ID: 1035950560

View in Genome Browser
Species Human (GRCh38)
Location 8:4016008-4016030
Sequence TGTCCAAGGCTGAAAGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 716
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 668}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035950560_1035950562 16 Left 1035950560 8:4016008-4016030 CCACTGTCTTTCAGCCTTGGACA 0: 1
1: 0
2: 3
3: 44
4: 668
Right 1035950562 8:4016047-4016069 AGAGAATGTGATTCCATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035950560 Original CRISPR TGTCCAAGGCTGAAAGACAG TGG (reversed) Intronic
900784810 1:4642376-4642398 TGTCTAATGCTGAAAGCCATTGG + Intergenic
901034419 1:6327811-6327833 TGTCCCAGGCTGAAGTGCAGTGG + Intronic
901284036 1:8062304-8062326 TGGCCCAGGCTGAAGTACAGTGG + Intergenic
901430149 1:9209214-9209236 TGTCCCAGGCTGGAGGACCGGGG + Intergenic
901701897 1:11049377-11049399 TGTCCCAGGCTGGAGGGCAGTGG + Intergenic
901842293 1:11961342-11961364 TTTCCCAGGCTGGAACACAGTGG - Intronic
901882075 1:12199801-12199823 TGTCCCAGGCAGAAAGAAGGAGG - Intronic
902060554 1:13638559-13638581 AGTGCTAGGCTGAAACACAGTGG + Intergenic
902447637 1:16477066-16477088 TGTCTATGGCTGCAGGACAGAGG + Intergenic
902871826 1:19318280-19318302 TGTCAAAGTCTGGAGGACAGAGG - Intronic
903844599 1:26271000-26271022 TCTTGCAGGCTGAAAGACAGTGG - Exonic
904520480 1:31091439-31091461 TCACCCAGGCTGAAATACAGTGG - Intergenic
904600646 1:31670933-31670955 TGGGCAAGGCTGAAAGAAATGGG - Intronic
904634026 1:31865740-31865762 TGGCCCAGGCTGAAGTACAGTGG - Intergenic
904675692 1:32198031-32198053 TGTGCAAGGCGGAAAGGCTGGGG - Exonic
905042856 1:34974765-34974787 TCTCCAAGGCTGAAGTGCAGTGG + Intergenic
905563428 1:38944895-38944917 TATCCAGGGATGAATGACAGTGG + Intergenic
905711310 1:40106668-40106690 TGGCCCAGGCTGGAACACAGTGG - Intergenic
906131454 1:43460957-43460979 TGTCCCAGGCTGGAGTACAGTGG - Intergenic
906340876 1:44979616-44979638 CGTCCAAGGCTGGAGTACAGTGG - Intronic
906614016 1:47222974-47222996 TGTGCAGGGCTGAGAGGCAGGGG - Intronic
907924103 1:58939978-58940000 AGTCCAAGGCACAAAGTCAGAGG - Intergenic
908579230 1:65496528-65496550 TGGCCAAGGCTGGAATGCAGTGG - Intronic
910142831 1:84045280-84045302 TGTCCCAGGCTGGAACGCAGTGG + Intergenic
910225302 1:84930221-84930243 TTTCCCAGGCTGGAGGACAGTGG - Intronic
910372388 1:86530742-86530764 TCTCCTAGGCTGAAATGCAGTGG + Intergenic
910467684 1:87517663-87517685 TCTCCAAGGGTGAAAGAGACAGG - Intergenic
910498427 1:87860325-87860347 TGACCCAGGCTGAAAAACATAGG + Intergenic
911539691 1:99144060-99144082 TGTCCAAGGCTTAAAGTCACTGG - Intergenic
911615667 1:100007989-100008011 TGTCCCAGGCTGGAAGGCAGTGG + Intronic
912335590 1:108859503-108859525 TGTCCCAGGCTGGAGTACAGTGG + Intronic
912369546 1:109163432-109163454 TTTCCTAGGCTGAAGTACAGAGG + Intronic
912405156 1:109431534-109431556 TGGCCAAATGTGAAAGACAGAGG + Intergenic
912813149 1:112809161-112809183 TGACCCAGGCTGGAATACAGTGG - Intergenic
913321757 1:117593549-117593571 TCACCAAGGCTGGAAGACAGTGG - Intergenic
914338278 1:146736890-146736912 TTACCCAGGCTGAAATACAGTGG + Intergenic
915133778 1:153715163-153715185 TGGCCCAGGCTGAAGTACAGTGG + Intergenic
915159632 1:153908834-153908856 TCCCCAAGGCTGGAACACAGTGG + Intronic
915167626 1:153957471-153957493 TTTCCAAGGCTGGAGGTCAGAGG - Intronic
915181503 1:154065034-154065056 TCTCCCAGGCTGGAATACAGTGG - Intronic
915432593 1:155878201-155878223 TTGCCCAGGCTGAAGGACAGTGG - Intronic
916020918 1:160791498-160791520 TGACCAAGGCTGAAGTGCAGTGG - Intergenic
916964140 1:169917903-169917925 AGTCCAAGGCTGGAAGTCTGAGG - Intergenic
917469488 1:175314338-175314360 TGACCAAAGCTGAGAGGCAGTGG + Intergenic
917653823 1:177105954-177105976 TCTCCCAGGCTGAAATGCAGTGG - Intronic
917949081 1:180010639-180010661 TGTCCCAGGCTGGAGCACAGTGG + Intronic
919092782 1:192994384-192994406 TGTCCAGGAATGAATGACAGAGG + Intergenic
919304141 1:195808349-195808371 TCACCAAGGCTGAAATACAGTGG - Intergenic
919818693 1:201458857-201458879 TGTCCCAGGCTGGAGTACAGTGG - Intergenic
920722550 1:208401126-208401148 TTGCCTAGGCTGAAACACAGTGG - Intergenic
921087225 1:211806218-211806240 TTTCCCAGGCTGTAATACAGTGG - Intronic
921146142 1:212358766-212358788 CATACAAAGCTGAAAGACAGAGG + Exonic
921496581 1:215849774-215849796 TGTCAAATGTTGAAAGACAATGG + Intronic
921600726 1:217103616-217103638 TCACCAAGGCTGGAATACAGTGG - Intronic
922564357 1:226591838-226591860 TTTCCTAGGCTGAAAGAGTGAGG + Intronic
923560246 1:235034524-235034546 TCGCCCAGGCTGAAATACAGTGG + Intergenic
923603189 1:235421373-235421395 TCTCCCAGGCTGAAGTACAGTGG - Intronic
923792722 1:237126195-237126217 TGGCCAAGGCTGGAGTACAGTGG - Intronic
