
1136381649 16:29898861-29898883 CAGGATATTAAGAGAAAGGAGGG + Intronic
1137317100 16:47337050-47337072 CAGGAGAATCACAGGGAGGCGGG + Intronic
1137595904 16:49723623-49723645 CAATAGTATCAGAGTGAGGAAGG - Intronic
1137758794 16:50923963-50923985 AAGGAGAAAAAGAGGGAGGATGG + Intergenic
1138103595 16:54274464-54274486 AGAGAGAATAAGAGAGAGGAAGG - Intergenic
1138128426 16:54457442-54457464 GAGGAGAAAAAGAGGAAGGAAGG - Intergenic
1138594142 16:58020617-58020639 GAGGAGAGGAAGAGAGAGGAGGG - Exonic
1138923610 16:61564066-61564088 CAAGAGATTAAGAAGGAGGAAGG - Intergenic
1139221163 16:65183676-65183698 CAGAGAAATCAGAGTGAGGATGG - Intergenic
1139230795 16:65280620-65280642 GAGGAAAATCAGAGTTAGGAAGG + Intergenic
1139259270 16:65576563-65576585 CAGGAGTGAGAGAGTGAGGAAGG + Intergenic
1139307729 16:66001646-66001668 CAGGAGGAAAAGTGAGAGGAGGG + Intergenic
1139329687 16:66177672-66177694 AGGGAGAATGAGAGTAAGGATGG + Intergenic
1139640817 16:68290280-68290302 AAGGAGAATAGGAAAGAGGAAGG - Intronic
1139800936 16:69522161-69522183 TAGGTGAAGAAGAGGGAGGAGGG + Intergenic
1140999139 16:80291340-80291362 CCAGAGAATAATAGGGAGGATGG + Intergenic
1141405942 16:83793132-83793154 CAGAAGCCTGAGAGTGAGGAAGG + Intronic
1142109754 16:88325018-88325040 CAGGAGGAAAAGAGAGAGGGAGG + Intergenic
1142287788 16:89178469-89178491 TGGGAGAAGAAGAGTGAGGCTGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1144091420 17:11860345-11860367 AAGCAGAATAAGAGAGAGAAAGG - Intronic
1147305822 17:39563774-39563796 AGGGAGAGTGAGAGTGAGGAAGG + Intronic
1148347311 17:46912122-46912144 CAGGAGAGGAGGTGTGAGGAAGG - Intergenic
1148492537 17:48032603-48032625 CAGGAGAAAAACAGGGAGGAAGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149003770 17:51783583-51783605 AAGGAGAATAAGAAAGAAGAAGG + Intronic
1149417580 17:56476029-56476051 CGGGAGAAAGAGAGTGAGGCAGG + Intronic
1149587428 17:57801572-57801594 CAGGAGGAAAAGAGAGAGTAAGG - Intergenic
1150991196 17:70261164-70261186 CAGGAGAATCATAGTGATGGTGG + Intergenic
1151320730 17:73350829-73350851 CAGGAGATTTGGAGGGAGGAGGG - Intronic
1151875345 17:76864958-76864980 CAGGAGAGAAACAGTGAAGAGGG + Intergenic
1151952703 17:77363977-77363999 CAGGGGGAGAAAAGTGAGGAGGG + Intronic
1152063505 17:78096783-78096805 CTGGAGAAGAAGAGCGAGGATGG - Intronic
1152153062 17:78615074-78615096 CAGGAGAAAGAGAGAGACGAGGG - Intergenic
1153106704 18:1536423-1536445 TAGGAGAAAGAAAGTGAGGAAGG - Intergenic
1153899982 18:9609691-9609713 CTGGAGAATGATAGAGAGGATGG - Intronic
1154050734 18:10954595-10954617 GATGAGAAGAAGAGGGAGGAGGG + Intronic
1154099975 18:11463890-11463912 CAGAAGAATGAGTATGAGGAAGG - Intergenic
1155882092 18:31162438-31162460 AAAGAGACTAGGAGTGAGGATGG - Intronic
1156012233 18:32508800-32508822 TAGGAGAATAAGAGGAGGGAGGG + Intergenic
1156131752 18:33984590-33984612 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156886932 18:42145769-42145791 CAGGAGAAAGAGAGAGAGGGTGG + Intergenic
1157226150 18:45866500-45866522 CAGCAGAATAGCAGGGAGGAAGG - Intronic
1157407902 18:47438816-47438838 CAGGAGCAGGAGAGTGAGGCAGG - Intergenic
1157874469 18:51259741-51259763 CAGGAGGATGAGGGTGGGGAGGG - Intergenic
1158117366 18:54010889-54010911 CAGGAGAGAGAGAGTGAGGGGGG + Intergenic
1158188308 18:54796568-54796590 CAGCAGAGTAAGAGAGAGGGGGG - Intronic
1158748932 18:60236173-60236195 CAGGGTAACAACAGTGAGGATGG - Intergenic
1159391302 18:67796041-67796063 AAGGAGAATGAGAATGAGAATGG - Intergenic
1159408346 18:68036004-68036026 TAGGTCAATGAGAGTGAGGATGG + Intergenic
1161408198 19:4102133-4102155 GAGGATACTAAGAGTGAAGAGGG + Intronic
1161981703 19:7633426-7633448 CAGGAGGAGAAGACGGAGGAAGG - Exonic
1162316938 19:9945158-9945180 CAGCAGAAAAAGAGGAAGGAAGG + Intergenic
1162365235 19:10244583-10244605 CAGGAGGCTGAGTGTGAGGATGG + Intergenic
1162847904 19:13407970-13407992 CAGGAGAGAGAGAGTGAGGGGGG - Intronic
1162976493 19:14209500-14209522 CAGGAGGCAAAGAGTGCGGAGGG + Intergenic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1163113059 19:15173045-15173067 AAGAAGAAGAAGAGGGAGGAGGG - Intronic
1163584514 19:18156539-18156561 CAGGAGGACCAGAGGGAGGAAGG + Intronic
1166017631 19:39994857-39994879 CAGGAGCAAGAGAGTGAGGAGGG - Intronic
1166349031 19:42185609-42185631 CAGGGGGACAAGAGTGAGAAGGG - Intronic
1166550728 19:43664397-43664419 CAGGAGAGGAAGGGTGGGGAAGG - Intronic
1166859216 19:45800204-45800226 AAGGAGAATAAGAGAGTGGGAGG - Intronic
1166898502 19:46039959-46039981 GAGGGGAATAAGAGGGAGGGTGG + Intronic
1167143368 19:47667446-47667468 CAGCAGAATTAGAGACAGGAGGG - Intronic
1167670141 19:50847317-50847339 TGAGAGAATAAGAGTGAGAAAGG - Intergenic
1167725016 19:51205553-51205575 CATGAGAAAGAGAGTGAGGAAGG - Intergenic
1168264423 19:55214355-55214377 CAGGAGCAAGAGAGAGAGGACGG + Intergenic
1168375149 19:55870789-55870811 CACGAGAAGGAGAGTGAAGAGGG - Intronic
1168673670 19:58260583-58260605 CAGAAGAATAAGAATAAGCAGGG - Intronic
