ID: 1035944964

View in Genome Browser
Species Human (GRCh38)
Location 8:3952285-3952307
Sequence AGGCTACGCGAAAGGTGTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035944961_1035944964 3 Left 1035944961 8:3952259-3952281 CCTGAGCACACAGTAAATACTTC No data
Right 1035944964 8:3952285-3952307 AGGCTACGCGAAAGGTGTCGTGG No data
1035944960_1035944964 18 Left 1035944960 8:3952244-3952266 CCTCACTCTTATTCTCCTGAGCA No data
Right 1035944964 8:3952285-3952307 AGGCTACGCGAAAGGTGTCGTGG No data
1035944959_1035944964 22 Left 1035944959 8:3952240-3952262 CCTTCCTCACTCTTATTCTCCTG No data
Right 1035944964 8:3952285-3952307 AGGCTACGCGAAAGGTGTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035944964 Original CRISPR AGGCTACGCGAAAGGTGTCG TGG Intronic