923929662 1:238680862-238680884 TCTCCAAGGCTGGAGGGCAGTGG - Intergenic
923998036 1:239518741-239518763 TCTCCTTGTCTGAAAGACAGAGG + Intronic
1063669513 10:8088555-8088577 TCTCCAAGGCTGGAGTACAGTGG - Intergenic
1064073796 10:12252614-12252636 TCTCCCAGGCTGGAATACAGTGG + Intergenic
1064566992 10:16650617-16650639 TCTCCCAGGCTGGAATACAGTGG + Intronic
1064973718 10:21091663-21091685 TGTCCAAGGCTGAAGTACAGTGG + Intronic
1065032610 10:21603090-21603112 TTTCCCAGGCTGAAATGCAGTGG + Intronic
1065173111 10:23051509-23051531 TTTCAAAGGCAGAAAGGCAGAGG - Intergenic
1065181884 10:23134451-23134473 TTGCCCAGGCTGAAAGGCAGTGG - Intergenic
1065182787 10:23143891-23143913 AGACCTAGGCTGAAAGCCAGAGG + Intergenic
1065428217 10:25627706-25627728 TGTCCAAGCCTGAAACCCATGGG - Intergenic
1065582166 10:27182701-27182723 TTTCCCAGGCTGAAATGCAGTGG - Intronic
1065732602 10:28722950-28722972 TGGCCCAGGCTGAAAGACCTTGG + Intergenic
1066118113 10:32258068-32258090 TCACCAAGGCTGGAATACAGTGG + Intergenic
1066559944 10:36659490-36659512 TGGCCCAGGCTGAAATGCAGTGG + Intergenic
1066976637 10:42374571-42374593 TCTCCCAGGCTGGAATACAGTGG - Intergenic
1067048319 10:42998288-42998310 TGTCCCAGTCTGAAGGCCAGGGG - Intergenic
1067091788 10:43270442-43270464 TCTCCCAGGCTGGAGGACAGTGG + Intergenic
1067136396 10:43611074-43611096 TTTCCTAGGCTGAAGTACAGTGG + Intronic
1067573961 10:47395562-47395584 TCTCCCAGGCTGAAATGCAGTGG + Intergenic
1067815332 10:49471239-49471261 TTTCCAAGGCTGAAAGTTTGGGG - Intronic
1068302995 10:55170187-55170209 TGACCCAGGCTGAAGTACAGTGG + Intronic
1068639668 10:59389156-59389178 TCTCCAAGGCTGGAGGGCAGTGG + Intergenic
1068704307 10:60056427-60056449 TCACCCAGGCTGAAATACAGTGG - Intronic
1070100086 10:73377528-73377550 TCACCCAGGCTGAAATACAGTGG - Intronic
1070255109 10:74807328-74807350 TGTCCCAGGCTGGAGGGCAGTGG - Intergenic
1070291219 10:75116137-75116159 TCTCCCAGGCTGGAATACAGTGG + Intronic
1072501813 10:96025325-96025347 TTGCCCAGGCTGAAACACAGTGG - Intronic
1072663036 10:97374207-97374229 TGGCCTAGGCTGGAATACAGTGG + Intronic
1073160041 10:101385156-101385178 TGTCCCAGGCTGGAATGCAGCGG - Intronic
1075185885 10:120256672-120256694 TAGCCCAGGCTGGAAGACAGTGG - Intergenic
1077035336 11:491682-491704 TGTCCCAGGCTGGCAGACACTGG + Intergenic
1077035348 11:491738-491760 TGTCCCAGGCTGGCAGACACTGG + Intergenic
1077035360 11:491794-491816 TGTCCCAGGCTGGCAGACACTGG + Intergenic
1077035372 11:491850-491872 TGTCCCAGGCTGGCAGACACTGG + Intergenic
1077035384 11:491906-491928 TGTCCCAGGCTGGCAGACACTGG + Intergenic
1077422900 11:2461262-2461284 TCTCCAAGGCTGAAGAAAAGGGG - Intronic
1078476260 11:11632944-11632966 TGTTCAAGGCGGAAAGACACTGG + Intergenic
1078615955 11:12866604-12866626 GGCCCAGGGCTGAAAGTCAGGGG - Intronic
1079154754 11:17935427-17935449 TTTCCCAGGCTGGAATACAGTGG - Intronic
1080015050 11:27495925-27495947 TCTCCCAGGCTGGAACACAGTGG - Exonic
1080472781 11:32562270-32562292 TCTCCCAGGCTGAAGTACAGTGG + Intergenic
1080921452 11:36713403-36713425 TCTCCCAGGCTGAAATGCAGTGG - Intergenic
1081040022 11:38198650-38198672 TGTAAAAGTCTAAAAGACAGAGG + Intergenic
1081232228 11:40599406-40599428 TCTCCCAGGCTGAAATGCAGTGG - Intronic
1081336789 11:41876415-41876437 TCACAAAGGCTGAAAGAAAGAGG + Intergenic
1083249139 11:61454029-61454051 TTTCCAACCCTGAAAGACCGTGG - Intronic
1083411111 11:62493049-62493071 TGTCCCAGGCTGGAGGGCAGTGG + Intronic
1083444165 11:62696332-62696354 TGTCACAGGCTGGAAGGCAGTGG + Intronic
1083650074 11:64198096-64198118 TCACCCAGGCTGAAAGACAGTGG + Intronic
1083685768 11:64374170-64374192 TGTCCAAGGCTGGAGTGCAGGGG + Intergenic
1083740386 11:64707345-64707367 TCTCCAAGGCTGGAGTACAGTGG - Intronic
1083941158 11:65896664-65896686 TGCCCAAGGCTGAAAGTGATAGG - Intronic
1083974047 11:66102868-66102890 TGTCCCAGGCTGGAGTACAGTGG + Intronic
1084217701 11:67659198-67659220 TAGCCAAGGCGGAGAGACAGAGG + Intergenic
1084767055 11:71319021-71319043 TGACCCAGGCTGAAGTACAGTGG + Intergenic
1085538337 11:77241596-77241618 TCACCCAGGCTGAAAGGCAGTGG - Intronic
1085742364 11:79088206-79088228 TCTCCAGGGCTGAAACCCAGAGG + Intronic
1086020092 11:82217118-82217140 CGACAAAGGCTGAAAGCCAGAGG - Intergenic
1087047179 11:93851798-93851820 TTTTCAAGGCAGAAAGAAAGGGG - Intergenic
1087708472 11:101521832-101521854 TGTACAAGTCTGAAACCCAGCGG - Intronic
1088321486 11:108558518-108558540 CTTCCCAGGCTGAAATACAGAGG - Intronic
1088504622 11:110515911-110515933 TGTCCCAGGCTGGAGTACAGTGG - Intergenic
1089048276 11:115523047-115523069 TTTCCCAGGCTGGAATACAGTGG - Intergenic
1089164473 11:116464466-116464488 AGTCCAAGCCTGAAGGCCAGAGG - Intergenic
1089206480 11:116767931-116767953 TTGCCCAGGCTGAAATACAGTGG - Intronic