925693509 2:6549579-6549601 CAGGAGGAAGAGAGGGAGGAAGG - Intergenic
925831891 2:7904016-7904038 CAGGAGAAAAGGGATGAGGATGG - Intergenic
926283961 2:11472702-11472724 CAGGAGAAAGAGAGTGAGTGAGG + Intergenic
926378943 2:12264723-12264745 CAGGAGCAAGAGAGCGAGGAAGG + Intergenic
926545846 2:14238797-14238819 CAGGAGGAAAAGAGTGAAGCAGG - Intergenic
927144497 2:20153687-20153709 GAGGAGAATGAGAGTGAGATCGG + Intergenic
927263306 2:21116742-21116764 CTGGAGGAGAGGAGTGAGGAGGG + Intergenic
928051531 2:28001739-28001761 CAGGAGCAAGAGAGAGAGGAGGG + Intronic
928324829 2:30311157-30311179 CAGGAAAATGAGAGGGAGGAGGG + Intronic
928663941 2:33531633-33531655 CAGGAGACTGAGACTCAGGAAGG + Intronic
928816412 2:35300156-35300178 AGGGACAATGAGAGTGAGGAGGG - Intergenic
928898863 2:36296361-36296383 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930732432 2:54741133-54741155 CTGGACAATAAGAATGAGGAGGG - Intronic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
931903274 2:66815081-66815103 CAGGAGAAAGAGAGAGAGAAGGG - Intergenic
932007211 2:67939045-67939067 CAGGAGAGGAAGAGTCATGATGG - Intergenic
932375793 2:71234678-71234700 CAAGAGGGTAAGAGGGAGGATGG + Intergenic
932817575 2:74874192-74874214 CAGTAGTATAAGAGGGAAGAGGG + Intronic
933000261 2:76912803-76912825 CAGGAGGATGAGAGTGGGGGAGG - Intronic
933130836 2:78672806-78672828 CATTAGAATAAGAATAAGGATGG + Intergenic
933267725 2:80200378-80200400 CAGCATAATGATAGTGAGGAAGG - Intronic
933478182 2:82819212-82819234 GAGTGGTATAAGAGTGAGGATGG - Intergenic
933867910 2:86540275-86540297 CAGGAGAAGAGGGGTCAGGAAGG - Intronic
933912239 2:86951850-86951872 CAGGAAATTAAGAGGGAGGCAGG + Intronic
934010755 2:87818047-87818069 CAGGAAATTAAGAGGGAGGCAGG - Intronic
934473477 2:94576891-94576913 CAGGAGCATCAGAGAGAGGAGGG + Intergenic
934702170 2:96451334-96451356 TAGGAGCATGAGGGTGAGGAGGG - Intergenic
934928621 2:98400731-98400753 CAGGAAGATCAGAGAGAGGAAGG + Intergenic
935164465 2:100558096-100558118 CAGAAGAAAGAGAGAGAGGACGG + Intergenic
935427772 2:102938521-102938543 CAGGAGGAAAGGAGAGAGGAGGG + Intergenic
935774323 2:106458748-106458770 CAGGAAATTAAGAGGGAGGCAGG - Intronic
935905745 2:107837165-107837187 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936127542 2:109802346-109802368 CAGGAAATTAAGAGGGAGGCAGG + Intronic
936217155 2:110569139-110569161 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936426295 2:112423722-112423744 CAGGAAATTAAGAGGGAGGCAGG - Intronic
936727947 2:115344921-115344943 AAGTAGAGTAAGAGAGAGGAAGG - Intronic
937079531 2:119130462-119130484 CAGGAGAGCAAGACTGAGGATGG - Intergenic
937380889 2:121375200-121375222 CAGGAGAGAGAGAGTGAAGAGGG - Intronic
937757382 2:125556768-125556790 CAGGAGAAACAGAGAGAGGCAGG - Intergenic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938797523 2:134730877-134730899 CAGGAGCAAAAGAGAGGGGAGGG - Intergenic
939321506 2:140628876-140628898 CAGGAGGAAGAGAGTGAAGAGGG - Intronic
939370053 2:141287234-141287256 GAGGAGAATGAGAATGAGAATGG - Intronic
939428626 2:142073822-142073844 CAGGAGGAAGAGAGAGAGGAAGG - Intronic
939438360 2:142208267-142208289 AAGGACAAGAAGAGTGAGAAAGG - Intergenic
939842828 2:147209063-147209085 GAGGAGAATAAGACAGAGAAAGG + Intergenic
940196013 2:151094845-151094867 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
940202562 2:151167459-151167481 CAGGAGCAAAAGAGTGAGGCAGG + Intergenic
940794540 2:158062986-158063008 CAGGAGAATAACAGAAAAGAGGG - Intronic
941989092 2:171537381-171537403 GAGGAGAAAAAGCATGAGGAGGG + Intronic
942539496 2:177001062-177001084 GAGGAGAAAATGAATGAGGACGG - Intergenic
942830862 2:180236545-180236567 CAGTAGAGTAAGACTGAGAAGGG - Intergenic
942868423 2:180705071-180705093 CAGAAATAAAAGAGTGAGGAAGG + Intergenic
943679103 2:190749080-190749102 CTGGAGGATGAGAGTGAGGCTGG + Intergenic
946115496 2:217458427-217458449 AAGGAGAATAAGAAAGAGGCTGG - Intronic
946685806 2:222268593-222268615 GAGGAGATTCAGAGTGAGGTAGG - Intronic
946937566 2:224737457-224737479 CAGGAGAGAGAGAGTGAAGAGGG - Intergenic
946964944 2:225027608-225027630 CAGGAGAAGGAGAGAGAGGGAGG - Intronic
947375362 2:229489812-229489834 CAGCAGGATAAGGATGAGGAAGG + Intronic
947488052 2:230570573-230570595 CAGGAGAGAAAGAGTGAAGGGGG + Intergenic
947520526 2:230842581-230842603 CAGGAGAACAGGAGTTAGGGAGG - Intergenic
947709090 2:232300396-232300418 CTGGAGACCAAGAGTGGGGAGGG - Intronic
948338254 2:237228336-237228358 CAGGAGAAAAGGAGGGAGTATGG + Intergenic
948461068 2:238130284-238130306 CAGGAGTATGAGAGTGAGCTGGG + Exonic
1168915525 20:1482554-1482576 AAGGAGAAAGAGAGAGAGGAAGG - Intronic
1169635848 20:7690559-7690581 AAGGAGCATAAGAGAGAGGGAGG - Intergenic
1169672729 20:8121306-8121328 CAGGAGAAAGAGGGAGAGGATGG + Intergenic
1170018201 20:11806745-11806767 CAGGAGGAAAAGAGTGAGAAGGG - Intergenic
1170215912 20:13891057-13891079 CAGAAGAAGAAGAGAGAGAAAGG + Intronic
