ID: 1035944964 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:3952285-3952307 |
| Sequence | AGGCTACGCGAAAGGTGTCG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1035944961_1035944964 | 3 | Left | 1035944961 | 8:3952259-3952281 | CCTGAGCACACAGTAAATACTTC | No data | ||
| Right | 1035944964 | 8:3952285-3952307 | AGGCTACGCGAAAGGTGTCGTGG | No data | ||||
| 1035944960_1035944964 | 18 | Left | 1035944960 | 8:3952244-3952266 | CCTCACTCTTATTCTCCTGAGCA | No data | ||
| Right | 1035944964 | 8:3952285-3952307 | AGGCTACGCGAAAGGTGTCGTGG | No data | ||||
| 1035944959_1035944964 | 22 | Left | 1035944959 | 8:3952240-3952262 | CCTTCCTCACTCTTATTCTCCTG | No data | ||
| Right | 1035944964 | 8:3952285-3952307 | AGGCTACGCGAAAGGTGTCGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1035944964 | Original CRISPR | AGGCTACGCGAAAGGTGTCG TGG | Intronic | ||