1090800577 11:130169132-130169154 TGTCCCAGGCTGGAGTACAGCGG + Intronic
1091466706 12:691054-691076 TCTCCCAGGCTGAAATGCAGTGG - Intergenic
1091479550 12:813191-813213 TGACCAAGGCTGGAATGCAGCGG - Intronic
1092447390 12:8569740-8569762 TTGCCAAGGCTGAAATGCAGTGG - Intergenic
1093018340 12:14177376-14177398 TCACCCAGGCTGAAGGACAGTGG + Intergenic
1093866898 12:24238389-24238411 TTGCCCAGGCTGAAATACAGGGG + Intergenic
1094862089 12:34478859-34478881 TGTCTAATGTTGACAGACAGTGG - Intergenic
1095206720 12:39446747-39446769 TTGCCCAGGCTGAAATACAGTGG + Intergenic
1095870634 12:47023871-47023893 TGGCCCAGGCTGGAATACAGTGG + Intergenic
1096197749 12:49659448-49659470 TGGCCCAGGCTGGAATACAGTGG + Intronic
1096997218 12:55846157-55846179 TCTCCCAGGCTGGAAAACAGTGG + Intergenic
1098921579 12:76306905-76306927 TACCCAAGGCTGGAAGACATAGG + Intergenic
1099930284 12:89066310-89066332 TCTCCCAGGCTGAAAGGCAGTGG - Intergenic
1100074810 12:90766756-90766778 TTTCCCAGGCTGGAACACAGCGG + Intergenic
1100483719 12:95004412-95004434 TCACCCAGGCTGAAATACAGTGG + Intergenic
1100708833 12:97231673-97231695 TGTCCAAATCTGACAGACAATGG + Intergenic
1100725255 12:97401439-97401461 TATCCCAGGCTGGAATACAGTGG - Intergenic
1100733414 12:97499076-97499098 GGTCCCAGGCTTAGAGACAGAGG - Intergenic
1101127482 12:101651892-101651914 TTTCCCAGGCTGAAATGCAGTGG - Intronic
1101329244 12:103744181-103744203 TCACCCAGGCTGAAATACAGTGG + Intronic
1102256744 12:111419595-111419617 TCACCAAGGCTGGAATACAGTGG - Intronic
1102333185 12:112053397-112053419 TGTCCAAGGCTGGTAGGGAGAGG - Intronic
1102368925 12:112364689-112364711 TGTCCATGGCTGGAGGGCAGTGG - Intronic
1102411766 12:112726152-112726174 TTTCCCAGGCTGAAATGCAGTGG + Intronic
1102926807 12:116832942-116832964 TTGCCCAGGCTGAAATACAGTGG + Intronic
1103119977 12:118372426-118372448 GGTCCAAGACTGAAAGTCTGAGG - Intronic
1103258660 12:119565291-119565313 TCTCCAAGGCTGGAGGGCAGTGG - Intergenic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1104002608 12:124869693-124869715 TGGCCCAGGCTGGAATACAGTGG + Intronic
1104274252 12:127310173-127310195 GGTCAAAGGCTTAAAGACAAAGG + Intergenic
1105203196 13:18195922-18195944 TCTCCAAGGCTGGAGGGCAGTGG + Intergenic
1105224454 13:18417021-18417043 TGACCAAGGCTAAAAGGAAGGGG - Intronic
1105479586 13:20762057-20762079 TTACCCAGGCTGAAATACAGTGG - Intronic
1105674005 13:22650604-22650626 TGGCTAAGGCTGAGAAACAGGGG + Intergenic
1105914425 13:24899920-24899942 TCGCCCAGGCTGAAATACAGTGG - Intronic
1106291803 13:28370142-28370164 TGGCCCAGGCTGGAAGGCAGTGG - Intronic
1106393046 13:29354365-29354387 TCTCCAAGGGTGAAAAATAGTGG - Intronic
1106556406 13:30812370-30812392 TCCCCAAGGCTGGAATACAGGGG + Intergenic
1106592127 13:31106877-31106899 TTTCCCAGGCTGAAGTACAGTGG - Intergenic
1106710354 13:32324675-32324697 TTTCCCAGGCTGGAATACAGTGG + Intronic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1108625571 13:52225212-52225234 TGTCCCAGGCTGTAGCACAGCGG - Intergenic
1108660493 13:52581207-52581229 TGTCCCAGGCTGTAGCACAGCGG + Intergenic
1108884474 13:55163368-55163390 TTTCCAAGACAAAAAGACAGAGG - Intergenic
1109380768 13:61557108-61557130 TCACCCAGGCTGAAATACAGTGG - Intergenic
1110166458 13:72448652-72448674 TGTGCAAGTCTGAAATCCAGTGG - Intergenic
1110210907 13:72972072-72972094 TCTCCCAGGCTGGAATACAGTGG + Intronic
1111001675 13:82192524-82192546 TCACCAAGGCTGGAATACAGTGG - Intergenic
1111750310 13:92321561-92321583 TGTCCCAGGCTGAAGTGCAGTGG - Intronic
1112360459 13:98713094-98713116 TCGCCTAGGCTGAAATACAGTGG + Intronic
1112915020 13:104537640-104537662 TGTTCATGGCTGAAAGAATGGGG + Intergenic
1113283327 13:108815414-108815436 TGTTCTTGGCTGAGAGACAGAGG + Intronic
1114321964 14:21554394-21554416 TCTCCCAGGCTGAAATGCAGTGG - Intergenic
1114632129 14:24165833-24165855 TGACCAAGTCTGAAAGAGAAAGG - Exonic
1114641298 14:24223586-24223608 TGTCCCAGCCTGGAACACAGTGG + Intronic
1115376653 14:32683984-32684006 TGCCCAAGTCTGAAATACGGAGG - Intronic
1115817756 14:37181125-37181147 TCTCCCAGGCTGGAATACAGTGG + Intergenic
1118020728 14:61711005-61711027 TGCCCAAGGCTGAAGTACAGTGG - Intronic
1118204933 14:63714110-63714132 AGTCCAAGGCTGAAAGCCTCAGG - Intronic
1118254585 14:64194330-64194352 TGGCCCAGGCTGGAATACAGTGG + Intronic
1118276588 14:64391034-64391056 TGTCCAAGGGTGAATGGCAATGG + Intronic
1119093251 14:71804569-71804591 TGTCCAAGTCTGAAAAACACAGG - Intergenic
1119872309 14:78028192-78028214 TGGCCCAGGCTGGAATACAGTGG + Intergenic
1120061943 14:79993779-79993801 TGTCAAAGGCTGGAGGAAAGAGG - Intergenic
1121146431 14:91587074-91587096 TGGACAAGGCTTAAAGACAGGGG - Intronic
1121755374 14:96398214-96398236 TGTCCAAGCCTGACAGCCCGCGG + Exonic