1170941864 20:20854645-20854667 CAGGAGGAAAAGATTAAGGAGGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1172434785 20:34921301-34921323 CAGGGGAATGGGAGAGAGGAAGG - Intronic
1172477800 20:35252059-35252081 CAGGAAAAACAGAGTGAGGGTGG - Intronic
1173560600 20:44002755-44002777 CAGGAGAATGAGAGAGAGAGAGG + Intronic
1173578066 20:44126125-44126147 CAGAAGAAAAAGAGAGAGGGAGG + Intronic
1174523699 20:51154910-51154932 AAGTGGACTAAGAGTGAGGAAGG - Intergenic
1174716812 20:52767584-52767606 AAGGAGAACTAAAGTGAGGATGG - Intergenic
1174842697 20:53915261-53915283 AAGGAGAATAAGAGAGAGGGAGG + Intergenic
1174923231 20:54727644-54727666 AAGGAGAAAAACAATGAGGATGG - Intergenic
1175211084 20:57355771-57355793 TAGGAGAACAGGAGGGAGGATGG + Intronic
1175755207 20:61525300-61525322 CAGGAGAAAGAGGGTCAGGAGGG + Intronic
1176162831 20:63657205-63657227 CAGGAGAAAGAGAGAGAGAAGGG + Intergenic
1176224618 20:63989475-63989497 TAGGAAAATAAGAGTAAGTATGG + Intronic
1177085379 21:16696142-16696164 CAGGAGAGAGAGAGTGAAGAGGG + Intergenic
1177402625 21:20624996-20625018 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1177412446 21:20747719-20747741 CAGTAAAGTCAGAGTGAGGAAGG - Intergenic
1177763108 21:25425211-25425233 AAGGACAATAAGAGAGAGAAAGG + Intergenic
1177807655 21:25889733-25889755 CAGGAGGCTGAGAGTGAGGTAGG + Intronic
1177907132 21:26985391-26985413 GAGGAGAATAAGAGGAAGGATGG + Intergenic
1178730230 21:35095231-35095253 CAGGAGCAAAAGAGAGAGGAGGG + Intronic
1179055876 21:37933602-37933624 CAGGAGAAAGAGAGAGAGTAAGG - Intergenic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1180759628 22:18190448-18190470 AAGGAAAATAAGTGTGAAGAAGG + Intergenic
1180827881 22:18877704-18877726 AAGGAAAATAAGTGTGAAGAAGG + Intergenic
1181072036 22:20350264-20350286 AAGGAAAATAAGTGTGAAGAAGG - Intergenic
1181195111 22:21179209-21179231 AAGGAAAATAAGTGTGAAGAAGG - Intergenic
1181214335 22:21313565-21313587 AAGGAAAATAAGTGTGAAGAAGG + Intergenic
1181524792 22:23475187-23475209 AAGGAAAATAAGTGTGAAGAAGG + Intergenic
1182679282 22:32066139-32066161 AAGGAGAATAAGACTGTGAATGG - Intronic
1182818961 22:33196776-33196798 GAGGAGGAAAAGAGGGAGGAGGG + Intronic
1183615707 22:38944075-38944097 GAGGAGAAGGAGAGGGAGGAAGG - Intergenic
1184126659 22:42492103-42492125 CAGGAGGACAAGAGGCAGGACGG - Intergenic
1184429299 22:44431905-44431927 CAGGAGGTAAAGAGTGGGGAGGG + Intergenic
1184637713 22:45848246-45848268 CAGGAGGAAGAGAGTGAGGGTGG + Intergenic
949102541 3:163459-163481 AAGGAGAAGAAGATGGAGGAGGG - Intergenic
949127894 3:468499-468521 CAGGAGAATAAGAAAGAAAAAGG + Intergenic
949725643 3:7041268-7041290 CAGGAGAATTAGAGGGAGACAGG - Intronic
950698087 3:14719972-14719994 AAGGAGGACAAGAGAGAGGAGGG + Intronic
951610906 3:24492217-24492239 CTGGAAAATAAGAGTGAGTGAGG + Intronic
951932325 3:27982180-27982202 CAGGAGCATCAGTGTGAGGAAGG - Intergenic
952005154 3:28835264-28835286 CAAGACAATATCAGTGAGGAAGG + Intergenic
952494275 3:33902270-33902292 CAGGAGAGTAGGAGACAGGAAGG + Intergenic
952595470 3:35012550-35012572 GAGGAAAATAAGAGTGTGTAAGG + Intergenic
952690783 3:36202831-36202853 CAGGAGAATATCAGTGATTAAGG + Intergenic
953091153 3:39727184-39727206 CAGTAGCAAGAGAGTGAGGATGG + Intergenic
953098969 3:39807623-39807645 TAGGAGAATAGGAGGGAGAAAGG - Intergenic
953140013 3:40220796-40220818 CAGGAGGAAGAGAGTGAGGGAGG + Intronic
953434336 3:42866563-42866585 GAGGAGAGCAAGAGAGAGGAAGG - Exonic
954800556 3:53184779-53184801 CAGGAGAGCAAGAGAAAGGAGGG - Intronic
954903889 3:54043367-54043389 TAAGAGGATAAGAGTGAGGCTGG + Intergenic
955092026 3:55761971-55761993 CAGGAGAGAGAGAGAGAGGAAGG - Intronic
955240876 3:57176977-57176999 CAGGAGAGAGAGAGTGAGCAGGG + Intergenic
955947702 3:64210927-64210949 CAGAAGAATGAAAGTGGGGAAGG + Intronic
956765346 3:72480122-72480144 CAGGAGAAAGAGAGAGAGGGGGG - Intergenic
956815404 3:72903768-72903790 CAGGTGAATATGAGCGAGGCAGG + Intronic
959243426 3:103830064-103830086 AAGGAGAAGAAGAAGGAGGAAGG - Intergenic
959253737 3:103982682-103982704 CAGAAGACTAAGAGAGATGAAGG + Intergenic
960724878 3:120660063-120660085 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
960818719 3:121703470-121703492 GAGAAGAAAAAGAGTTAGGAAGG + Intronic
960931822 3:122859327-122859349 CAGTAGAAGAAGAGAGAGCAGGG + Intronic
961219396 3:125187763-125187785 CAGGGGAATCAGCATGAGGAGGG - Intronic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
962321726 3:134396161-134396183 CAGGAGACAAAGAGACAGGAAGG - Intergenic
962390309 3:134966210-134966232 CAAGAGAATGAGAGTGAGCCTGG + Intronic
962698584 3:137974980-137975002 GAGGAGAGTAAGAGAGAAGAGGG - Intergenic
962721045 3:138175093-138175115 CAGGAAGAAAAGAGTAAGGATGG - Intergenic
963444246 3:145383345-145383367 AAGGAGAAAAGGAGGGAGGAAGG + Intergenic
963763634 3:149310170-149310192 CAGGAGCAAAAGAGAGAGAAGGG - Intergenic
963774878 3:149428611-149428633 CAGGAGAAAGAGAGTGAGGGAGG + Intergenic
964256988 3:154786618-154786640 CAGGTGAATGGGAGAGAGGAAGG + Intergenic