1122139029 14:99651207-99651229 TCACCAAGGCTGGAATACAGTGG - Intronic
1122253337 14:100456995-100457017 TCTCCCAGGCTGAAATGCAGTGG + Intronic
1123165410 14:106320701-106320723 TGTCCCTGGCTGAAACACAATGG + Intergenic
1123410291 15:20053267-20053289 TTTCCCAGGCTGAAGGGCAGTGG + Intergenic
1123519624 15:21059974-21059996 TTTCCCAGGCTGAAGGTCAGTGG + Intergenic
1124725172 15:32150089-32150111 TCTCCTAGGCTGGAGGACAGTGG + Intronic
1124818677 15:33020972-33020994 TGGCCAAGGCTTAAAGCCATAGG - Intronic
1124838935 15:33223914-33223936 TCACCCAGGCTGAAATACAGTGG - Intergenic
1125120228 15:36148280-36148302 TGGCCCAGGCTGGAGGACAGTGG + Intergenic
1126345273 15:47687024-47687046 TCACCTAGGCTGAAATACAGTGG - Intronic
1126719783 15:51566170-51566192 TGACCCAGGCTGGAATACAGTGG - Intronic
1126838416 15:52691793-52691815 TCTCCCAGGCTGGAATACAGTGG - Intronic
1127244801 15:57160730-57160752 TCTCCTAGGCTGAAATGCAGTGG + Intronic
1127555827 15:60086561-60086583 TGGCCCAGGCTGAAGTACAGTGG - Intergenic
1128554460 15:68621794-68621816 TCTCCTAGGCTGGAGGACAGTGG + Intronic
1128786229 15:70399514-70399536 AGGGCAAGGCTCAAAGACAGGGG + Intergenic
1129105103 15:73301705-73301727 TCTCCCAGGCTGGAATACAGTGG + Intronic
1129183942 15:73894351-73894373 GGTCCAGGGCTGGATGACAGGGG + Intergenic
1129317131 15:74751813-74751835 TGACCAAGCCTGAGATACAGAGG + Exonic
1129329794 15:74821156-74821178 TGGCCCAGGCTGAGAGACAATGG + Exonic
1129627559 15:77218609-77218631 TATCCTAGGCTGGAATACAGTGG + Intronic
1130076007 15:80691033-80691055 TCACCAAGGCTGAAGTACAGTGG + Intronic
1130228050 15:82075023-82075045 TTTCCCAGGCTGAAGTACAGTGG + Intergenic
1130284797 15:82546147-82546169 TGTCCCAGGCTGAAGTGCAGTGG + Intronic
1130445273 15:83995059-83995081 TGTCCCAGGCTGACCCACAGTGG + Intronic
1130583501 15:85160162-85160184 TCTCCCAGGCTGGAAGGCAGTGG + Intergenic
1130732949 15:86518097-86518119 CGTCCATGACTGAAAAACAGAGG - Intronic
1131503629 15:92996197-92996219 TCTCCAAGGCTGGAGCACAGTGG + Intronic
1131727048 15:95238168-95238190 TGGCCCAGGCTGGAGGACAGTGG + Intergenic
1132763060 16:1520340-1520362 TGGCCTAGGCAGAGAGACAGCGG + Exonic
1133243879 16:4433605-4433627 TACCCAAGGCTGCAAGATAGAGG + Intronic
1133324491 16:4935064-4935086 TGTCCTAGGCTGATAGCCATTGG - Intronic
1133649311 16:7795675-7795697 TGTCCCAGGCTGAAGTGCAGTGG - Intergenic
1133950938 16:10391854-10391876 TCACCCAGGCTGAAAGGCAGTGG - Intronic
1134504337 16:14792752-14792774 TCTCCCAGGCTGTAAGGCAGTGG - Intronic
1134576236 16:15336157-15336179 TCTCCCAGGCTGTAAGGCAGTGG + Intergenic
1134726207 16:16420345-16420367 TCTCCCAGGCTGTAAGGCAGTGG - Intergenic
1134941227 16:18291515-18291537 TCTCCCAGGCTGTAAGGCAGTGG + Intergenic
1135676326 16:24417982-24418004 TGTCCCAGGCTGGAGGGCAGTGG - Intergenic
1136249231 16:28992986-28993008 TGGCCCAGGCTGAAATGCAGTGG + Intergenic
1137223221 16:46476573-46476595 TGTCCCAGGCTGGAATGCAGTGG - Intergenic
1137489516 16:48919840-48919862 TCTCCCAGGCTGAAGCACAGCGG - Intergenic
1137939571 16:52670422-52670444 TCTCCAAGACTGAAAGAATGTGG + Intergenic
1137980818 16:53068017-53068039 TGTGCCAGGCTGGAGGACAGTGG - Intronic
1138587742 16:57982117-57982139 TGTCCAAGAATGTAAGAGAGAGG - Intronic
1139996003 16:70980464-70980486 TTACCCAGGCTGAAATACAGTGG - Intronic
1140176436 16:72664999-72665021 TCTCCCAGAGTGAAAGACAGAGG + Intergenic
1141237522 16:82232374-82232396 AGTTCAAGGCAGAAAGTCAGGGG + Intergenic
1142208753 16:88797106-88797128 TGTCCTAGGCTGGAGCACAGTGG + Intergenic
1142384449 16:89754012-89754034 TGTCCCAGGCTGGAGTACAGTGG - Intronic
1142761864 17:2047033-2047055 TCTCCCAGGCTGGAATACAGTGG - Intergenic
1143120179 17:4601561-4601583 TCTCCCAGGCTGGAATACAGTGG + Intronic
1143124696 17:4634340-4634362 TTTCCCAGGCTGAAGTACAGTGG + Intronic
1143270236 17:5669863-5669885 TGGCCAAGGCTGGAGTACAGTGG - Intergenic
1144491521 17:15716045-15716067 TCTCCATGTCTGAAAGACATTGG - Exonic
1144507516 17:15845269-15845291 TCTCCCAGGCTGGAATACAGTGG - Intergenic
1144523205 17:15968073-15968095 GCTCCAAGACAGAAAGACAGAGG + Intronic
1144547653 17:16213019-16213041 TTGCCCAGGCTGAAATACAGTGG - Intronic
1144815849 17:18034150-18034172 TGTTCAAGTCTGAGAGACCGAGG + Intronic
1145215061 17:21044702-21044724 TGCCCAAGGCTGGAGTACAGTGG + Intergenic
1145757974 17:27406640-27406662 TCACCCAGGCTGAAGGACAGTGG - Intergenic
1145819380 17:27819804-27819826 TTGCCAAGGCTGCAATACAGTGG - Intronic
1145967031 17:28926677-28926699 TATCCATGGCTGAAAAACAAAGG - Intronic
1146569702 17:33941759-33941781 TGTCCCAGGCAGAAGCACAGGGG - Intronic
1148010428 17:44475652-44475674 TCTCCCAGGCTGAAATGCAGTGG - Intronic
1148121469 17:45214824-45214846 TCTCCCAGGCTGAAGTACAGTGG + Intergenic
1148171232 17:45522246-45522268 TCACCCAGGCTGAAATACAGTGG + Intergenic
1148278441 17:46327552-46327574 TCACCCAGGCTGAAATACAGTGG - Intronic
1148300650 17:46545410-46545432 TCACCCAGGCTGAAATACAGTGG - Intronic
1148364788 17:47046303-47046325 TCACCCAGGCTGAAATACAGTGG - Intronic
1148405768 17:47413742-47413764 TTCCCAATTCTGAAAGACAGTGG - Intronic
1148983017 17:51595558-51595580 TCACCAAGGCTGGAATACAGTGG - Intergenic
1149966165 17:61166435-61166457 TTTCCCAGGCTGAAATGCAGTGG + Intronic
1150146790 17:62775854-62775876 TCTCCCAGGCTGAAATGCAGTGG + Intronic
1150401855 17:64863841-64863863 TCACCCAGGCTGAAATACAGTGG + Intronic
1150494609 17:65597637-65597659 TTTCCTAGCCTGTAAGACAGAGG + Intronic
1150781972 17:68131158-68131180 TCACCCAGGCTGAAATACAGTGG + Intergenic
1151001379 17:70380950-70380972 TCTCCAAGGCTGGAATGCAGTGG + Intergenic
1151043541 17:70893356-70893378 TGTCCAAGGCTTCCAGACAGAGG - Intergenic
1151197104 17:72439386-72439408 TGTCCAAGGATGATAAACAGTGG - Intergenic
1151206735 17:72513428-72513450 TCTCCCAGGCTGGAAGGCAGTGG + Intergenic
1151925331 17:77191834-77191856 TCACCAAGGCTGAAATGCAGTGG + Intronic
1152193943 17:78905169-78905191 GGTCCAAGGCAGAAAGAAGGTGG - Intronic
1152403090 17:80081343-80081365 TAACCCAGGCTGAAATACAGTGG - Intronic
1152674099 17:81628169-81628191 TCTCCAAGGCTGGAATGCAGTGG - Intronic
1153271434 18:3326556-3326578 TTACCCAGGCTGGAAGACAGTGG + Intergenic
1153381069 18:4439768-4439790 TCTCCCAGGCTGGAATACAGTGG - Intronic
1154223137 18:12474777-12474799 TTGCCAAGGCTGGAACACAGTGG - Intronic
1154528903 18:15322427-15322449 TGACCAAGGCTAAAAGGAAGGGG + Intergenic
1155051004 18:22147556-22147578 TCTCCCAGGGTGAAATACAGTGG + Intergenic
1155683960 18:28523928-28523950 TTTCAAAAGCTTAAAGACAGAGG - Intergenic
1156151926 18:34253019-34253041 TCTCCCAGGCTGGAACACAGTGG + Intergenic
1156239893 18:35243042-35243064 TCTCCAGGGATGAAGGACAGGGG - Intronic
1156473534 18:37391982-37392004 TGTGCAAGGCTGAGAACCAGAGG + Intronic
1156964286 18:43072023-43072045 TCTCCCAGGCTGAAGTACAGTGG + Intronic
1158276130 18:55769914-55769936 TGTCCCAGGCTGGAGGGCAGTGG + Intergenic
1159156908 18:64595805-64595827 TGTTGAAGGCTGAAAGAGTGAGG - Intergenic
1159833519 18:73307789-73307811 TTTCCCAGGCTGAAATGCAGTGG + Intergenic
1160567347 18:79795214-79795236 TGTCCACGTCTGAGAGACATGGG + Intergenic
1160567378 18:79795415-79795437 TGTCCACGTCTGAGAGACACGGG + Intergenic
1160949822 19:1660321-1660343 TGTCCCAGGCTGGAATGCAGTGG - Intergenic
1161414106 19:4135181-4135203 TGTCCCAGGCTGGAGTACAGTGG - Intergenic
1161637084 19:5395677-5395699 TGTCCCAGGCTGGAATGCAGTGG - Intergenic
1161676893 19:5656309-5656331 TGGCCCAGGCTGGAATACAGTGG + Intronic
1161807831 19:6455230-6455252 TTTCCCAGGCTGAAATGCAGTGG - Intronic
1162804515 19:13130114-13130136 TGACCCAGGCTGAAATATAGTGG + Intronic
1162915742 19:13873506-13873528 TGACCCAGGCTGGAATACAGTGG + Intronic
1163597340 19:18227740-18227762 AGGCCCAGGCTGAGAGACAGAGG - Intronic
1163661065 19:18577845-18577867 TGGCCAAGGGTGGAAAACAGTGG + Intronic
1164313857 19:24069563-24069585 TCACCAAGGCTGAACGGCAGTGG - Intronic
1164651312 19:29892823-29892845 TGTCCCAGGCTGAAGTACGGTGG + Intergenic
1164802487 19:31089185-31089207 CATCCAAGGCTGAAAGAGAGTGG + Intergenic
1164926399 19:32133135-32133157 TCTCCCAGGCTGAAATGCAGTGG - Intergenic
1165213314 19:34252496-34252518 TCGCCAAGGCTGGAATACAGTGG + Intergenic
1165213360 19:34252795-34252817 TCGCCAAGGCTGGAATACAGTGG + Intergenic
1165353814 19:35291848-35291870 AGTCCCAGGCTGAGGGACAGAGG - Intergenic
1165561256 19:36682029-36682051 TTTCAGAGGCTGAGAGACAGGGG + Intergenic
1165578932 19:36845633-36845655 TGTCCTAGACTAAAAGAAAGAGG + Intronic
1166128574 19:40731640-40731662 TGTCCCAGGCTGGAATGCAGTGG + Intronic
1166512283 19:43416991-43417013 TGTCCCAGGCTGAAGTGCAGTGG - Intronic
1167317752 19:48775748-48775770 TCTCCCAGGCTGAAGTACAGTGG - Intergenic
1167703363 19:51064446-51064468 TCTCCCAGGCTGGAAGGCAGTGG - Intronic
1167960823 19:53103169-53103191 GGCCCAAGGCAGAAAGACCGGGG + Intronic
1168282719 19:55314059-55314081 TGTCCCAGGCTGGAATGCAGTGG + Intronic
1168502677 19:56906551-56906573 TGTTCCAGGCAGAAAGAAAGGGG + Intergenic
925233036 2:2252709-2252731 TCTCCAAGGCTAAAGGAAAGAGG + Intronic
925362580 2:3289763-3289785 TGTCCAAAGCTGAACGCCAGCGG + Intronic
925787865 2:7450443-7450465 TGTCCACGGCTGACACACGGTGG + Intergenic
926749444 2:16186752-16186774 TGGCCCAGGCTGGAATACAGTGG - Intergenic
927026537 2:19073998-19074020 TGGCCAAGGCAGAAACACTGAGG - Intergenic
927744935 2:25610148-25610170 TCGCCCAGGCTGAAATACAGTGG + Intronic
928451890 2:31385153-31385175 TTGCCCAGGCTGAAATACAGTGG - Intronic
928527162 2:32152785-32152807 TCTCCCAGGCTGAAATACATTGG + Intronic