964408046 3:156370510-156370532 CAGGACACTAAGAGGGATGAGGG + Intronic
964490145 3:157227574-157227596 CAGGAGCAAGAGAGTGAGGAGGG + Intergenic
964510407 3:157444113-157444135 CAGGAGAATACTAGTGTGGTGGG - Intronic
964910403 3:161773749-161773771 CTGGAGAATATGTGTAAGGATGG - Intergenic
965172168 3:165279838-165279860 GAGGAGAAGAAGAGAGAAGAAGG - Intergenic
965264904 3:166531061-166531083 AAGGAGAATTAGAGTGAAGAGGG + Intergenic
965349811 3:167598543-167598565 CAGGAGAAAGAGAGTGGGGTGGG - Intronic
965761618 3:172083684-172083706 CTGGATAATTAGAGTGAAGATGG + Intronic
966092245 3:176154239-176154261 AAGGAGGAAAAGAGTGAAGAAGG - Intergenic
966754226 3:183353590-183353612 CAGGAGGAAGAGAGTGAGGGAGG + Intronic
966869173 3:184278743-184278765 TAGAAGAATAAGAGGAAGGAAGG - Intronic
966930554 3:184672922-184672944 GAGGGAAGTAAGAGTGAGGATGG + Intronic
967316876 3:188158060-188158082 CAGGAGAATAAGGCTGGGTAGGG + Intronic
967703325 3:192620132-192620154 GAGGAGGATGAGAGTGAGGTCGG - Intronic
968779973 4:2573125-2573147 CACAAGAGTAAGAGTGAGGCGGG - Intronic
969140595 4:5067862-5067884 CAGGAGGATAAGAGAGAGGGAGG + Intronic
969682485 4:8651025-8651047 CAGGAGAAAAAGGCAGAGGAAGG + Intergenic
969828868 4:9779918-9779940 CAGGAGAAGAAGATAGGGGAAGG + Intronic
969861527 4:10039642-10039664 CAGGAGGATGACAGTGGGGATGG - Intronic
970390618 4:15607732-15607754 CAGGAGAATGGCAGTGAGGCAGG - Intronic
970421449 4:15909102-15909124 CAGGAGCAAAAGAGTGAGGGAGG + Intergenic
970738904 4:19209581-19209603 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
970750930 4:19359977-19359999 CCAGACAAGAAGAGTGAGGAAGG + Intergenic
970758407 4:19453633-19453655 CAGGAGAGAGAGAGTGAGAAGGG - Intergenic
970957103 4:21825859-21825881 CAGGAAAATGTGAGAGAGGATGG + Intronic
971382324 4:26110356-26110378 CAGGAGAGTAAGAGTCTGCAGGG - Intergenic
971594190 4:28507960-28507982 AAGGAGAATAAGATTGAATAGGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972255957 4:37355513-37355535 CAGGAGGAAAAGAGTAGGGAGGG + Intronic
972847300 4:43005143-43005165 CAGGAAAAAGAGAGTGAGGGGGG - Intronic
973542395 4:51947313-51947335 CAGGACCAAGAGAGTGAGGAGGG - Intergenic
973967157 4:56174937-56174959 CAAGAGAGAAAGAGTGAGGCGGG + Intronic
974099576 4:57402021-57402043 AAGGAGAGAAAGAGTGAGGGAGG + Intergenic
974469337 4:62297940-62297962 CAGGAGAGAGAGAGTGAGGGGGG + Intergenic
974556600 4:63459568-63459590 CAGGAGAGAAAGAGTGAAAAGGG + Intergenic
975273271 4:72464227-72464249 AAAGAAAATAAGAGTGAAGAAGG + Intronic
975293616 4:72706620-72706642 AAGGAGAATGAGAGGGAAGAAGG + Intergenic
975455171 4:74582019-74582041 TAGGTGAATAAAAGAGAGGAGGG + Intergenic
975475876 4:74822773-74822795 AGGGAGAATATGAGAGAGGAAGG - Intergenic
975607212 4:76167461-76167483 CAGGAGCAAGAGAGAGAGGAGGG - Intronic
976186722 4:82449506-82449528 CAGGAGCAAGAGAGTGGGGAGGG + Intronic
976400570 4:84602055-84602077 AAGGAAAATAAGAGTGTGAATGG - Intronic
976532891 4:86175578-86175600 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
976777174 4:88719532-88719554 GAGGAGAAAAAGATAGAGGAAGG - Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
977374213 4:96180571-96180593 CAGGGGAAGGAGAGAGAGGAGGG - Intergenic
978690568 4:111504539-111504561 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
979093889 4:116519997-116520019 CAGGAGAATGAAAGAGAAGAAGG + Intergenic
979876553 4:125898764-125898786 AAGGAGAAAAAGAGAAAGGAAGG - Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980273860 4:130622639-130622661 CAGGAGAGAGAGATTGAGGAGGG - Intergenic
980436601 4:132783819-132783841 CAGGAGAGAGAGAGTGAGGGTGG + Intergenic
980888502 4:138788909-138788931 CAGAAGAATTAGAGAAAGGAAGG + Intergenic
981251836 4:142612123-142612145 CAGGAGAAAAAAATAGAGGAAGG + Intronic
981307315 4:143260477-143260499 CAGGAGAAAAAGAGAGAGATGGG - Intergenic
981454758 4:144940567-144940589 CGGTAGAATAGGAATGAGGATGG - Intergenic
981634023 4:146854560-146854582 AAAGGGAGTAAGAGTGAGGACGG - Intronic
982215789 4:153081694-153081716 CAGGAGAACCAGAGTGTGGTGGG - Intergenic
982225860 4:153165771-153165793 AAGGAAAAGGAGAGTGAGGATGG - Intronic
983737046 4:171074497-171074519 CAGGAGAGCAAGAGTGAAGGAGG + Intergenic
983966450 4:173818817-173818839 CAGAACAAAAAGACTGAGGAAGG + Intergenic
984118238 4:175709225-175709247 GAGGAGGAGAAGAGGGAGGAAGG - Intronic
984228146 4:177060748-177060770 AGGGAGAATGATAGTGAGGAGGG - Intergenic
984256927 4:177400569-177400591 CAGGAGCAAGAGAGAGAGGAGGG + Intergenic
984265105 4:177488766-177488788 CAGGACAATAAGAGTAGAGATGG + Intergenic
984487694 4:180392895-180392917 CATGAGAATATGAGTGGGGAAGG - Intergenic
984915252 4:184717866-184717888 CAGGAAAACAAGTGTGAAGAAGG + Intronic
985119925 4:186630297-186630319 CAGGTGAGTAAGTATGAGGAAGG + Intronic
985189384 4:187355288-187355310 GATGAGAATAAGAATGAGAACGG - Intergenic
985993812 5:3585064-3585086 GAGGAGGAAAAGAGGGAGGAGGG + Intergenic