928974000 2:37064324-37064346 TCACCCAGGCTGAAGGACAGTGG + Intronic
929486922 2:42362912-42362934 TGTCCCAGGCTGGAGTACAGTGG + Intronic
929540371 2:42814805-42814827 TCTCCCAGGCTGGAATACAGTGG - Intergenic
929991085 2:46787499-46787521 AGTCCAAGGCTGAAAGCCTTGGG - Intergenic
930492939 2:52099500-52099522 TCACCAAGGCTGAAGTACAGTGG + Intergenic
930514465 2:52388862-52388884 TGGCCCAGGCTGAAATGCAGTGG + Intergenic
930652936 2:53980311-53980333 TCTCCCAGGCTGGAACACAGTGG - Intronic
930749380 2:54918386-54918408 TTTCCCAGGCTGGAATACAGTGG + Intronic
930804641 2:55478192-55478214 TGACAAAGCCTGAAAGAAAGAGG - Intergenic
931278127 2:60762664-60762686 TGGCCAAGGCTGGAATGCAGTGG + Intronic
931327369 2:61240611-61240633 TTGCCCAGGCTGAAATACAGTGG + Intronic
932695698 2:73954301-73954323 TGGCCTAGGCTGAAATGCAGTGG - Intronic
932719701 2:74130053-74130075 TCTCCCAGGCTGGAATACAGTGG - Intergenic
933040998 2:77466736-77466758 TTGCCAAGGCTGAAATGCAGTGG + Intronic
933068494 2:77829636-77829658 TATCCCAGGCTGAAAGGCAGTGG - Intergenic
933509658 2:83223912-83223934 TCACCCAGGCTGAAAGATAGTGG - Intergenic
934221684 2:90089760-90089782 TTTCCCAGGCTGAAGTACAGTGG - Intergenic
934700156 2:96432919-96432941 TTTCCAAGGCTGAAGTGCAGTGG + Intergenic
935128388 2:100243262-100243284 TGTCCAAGGCTGAAGGTGTGAGG - Intergenic
936087067 2:109476532-109476554 TGTCAAAGGCTAAAAGATACTGG + Intronic
937351736 2:121169342-121169364 TCTCCTAGGCTGGAATACAGTGG - Intergenic
937417471 2:121727540-121727562 TGCCCTTGGCTGAAATACAGGGG - Exonic
937502122 2:122490590-122490612 GGTCCAAACCTAAAAGACAGGGG - Intergenic
938006501 2:127791196-127791218 TCACCCAGGCTGCAAGACAGTGG + Intronic
939068036 2:137507359-137507381 TTGCCAAGGGAGAAAGACAGTGG - Intronic
939167480 2:138654827-138654849 TGTCCAGGGCTAAAACAAAGAGG - Intergenic
940943504 2:159590145-159590167 TTTCCCAGGCTGGAATACAGTGG - Intronic
942180205 2:173373113-173373135 TGTCCCAGGCTGGAGTACAGTGG + Intergenic
942496444 2:176545089-176545111 TCTCCTAGGCTGAAACAAAGGGG + Intergenic
943221362 2:185110981-185111003 TTCCCAAGGCTGAAGGGCAGTGG - Intergenic
943232114 2:185267081-185267103 TGTGCAAGGTTGAAAGACATCGG - Intergenic
943418918 2:187642365-187642387 TATCAAAGGCTGAAAAACAGTGG + Intergenic
943483796 2:188455090-188455112 TCTCCAAGGCTGGAGTACAGTGG - Intronic
943837496 2:192531858-192531880 TCTCCCAGGCTGAAATGCAGTGG - Intergenic
944419688 2:199516453-199516475 TCTCCCAGGCTGGAAGGCAGTGG + Intergenic
944646490 2:201785722-201785744 TCGCCAAGGCTGAAGTACAGTGG + Intergenic
945591222 2:211734000-211734022 TGGCCCAGGCTGGAGGACAGTGG - Intronic
945953768 2:216066082-216066104 TTGCCCAGGCTGAAAGGCAGTGG - Intronic
946608489 2:221432681-221432703 TGGCCCAGGCTGAATTACAGTGG + Intronic
946892016 2:224286674-224286696 TGTCCAAGGCTGCAGGAAATAGG + Intergenic
947009244 2:225547353-225547375 TGTCCTGGGCTCAAAGCCAGTGG - Intronic
947327054 2:228991161-228991183 TTGCCCAGGCTGAAATACAGTGG + Intronic
948019712 2:234720413-234720435 TGTCCCAGGCTGAAGTGCAGTGG - Intergenic
948657942 2:239488239-239488261 CATCCAGGGCTGCAAGACAGAGG - Intergenic
948666950 2:239541776-239541798 TGTCTAATTCTGAAAGACAGAGG - Intergenic
1170344844 20:15373442-15373464 TCACCCAGGCTGAAAGGCAGTGG + Intronic
1170351249 20:15444074-15444096 TGCCCAAGGTTGAGAGAGAGGGG - Intronic
1170632371 20:18076502-18076524 TCACCCAGGCTGAAAGGCAGTGG + Intergenic
1171167769 20:22987124-22987146 TGTCCCAGGCTGGAGTACAGTGG - Intergenic
1172380411 20:34485720-34485742 TTGCCGAGGCTGAAATACAGTGG + Intronic
1172548490 20:35780584-35780606 TCTCCCAGGCTGGAAGGCAGTGG + Intronic
1172619869 20:36311801-36311823 TGACAGAGGCTGGAAGACAGAGG + Intronic
1172620971 20:36318410-36318432 TCTCCCAGGCTGAAATGCAGTGG + Intronic
1172892504 20:38276946-38276968 TGGCCCAGGCTGGAAGGCAGTGG - Intronic
1173048938 20:39540543-39540565 TCTCCCAGGCTGAAATGCAGTGG + Intergenic
1173071247 20:39768997-39769019 TCTCCAGGGCTGAAGTACAGTGG + Intergenic
1174011018 20:47449687-47449709 TGGCCCAGGCTGGAATACAGTGG + Intergenic
1174193806 20:48758616-48758638 TGTGCAGGGCTGAAGGTCAGAGG + Intronic
1174426939 20:50438460-50438482 TGCCCAAGGCTGGAGTACAGTGG - Intergenic
1174477156 20:50803751-50803773 TCCCCAAGGCTGAAGTACAGTGG - Intronic
1174817209 20:53697252-53697274 TCGCCCAGGCTGAAAGGCAGTGG - Intergenic
1177314536 21:19439857-19439879 TCACCAAGGCTGGAATACAGAGG - Intergenic
1177377792 21:20296025-20296047 TTTCCTAGGCTGGAAGACAATGG - Intergenic
1177633238 21:23753441-23753463 TGGCCCAGGCTGAAGTACAGTGG + Intergenic
1177710365 21:24765781-24765803 TCTCCCAGGCTGGAAAACAGTGG - Intergenic
1178300340 21:31447924-31447946 AGTCCAAGGCTGAAAGCAGGAGG + Intronic