986093572 5:4534915-4534937 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
986777437 5:11030335-11030357 CAGGAGAAAAAAAGTGGGAAAGG - Intronic
986817978 5:11433616-11433638 CGGGAGCAAAAGAGTGAGAAAGG + Intronic
986827023 5:11532881-11532903 CAGGAGAAAAAGAAGGAGGGAGG + Intronic
986846650 5:11764102-11764124 CAGGAAAGTCAGAGTCAGGAAGG + Intronic
986995780 5:13605526-13605548 AAGAAGAATGAGAGTAAGGAGGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987178001 5:15336462-15336484 CAGGAGAATTTGAGTGAGAGTGG + Intergenic
987187986 5:15444665-15444687 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
988031530 5:25769730-25769752 CAGGAGAAAGAGAGTGAGTAGGG + Intergenic
988038338 5:25857263-25857285 CAGCAGAGAAAGAGAGAGGAGGG + Intergenic
988424850 5:31052018-31052040 AAGGAGAAAAAGTGTGAGGTGGG - Intergenic
988580063 5:32460945-32460967 CAGGAGCAAAAGAGAGAGCAGGG - Intergenic
988745287 5:34129114-34129136 CAGGAGAGAAAGAGTGTGAAGGG - Intergenic
988994536 5:36702091-36702113 AAGGAGAAAAAGAGAAAGGAAGG + Intergenic
990304337 5:54480120-54480142 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
990675444 5:58179048-58179070 CAGGAGAAGTAGAGAGAGAAGGG + Intergenic
990985655 5:61638764-61638786 CAAGAGAAGAAGGGTGAGCAGGG + Intronic
991085576 5:62645720-62645742 CAGGTGAATAAGAGGAAGGGAGG - Intergenic
991273518 5:64815366-64815388 CAGGAGGAAAAGAGTGATGAAGG + Intronic
991715470 5:69447324-69447346 AAGGAGAGAAAGAGAGAGGAAGG + Intergenic
992313595 5:75529255-75529277 CAGGAGCAAAAGAGAGAGGGGGG + Intronic
992411131 5:76506279-76506301 TATGAGAATGAGGGTGAGGAAGG - Intronic
992689055 5:79225684-79225706 CAGGAGGATAAGTGGAAGGATGG - Intronic
993174515 5:84466268-84466290 CAGGAGAATGAGAATGTGGTAGG + Intergenic
993594684 5:89838574-89838596 CAGGAGAAACAAAGTTAGGATGG + Intergenic
993875821 5:93305505-93305527 AAGGAGAAAAAGAGGGAGGAAGG + Intergenic
993881633 5:93369688-93369710 AAGGAGAAAAAGAGTGGGGCAGG - Intergenic
994736890 5:103566681-103566703 CAGGAGAATGAGGCTGAGGCAGG + Intergenic
995126622 5:108583298-108583320 CTAGAGAATAAAAGGGAGGAGGG + Intergenic
995306688 5:110659304-110659326 CAGCAGAAAAAGAATGAGAATGG + Intronic
995718208 5:115101611-115101633 CTGGAGCATAAGTGAGAGGAAGG - Intergenic
995752165 5:115463706-115463728 CAAGAAAATAAGCATGAGGAAGG + Intergenic
996600921 5:125262990-125263012 CAGGAGGAAACGAGTCAGGAAGG + Intergenic
996876980 5:128250862-128250884 CAGGAGGAAGAGAGAGAGGAGGG - Intergenic
996982818 5:129520158-129520180 CAGGAGACTTAGAGGCAGGAAGG - Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997100191 5:130959593-130959615 CAGGAGAGTAAGAGAAAGCAGGG - Intergenic
998775239 5:145592316-145592338 AAGGAGAATGACACTGAGGAAGG + Intronic
998960560 5:147481966-147481988 CAGGAGAATAATACTGATGTAGG + Intronic
999107649 5:149087680-149087702 CAGGAGCAAAAGAGAGAGAAAGG - Intergenic
1000325001 5:160165428-160165450 CAGCAGAAGAGCAGTGAGGAAGG + Intergenic
1000559393 5:162767158-162767180 CAGGAGCATATGAGCGAGGAGGG + Intergenic
1000642661 5:163721077-163721099 CAGGAGAATTATAGAGAGAATGG - Intergenic
1001569920 5:172723874-172723896 AAGGAGAGAAAGAGGGAGGAAGG + Intergenic
1002520959 5:179793111-179793133 CAGGAAACTCAGAGTGGGGAGGG - Intronic
1002676303 5:180916111-180916133 CAAGAGAGTAAGAAAGAGGAAGG + Intronic
1003529272 6:6924598-6924620 CAGGAGCAGGAGAGAGAGGAGGG - Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004458495 6:15813906-15813928 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1004819535 6:19352285-19352307 AAGGAAAAAAAGAGTGGGGAAGG - Intergenic
1005202886 6:23367009-23367031 CAGGAGTATGACTGTGAGGATGG - Intergenic
1005543410 6:26836862-26836884 CAGGAGAGAAAGAGTGTGAAGGG - Intergenic
1005626788 6:27669919-27669941 CAGAAGAAGATGAGTGTGGAAGG - Intergenic
1005995386 6:30927869-30927891 CAGGAAAATAAGATTGAAGGAGG - Intergenic
1006201222 6:32293327-32293349 CAAGAAAAGAAGAGTGAGGCAGG - Exonic
1007233926 6:40377093-40377115 CAGGAGAAAGAGAGGGAGGAGGG + Intergenic
1007925417 6:45646057-45646079 CAGGTGAGGAAGAGTAAGGAAGG + Intronic
1007969057 6:46032409-46032431 CAGGATAGTAAGATTGGGGAGGG + Intronic
1008849409 6:56006313-56006335 CAGAAGAAAAAGAGTGAAGGGGG - Intergenic
1009014235 6:57879031-57879053 CAGGAGAGAAAGAGTGTGAAGGG - Intergenic
1009449478 6:63784592-63784614 CAGGAGGAAAAGAGTGAAGGGGG + Intronic
1010332112 6:74635350-74635372 AAGGTGAGAAAGAGTGAGGAAGG - Intergenic
1010391448 6:75342897-75342919 CAGGAGAAAAAGAGTAAAAATGG - Intronic
1010659633 6:78555438-78555460 CAGGAGAGAAAGAGTGAAGGGGG + Intergenic
1010977905 6:82337295-82337317 CAGGAGAAGAAGAGAGAGGCTGG + Intergenic
1011216239 6:85008862-85008884 CAGGAGAAAGAGAGAGAGCATGG - Intergenic
1011438522 6:87363854-87363876 TAGGAGACTAAGAGTGAAAAAGG - Intronic
1012119590 6:95348149-95348171 CACTAAAATAAGATTGAGGAAGG + Intergenic
1012511715 6:100010134-100010156 CAGGAGAAAGAGAGTGAAGGGGG + Intergenic
1012607757 6:101179205-101179227 CAGGAGAGAAAAAGAGAGGAAGG - Intergenic
1012956803 6:105579810-105579832 CAGGAGAGAAAGAGTGAAGAGGG + Intergenic
1013080599 6:106808640-106808662 AAGGAGAAAAAGAGAGAGCAGGG - Intergenic
1013378684 6:109544539-109544561 CAGGAGAAAGAGAGTGAGGTGGG - Intronic
1013855989 6:114572584-114572606 CAGGAGAAAGAGAGTGAAGGAGG - Intergenic
1014143949 6:117974940-117974962 TAGGAGAATGAGAGTGATAAAGG + Intronic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1015654293 6:135499134-135499156 GAGGACAATATGAGTAAGGACGG - Intergenic
1015710141 6:136130327-136130349 CAGTAGAAAAGGAATGAGGAAGG - Intronic
1015890795 6:137967913-137967935 CTGGAGCATCAGAGTGATGATGG - Intergenic
1016870339 6:148809896-148809918 CAGCAGAATTGGGGTGAGGATGG - Intronic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017189847 6:151641342-151641364 CAGGAGCAAGAGAGAGAGGAAGG - Intergenic
1017262350 6:152402015-152402037 CAGGAGACCAACAGTGTGGAAGG + Intronic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1018347817 6:162921206-162921228 CAGGAGAGACAGAGTGGGGAGGG + Intronic
1019016772 6:168885685-168885707 CAGGTGACTGAAAGTGAGGAGGG + Intergenic
1019437098 7:1028009-1028031 CAGGAGAGTAAGTGGGAGGAGGG + Intronic
1021107565 7:16655667-16655689 CAGGAGAATAGGAGTGAGGTGGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021903018 7:25306349-25306371 CAGGAAGATATGTGTGAGGATGG - Intergenic
1021943744 7:25704974-25704996 AAGGAAAATGACAGTGAGGAGGG + Intergenic
1022243602 7:28535612-28535634 TAGGAGAGAAAGAGGGAGGAAGG + Intronic
1022452731 7:30530302-30530324 AAGGAGAATAAGACTGTGAATGG - Intronic
1023119984 7:36899407-36899429 CAGGTGAAGAAGAGGGAGAAGGG + Intronic
1023269474 7:38445938-38445960 CAGGAGGAAGAGAGAGAGGAGGG - Intronic
1024062283 7:45708178-45708200 TAGGAGACTAAGAGAGAGGCAGG - Intronic
1024157625 7:46640679-46640701 AAGGAGGAAAAGAGTGAAGAGGG + Intergenic
1024436793 7:49365884-49365906 GAGAAGAATGAGAGTGAGGGCGG - Intergenic
1024459924 7:49649428-49649450 CAAGAGCAAAAGAGTGAAGAGGG + Intergenic
1024654814 7:51442669-51442691 CAGGAAAATAAGAATTAGGGAGG + Intergenic
1025092302 7:56074252-56074274 CTGGAGAATAAGAGTCAAGCAGG - Intronic
1025939958 7:66068678-66068700 CAGGAGCAAGAGAGAGAGGAGGG + Intergenic
1026280749 7:68919796-68919818 CAGGAGGAAGAGAGAGAGGAGGG + Intergenic
1026475195 7:70729130-70729152 CAGGAGAAAAAGAGTGATGGAGG - Intronic
1026487613 7:70834990-70835012 CAGGAGCAGGAGAGTGAGGGGGG + Intergenic
1026494119 7:70888062-70888084 AAAGAGAAAAAGAGAGAGGAAGG + Intergenic
1026536266 7:71241202-71241224 GAGGAGAGAAAGAGTGAGAAAGG - Intronic
1026622932 7:71966518-71966540 CAGGAGACAGAGAGAGAGGAGGG - Intronic
1027513288 7:79110098-79110120 TAGGAGAGCAAGAGTGAAGAAGG + Intronic
1027837741 7:83266787-83266809 CAGGAGAAGAGGAGGGAGGGAGG + Intergenic
1027969901 7:85066239-85066261 AAGGAGAAAAAGAGAGAGAAAGG + Intronic
1028199712 7:87947039-87947061 CTGGGGACTAAGAGAGAGGAAGG + Intronic
1028714399 7:93948059-93948081 CAGGAGATTTAGTGTGAGCAAGG + Intergenic
1028870405 7:95765361-95765383 CTGGAAACTAAGAGGGAGGAGGG + Intergenic
1029157934 7:98530542-98530564 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1029184727 7:98730397-98730419 CAGGAGAAAGAGACAGAGGAAGG + Intergenic
1029476136 7:100785959-100785981 GAAGAGAAAGAGAGTGAGGAGGG - Intronic
1029484050 7:100828624-100828646 CACGAGAGTGAGAGTGAGAAGGG - Intronic
1030021203 7:105276952-105276974 CAGGAGAAGTAGAGTTAGGATGG - Intronic
1030695202 7:112577634-112577656 CAGGAGCAAGAGAGTGAAGAGGG + Intergenic
1030960387 7:115913090-115913112 AATGGGAATAAGGGTGAGGATGG - Intergenic
1031108005 7:117569252-117569274 GAGGAGACTAAGAGCCAGGAGGG + Intronic
1031288220 7:119899840-119899862 CAGGAGAAAAAGAGAGAGATGGG + Intergenic
1031310757 7:120194397-120194419 CAGGAAGAAAAGAGTGAGGGAGG - Intergenic
1031475517 7:122216428-122216450 TAGGAGAGTAGGAGTGTGGATGG + Intergenic
1031599197 7:123684938-123684960 CAGGAAAAGAAGATTGGGGAAGG - Intronic
1031630166 7:124034298-124034320 AAGGAGATAAAGAGGGAGGAAGG - Intergenic
1031878069 7:127164140-127164162 CAGGAGCAAGAGAGTGAGGGGGG - Intronic
1032248263 7:130231414-130231436 CAGGAGAAAGAGAGTGAAGTGGG + Intergenic
1032559535 7:132874300-132874322 CTGGAGAATAAGTTTGATGATGG - Intronic
1032621899 7:133542626-133542648 GGGGAGAATAGGACTGAGGAGGG + Intronic
1032902785 7:136329708-136329730 ACGGAGAATAGGAGTGAGAAAGG + Intergenic
1033144196 7:138856942-138856964 CAGAAGAAAAAGACAGAGGAAGG + Intronic
1033300392 7:140179475-140179497 CAGGAGCAAAAGAGAGAGGGAGG - Intergenic
1033844099 7:145411566-145411588 CAGGAGCATGACAGTGAGCATGG + Intergenic
1034193589 7:149229144-149229166 TAGGAGAATGAGATTGAGGATGG + Intergenic
1034210919 7:149361781-149361803 CAGGAGAACTAGAATTAGGAGGG + Intergenic
1034212031 7:149372431-149372453 CAGGAGGAAGAGAGTGAAGAAGG + Intergenic