1178347990 21:31848622-31848644 TGGCCAAGGATGAGAGCCAGAGG - Intergenic
1179423950 21:41258008-41258030 AGTCCAAGCCTGCAAGGCAGAGG + Intronic
1179986724 21:44926295-44926317 TGCACAAGGCTGGAAGTCAGAGG + Intronic
1180241685 21:46511559-46511581 TATCCAAGGCAGTCAGACAGGGG - Exonic
1180603585 22:17037850-17037872 TCTCCAAGGCTGGAGGGCAGTGG + Intergenic
1180948493 22:19709683-19709705 TGTCCACCGCTGCAAGACATAGG + Intergenic
1181049732 22:20232811-20232833 TGTCTTAGGCTGAACCACAGTGG - Intergenic
1181300111 22:21873816-21873838 TCTCCAAGGCTGGAATGCAGTGG - Intergenic
1181381847 22:22511089-22511111 TGCCCAAGGCTGGAGTACAGTGG - Intergenic
1181732615 22:24858594-24858616 TTGCCAAGGCTGGAGGACAGCGG - Intronic
1181844037 22:25692001-25692023 TCTCCAAGGCTGGAGTACAGTGG + Intronic
1183351607 22:37337680-37337702 TGCCCAAGGCGGACAGAGAGGGG - Intergenic
1183388796 22:37531403-37531425 TTTCCAAGGCTGGAGTACAGTGG - Intergenic
1183446050 22:37856095-37856117 TCTCCCAGGCTGAAGTACAGTGG + Intronic
1183556887 22:38535510-38535532 TCTCCCAGGCTGAAATGCAGTGG + Intronic
1184045117 22:41968264-41968286 TCGCCCAGGCTGGAAGACAGTGG - Intergenic
1184146967 22:42617458-42617480 TGTCTGAGGCTGAAAGGCACAGG - Intergenic
950086845 3:10265114-10265136 TGGCCCAGGCTGAAATACAGTGG + Intronic
950358752 3:12435107-12435129 TGGCCCAGGCTGGAATACAGTGG - Intergenic
950390055 3:12689477-12689499 TTGCCCAGGCTGAAATACAGTGG - Intergenic
950441416 3:13012998-13013020 TGTCCAAGGCTGGAGTGCAGTGG + Intronic
950727673 3:14927801-14927823 TGTCCAAGGCTGGAGTGCAGTGG + Intronic
950851283 3:16064328-16064350 TCACCCAGGCTGGAAGACAGCGG - Intergenic
950942871 3:16911211-16911233 TGGCCCAGGCTGGAATACAGTGG - Intronic
951408109 3:22326318-22326340 TCCCCAAGCCTGAAAGACTGGGG + Intronic
952042466 3:29277334-29277356 TTGCCAAGGCTGAAGGGCAGTGG - Intergenic
952117306 3:30198191-30198213 TTGGCAAGGCTGAAAGTCAGAGG + Intergenic
953709870 3:45260847-45260869 TGTCCAGGCTGGAAAGACAGTGG - Intergenic
954112466 3:48442219-48442241 TCTCCCAGGCTGGAATACAGTGG - Intronic
954408928 3:50361112-50361134 TGTCCAAGGCTGGAGTGCAGTGG + Intronic
955734316 3:62020752-62020774 TCTCCCAGGCTGGAATACAGTGG + Intronic
955993814 3:64657374-64657396 TCTCCAAGGCTGATGCACAGTGG + Intronic
956082277 3:65570140-65570162 TTGCCAAGGCTGAAGTACAGTGG + Intronic
956805825 3:72809917-72809939 TGCCCAAGGCTGGAGTACAGTGG - Intronic
957135784 3:76287333-76287355 TCACCAAGGCTGAAATGCAGTGG + Intronic
957195387 3:77060973-77060995 TCACCAAGGCTGGAAGACAGTGG + Intronic
958083343 3:88774763-88774785 TGTGCTAGACTGAGAGACAGTGG + Intergenic
958464418 3:94440887-94440909 CGTCCAAGGTTGGCAGACAGAGG - Intergenic
958631275 3:96686331-96686353 TGAACTAGGCTGAAAGACAGTGG - Intergenic
959209403 3:103357772-103357794 TGTCCAAAATTGAAAGAGAGTGG + Intergenic
959697681 3:109266172-109266194 TGGCCCAGGCTGAATTACAGTGG - Intergenic
960096987 3:113698481-113698503 TTGCCAAGGCTGAAGGTCAGTGG + Intergenic
960758612 3:121048284-121048306 TCTCCAAGGCTGAAAGAAAAGGG - Intronic
961621797 3:128230184-128230206 TGGCCCAGGCTGGAATACAGTGG + Intronic
961747558 3:129074799-129074821 TCTCCCAGGCTGAGAGGCAGTGG + Intergenic
962618845 3:137156394-137156416 TGAGCAAGACTGGAAGACAGGGG + Intergenic
962755555 3:138463132-138463154 TGGCCCAGGCTGAAATGCAGTGG + Intronic
963613996 3:147511411-147511433 TGTCCAGGGGTGGGAGACAGGGG - Intergenic
964011700 3:151899518-151899540 TCTCCCAGGCTGAAGTACAGTGG + Intergenic
964660222 3:159112538-159112560 TGACAAAGGCTGCTAGACAGAGG + Intronic
964953348 3:162324057-162324079 GGTCCAAAGGTGAAAGACAAAGG + Intergenic
965516840 3:169630490-169630512 TTCCCCAGGCTGAAATACAGTGG + Intronic
965575672 3:170216034-170216056 TCTCCAAGGCTGGAGTACAGTGG + Intergenic
966143713 3:176786399-176786421 TCTCCAAGGCTGGAATGCAGTGG - Intergenic
966163339 3:176990616-176990638 TGTCCCAGGCTGGAGGGCAGTGG + Intergenic
966375897 3:179295355-179295377 TTGCCTAGGCTGAAAGGCAGTGG - Intergenic
966522027 3:180883926-180883948 TGTCCAAGGCTGGAGTGCAGCGG - Intronic
966949803 3:184805934-184805956 TTTCTAAGGCTGAAAGAAAGAGG + Intergenic
967169653 3:186813088-186813110 AGACCAAGGATGAAAGCCAGAGG + Intergenic
967562014 3:190927099-190927121 TTGCCCAGGCTGAAACACAGTGG + Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
967902813 3:194474201-194474223 TCACCCAGGCTGGAAGACAGTGG + Intronic
968892096 4:3374847-3374869 AGTCCAAGGCAGAAAGCCATGGG - Intronic
968974487 4:3814116-3814138 TGTCTGAGGCTGAAAGACCAAGG - Intergenic
969086245 4:4658754-4658776 TGTTCAAGGAAGAAAGAAAGGGG + Intergenic
969288498 4:6223094-6223116 TTTACAAGGCTGAGCGACAGTGG - Intergenic
970832410 4:20357120-20357142 ATTTCCAGGCTGAAAGACAGTGG - Intronic