1034485880 7:151362069-151362091 CAGGATAAAAAGATTGAGGGAGG - Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1034950047 7:155290880-155290902 CAGGAGAAGCCGTGTGAGGACGG - Intergenic
1035168932 7:157007286-157007308 GAGGAGAAAAAGAGGAAGGAAGG + Intronic
1035322128 7:158038213-158038235 CAGTGGAATAAAACTGAGGAGGG + Intronic
1035366987 7:158355434-158355456 CAGGAGAGTGAGAGAGAGGCAGG - Intronic
1035494183 7:159307644-159307666 TATGAGAATTGGAGTGAGGACGG + Intergenic
1035944959 8:3952240-3952262 CAGGAGAATAAGAGTGAGGAAGG - Intronic
1036221646 8:6926000-6926022 GAGGAGAACAGCAGTGAGGATGG + Exonic
1036223037 8:6936864-6936886 CAAGAGAATAGCAGCGAGGAGGG + Exonic
1036226233 8:6960126-6960148 CAGGAGAATGGCAGTGAGGAGGG + Intergenic
1036234824 8:7029454-7029476 CAGGAGAATGGCAGCGAGGAGGG + Intergenic
1036448727 8:8846288-8846310 GAGGAGGATAAGAAGGAGGAGGG + Intronic
1036598382 8:10236281-10236303 CAGGAGAATAAGAATGGGAGAGG + Intronic
1036971832 8:13364097-13364119 CAGGAGAATGAAAGAGAGAAAGG + Intronic
1036988579 8:13566248-13566270 AACGATATTAAGAGTGAGGACGG + Intergenic
1038596001 8:28887182-28887204 CAGGCAAAAAAGAGTGAGGCAGG + Intronic
1039028129 8:33280534-33280556 CAGGAAAATAGGAGAGTGGATGG - Intergenic
1039590305 8:38740733-38740755 CATGAGAATGAGAGTTAAGATGG - Intronic
1040377182 8:46837608-46837630 GAGCAGTATAAGGGTGAGGATGG + Intergenic
1040639086 8:49310822-49310844 AAAGAGAAAAAGAGAGAGGAGGG + Intergenic
1041106711 8:54452017-54452039 GAGGAGATTAAGATTGAGAAAGG - Intergenic
1041392361 8:57358445-57358467 CAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1043383709 8:79728724-79728746 CAGGAGGAAGAGAGTGAGGGGGG - Intergenic
1043500112 8:80845182-80845204 AATCAGTATAAGAGTGAGGAAGG - Intronic
1043675872 8:82952990-82953012 CAAGAGAGGGAGAGTGAGGAGGG - Intergenic
1043714967 8:83470677-83470699 CAGTAGAAAAAGAATGAGCAAGG - Intergenic
1044249540 8:89989778-89989800 CAGGAAAATAAGGGTGAAGAAGG - Intronic
1044281827 8:90365507-90365529 GAGAAGAAAAAGAGAGAGGAAGG - Intergenic
1044606619 8:94053631-94053653 CAGGAGAGCAGGAGTGAGCAGGG + Intergenic
1044871559 8:96625329-96625351 GAGGACAAGAGGAGTGAGGAAGG - Intergenic
1044878971 8:96702397-96702419 AGGGAGAATAAGAGAGAGAAAGG + Intronic
1045723779 8:105146228-105146250 AAGGAGAATGGGAGTGATGAAGG - Intronic
1046682126 8:117182157-117182179 CATGAGAAGGAGAGTGAGGTGGG + Intergenic
1047061141 8:121227501-121227523 CAGAAGAATGGAAGTGAGGATGG - Intergenic
1047189169 8:122662180-122662202 CAGGAGCATAAGAGTGAGGGGGG - Intergenic
1047783933 8:128135427-128135449 CTGGAGAAGAAGTGTGATGAAGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1049009029 8:139875154-139875176 CGGGGGAAGAAGAGAGAGGAGGG + Intronic
1049952576 9:659691-659713 CAGGAGAAAAAGAGGGAAGAAGG + Intronic
1050365656 9:4871257-4871279 CCTGAGAAGAAGAGTGAGAAAGG + Intronic
1050816787 9:9823322-9823344 CAAGAGAGAAAGAGTGAGGGCGG + Intronic
1050818492 9:9846868-9846890 CAGGAGAATTAAAGAGAGTAGGG + Intronic
1051001525 9:12288408-12288430 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1051160025 9:14197266-14197288 CAGGAGAGTGAGACTGAGAAAGG - Intronic
1051811432 9:21054084-21054106 CAGGAGAAAGAGAGAGAGAAAGG - Intergenic
1052017134 9:23482160-23482182 CAGAAGCATGGGAGTGAGGAAGG + Intergenic
1052284005 9:26763786-26763808 CAGAAGGAAAAGAGAGAGGAAGG - Intergenic
1052323911 9:27196726-27196748 CAGGAGCAGAAGAGTGAGGGGGG + Intronic
1052606637 9:30712371-30712393 AAGCAAAATAAGAGAGAGGAAGG + Intergenic
1052662848 9:31458093-31458115 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1053102257 9:35380888-35380910 TAGGAGAACAGGAGTGTGGAGGG - Intronic
1053296476 9:36918031-36918053 TAGGAGAAGAAGAGAGATGAGGG - Intronic
1053616264 9:39769700-39769722 CAGGAGAGAAAGAGTGAAGGGGG + Intergenic
1053684853 9:40511611-40511633 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1053874429 9:42529007-42529029 CAGGAGAGAAAGAGTGAAGGGGG + Intergenic
1053898183 9:42765580-42765602 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1053934816 9:43139894-43139916 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054237253 9:62572689-62572711 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1054267906 9:62937748-62937770 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1054278874 9:63113345-63113367 CAGGAGCATCGGAGAGAGGAGGG + Intergenic
1054297945 9:63347074-63347096 CAGGAGCATCGGAGAGAGGAAGG - Intergenic
1054395962 9:64651592-64651614 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054430606 9:65156787-65156809 CAGGAGCATCGGAGAGAGGAGGG - Intergenic
1054499774 9:65864734-65864756 CAGGAGCATCGGAGAGAGGAGGG + Intergenic
1054551388 9:66607200-66607222 CAGGAGAGAAAGAGTGAAGGGGG - Intergenic
1055124743 9:72706197-72706219 CAGGAGAGAAAGGGTGAGAATGG - Intronic
1055143547 9:72904723-72904745 CCAGAGTATAAGAGTCAGGATGG - Intronic
1056789915 9:89618593-89618615 CAGGAGAAGCGGTGTGAGGAGGG - Intergenic
1056835642 9:89953146-89953168 CAAGAGAAAAAGAGAGGGGAGGG - Intergenic
1057406563 9:94776719-94776741 CTGGAGAATATGGGTGCGGAAGG - Intronic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058429027 9:104901554-104901576 CAAAGGAATAAGAGTAAGGACGG + Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1059351103 9:113665654-113665676 CTGAAGAAAAAGAGAGAGGATGG - Intergenic
1059588816 9:115635264-115635286 CAGGAGCACAAGACAGAGGAAGG - Intergenic
1059635048 9:116162108-116162130 GAGGGGAATAAAAGTGATGAGGG + Intronic
1059714707 9:116903191-116903213 CAGGGGCTTAAGAGTGATGATGG - Intronic
1060123708 9:121021174-121021196 CAGGGGATTAAAAGTGAGGGGGG + Intronic
1060648907 9:125307170-125307192 CAGGAGAATCACAGTGGGGGAGG + Intronic
1060859044 9:126938886-126938908 CAGGAGTAGAGGAGGGAGGAGGG + Intronic
1062112752 9:134790985-134791007 CAGGAGCATGGGAGTGAGCAAGG - Intronic
1062608277 9:137358574-137358596 CAAGAGAATAAGAGGGGAGACGG - Intronic
1185668080 X:1784027-1784049 CAAAAGAAGAAAAGTGAGGAAGG + Intergenic
1185680071 X:1881252-1881274 AAGGAAAATAAGAGGAAGGAAGG + Intergenic
1186086463 X:5995839-5995861 CAGAAAAGAAAGAGTGAGGATGG - Intronic
1186830997 X:13390116-13390138 CAGGAGCAAGAGAGTGAGGGAGG - Intergenic
1187114413 X:16334463-16334485 CAGGAGCAACAGAGTGAGGCAGG + Intergenic
1187204896 X:17172404-17172426 CAGGAGAAAGAGAGTGAAGGGGG - Intergenic
1187634271 X:21210076-21210098 CAGGAGAAAGAGAATGAGGGCGG - Intergenic
1187731942 X:22264282-22264304 CTGGAGAATGGGAGGGAGGATGG - Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188538080 X:31219404-31219426 GTGGAGAATAAGAGAGAGGGCGG - Intronic
1189120914 X:38393978-38394000 CTAGAGAATAAGAGAGAGGCAGG - Intronic
1190048010 X:47128002-47128024 CAGGAGAAGGAGAGAGAGGTAGG + Intergenic
1190432284 X:50389834-50389856 CAGGAGAATAAGAAAGGGGAGGG - Intronic
1190824306 X:54002920-54002942 CATGAGAATAAGGGTGAAAAAGG - Intronic
1191724069 X:64260308-64260330 CAGGAGCAGGAGAGTGAAGAGGG - Intergenic
1192140651 X:68644928-68644950 CAGGACAAGACGAGAGAGGAAGG + Intergenic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192397102 X:70793523-70793545 CAGAAGAAAGAGAGTGAGGGTGG - Intronic
1193186825 X:78523239-78523261 CAGGAGGAAAAGAGTGATGAGGG + Intergenic
1193274567 X:79570579-79570601 CTGGAGAATATGGGTGGGGAGGG + Intergenic
1193428368 X:81368949-81368971 AAGGTGAGTAAGAGTGAGGAAGG - Intergenic
1194200473 X:90948776-90948798 CAGGAGAAAGAGAGGGAGGGAGG - Intergenic
1194402238 X:93452775-93452797 CAGGAGCAAGAGAGAGAGGAGGG - Intergenic
1194453720 X:94077047-94077069 CAGGAGAAAGAAAGTGAAGAAGG - Intergenic
1194744099 X:97609583-97609605 TAGGAGAAAAAGGGTGAGGCTGG - Intergenic
1195348712 X:103976678-103976700 TAGGAGAATGAGAGTGAAAAGGG - Intergenic
1195356073 X:104040781-104040803 TAGGAGAATGAGAGTGAAAAAGG - Intronic
1195358730 X:104062162-104062184 TAGGAGAATGAGAGTGAAAAGGG + Intergenic
1195570876 X:106397435-106397457 CAGGAGCAAAAGAGAGATGAGGG - Intergenic
1196758098 X:119175803-119175825 CAGGACAAGAAGGGAGAGGAGGG - Intergenic
1196855888 X:119983903-119983925 CAGGAGATTAAGATTTAGGGTGG + Intergenic
1197098635 X:122625182-122625204 CAGGAGGAAAAGAGAGAGGGAGG + Intergenic
1197375654 X:125678979-125679001 CTGAAGAATAAAAGTGATGAAGG + Intergenic
1198036285 X:132804470-132804492 CAGGAGAAGAGCAGTGAGTATGG - Intronic
1198173950 X:134136082-134136104 CAGGAGAGAAAGAGTGAGGGGGG - Intergenic
1198321584 X:135522370-135522392 CAGGAGAAAAGTAGGGAGGACGG + Intronic
1198596797 X:138244917-138244939 CAGGAAAGAAAGAGTGAGGGGGG - Intergenic
1198631261 X:138641318-138641340 GAGGAGAAGAAGAGAGAGGTGGG - Intronic
1198801944 X:140457194-140457216 CAGGAAAAAAAGAGAGAGGGTGG - Intergenic
1199239416 X:145528970-145528992 CAGGAGCAAGAGAGTGAGGTGGG - Intergenic
1199301132 X:146215346-146215368 CCTGAGAAAAAGAGTGATGAGGG + Intergenic
1199394492 X:147318818-147318840 TAGGAGAATGGGATTGAGGAAGG - Intergenic
1199420923 X:147643884-147643906 CAGGGGAAAGAGAGTGAAGAGGG - Intergenic
1199661336 X:150053710-150053732 AAGGAGAATGAGAGGGATGATGG - Intergenic
1200692078 Y:6316450-6316472 GAAGAGAATAAGAAAGAGGAAGG + Intergenic
1200713636 Y:6512489-6512511 GAAGAGAATAAGAAAGAGGAAGG - Intergenic
1200894921 Y:8365098-8365120 GAGCAGCATAAGGGTGAGGATGG - Intergenic
1200982915 Y:9278610-9278632 CAGGAAAATATGAGTCAGGCTGG - Intergenic
1201020291 Y:9649552-9649574 GAAGAGAATAAGAAAGAGGAAGG + Intergenic
1201043194 Y:9858277-9858299 GAAGAGAATAAGAAAGAGGAAGG - Intergenic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic
1202240924 Y:22768534-22768556 TAGGAGAAAAAGAGCAAGGATGG + Intergenic
1202365829 Y:24163701-24163723 AAGGAGAATAAGACTGTGAATGG + Intergenic
1202393910 Y:24402277-24402299 TAGGAGAAAAAGAGCAAGGATGG + Intergenic
1202476875 Y:25267815-25267837 TAGGAGAAAAAGAGCAAGGATGG - Intergenic
1202504953 Y:25506421-25506443 AAGGAGAATAAGACTGTGAATGG - Intergenic
1202590760 Y:26480839-26480861 CAGGAGAAGAAAGGGGAGGAGGG + Intergenic