971126189 4:23757867-23757889 TTCCCAAGGCTTAAAAACAGGGG + Intronic
971381449 4:26102394-26102416 TGTCCCAGGCTGAAACATATAGG - Intergenic
971461968 4:26909037-26909059 TTGCCAAGGCTGAAGCACAGTGG - Intronic
971656043 4:29346581-29346603 TCACCAAGGCTGAAATGCAGTGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
973273786 4:48287898-48287920 ACTCCAAGACTGAAAGGCAGAGG - Intergenic
973946173 4:55958393-55958415 TGTCCCAGGCTGAAGTGCAGTGG - Intronic
974293998 4:59970751-59970773 TCTCCTAGGCTGAAATGCAGTGG + Intergenic
974368153 4:60980021-60980043 TCTCCTAGGCTGGAATACAGTGG + Intergenic
974434540 4:61840117-61840139 TGTCCCAGGCTGGAACACAGTGG + Intronic
975740048 4:77420874-77420896 TGTCCCAGCCTGAGAGTCAGGGG + Intronic
975780849 4:77838377-77838399 TCACCAAGGCTGGAATACAGTGG + Intergenic
976082897 4:81375764-81375786 TGTGCTGGGCTCAAAGACAGTGG - Intergenic
976121279 4:81785204-81785226 TCTCCCAGGCTGAAGTACAGTGG + Intronic
976184813 4:82432693-82432715 TCTCCCAGGCTGGAATACAGTGG + Intronic
976186057 4:82443686-82443708 TGTCCCAGGCTGGAGGGCAGTGG - Intronic
976191404 4:82490637-82490659 TCTCCCAGGCTAAAATACAGTGG + Intronic
976449829 4:85175682-85175704 TGTCCAGGGCTGAAGGAGAGGGG + Intergenic
976656747 4:87496911-87496933 TTGCCCAGGCTGAAATACAGTGG + Intronic
976852563 4:89565026-89565048 TTGCCCAGGCTGAAAGGCAGTGG + Intergenic
977212896 4:94242071-94242093 TGTCCCAGGCTGGAGTACAGTGG + Intronic
977240563 4:94564001-94564023 TCTCCCAGGCTGAAATGCAGAGG + Intronic
977399086 4:96509466-96509488 TGAGCTAGGCTGAAAGACAGTGG + Intergenic
978586118 4:110277536-110277558 TTTCCCAGGCTGAAATGCAGTGG - Intergenic
979073746 4:116243868-116243890 TGTCCAAGGTTCTGAGACAGGGG - Intergenic
982520480 4:156410338-156410360 TCTCCCAGGCTGAAATACAGTGG + Intergenic
982692140 4:158560740-158560762 TGTTCAAGGCAGAAAGAAAGTGG + Intronic
982711712 4:158764644-158764666 TGTCTAATGCAAAAAGACAGAGG + Intergenic
983372963 4:166886861-166886883 TGCCAAAGGCTGAGAGACAGGGG - Intronic
983388845 4:167102824-167102846 AGTCCTAGGCTCAGAGACAGGGG + Intronic
983636438 4:169902250-169902272 TTTAAAAGGCTGAAAAACAGTGG - Intergenic
984063254 4:175018154-175018176 TGTCTCAGGCTGGAATACAGTGG - Intergenic
984497561 4:180517293-180517315 TGTCCCAGGCTGAAGTGCAGTGG - Intergenic
984853631 4:184174786-184174808 TATACAAGCCTGAAAGTCAGTGG + Intronic
985075046 4:186205873-186205895 TCTTCAAGGCAGGAAGACAGGGG + Intronic
985178520 4:187229756-187229778 TGACCAAGGCTGAAGTGCAGTGG + Intergenic
986466466 5:8030177-8030199 TGTCCCAGGTTGGAACACAGTGG - Intergenic
986719115 5:10547464-10547486 TGGCCCAGGCTGAAGTACAGTGG - Intergenic
987638230 5:20575482-20575504 TGTTCAATGCTGGAAGAAAGTGG + Exonic
987884931 5:23800736-23800758 CGTGCAAGGCTGAAATCCAGTGG - Intergenic
987887382 5:23830146-23830168 TATCAAAGGCTTACAGACAGGGG - Intergenic
988286704 5:29228131-29228153 TTGCCAAGGCTGAAGTACAGTGG + Intergenic
988491060 5:31706010-31706032 TGGCCCAGGCTGAAGTACAGTGG - Intronic
988663627 5:33301213-33301235 TTTCCCAGGCTGGAATACAGTGG + Intergenic
988687145 5:33536174-33536196 TCACCCAGGCTGAAAGGCAGCGG + Intronic
990131011 5:52583109-52583131 TTGCCAAGTCTGAAAAACAGGGG + Intergenic
990506291 5:56448767-56448789 TGTCCAAGGCAAAAAGAAATTGG + Intergenic
990597334 5:57324753-57324775 TGTCCCAGGCTGAAAAGTAGGGG + Intergenic
990745198 5:58951857-58951879 TTTCCCAGGCTGAAGAACAGTGG - Intergenic
990746633 5:58965363-58965385 TCACCTAGGCTGAAATACAGTGG - Intergenic
990933584 5:61121868-61121890 TTACCAAGGCTGGAATACAGTGG + Intronic
991433397 5:66571531-66571553 TATACAAGGCTGAGATACAGAGG + Intergenic
992060070 5:73035540-73035562 TTTCCCAGGCTGGAATACAGTGG + Intronic
992685999 5:79200068-79200090 TGTCCCAGGCTGGAATGCAGTGG - Intronic
992702311 5:79353164-79353186 TCTCCCAGGCTGGAATACAGTGG + Intergenic
993724526 5:91352693-91352715 TCACCAAGGCTGGAGGACAGTGG - Intergenic
993832536 5:92777798-92777820 TCACCCAGGCTGAAATACAGTGG + Intergenic
994880396 5:105486314-105486336 TGGCCAATGCAAAAAGACAGTGG + Intergenic
995377552 5:111493063-111493085 TGTGAAAGGCTGAAATACACAGG + Exonic
995718659 5:115105981-115106003 TGTCCCAGGCTGGAATGCAGTGG - Intergenic
995925308 5:117366531-117366553 TCTCCCAGGCTGAAGCACAGTGG - Intergenic
996946669 5:129078752-129078774 TGTCAAAGCCTTGAAGACAGGGG + Intergenic
997247236 5:132360317-132360339 AGTCCAAGTCTGAAAGACTGAGG + Intergenic
997464409 5:134077824-134077846 TGGCCAAGGCTGAAACACTCAGG - Intergenic
997606968 5:135182221-135182243 TGTTCAAGGCTGGGAGACAGTGG + Intronic
998084832 5:139311805-139311827 TGTCCCAGGCTGGAGTACAGTGG + Intronic
998101618 5:139439484-139439506 TGCCCGAGGCTGAAAGAGAAGGG + Exonic
998363814 5:141615391-141615413 TGTCCAAGGCTGCAGTGCAGTGG - Intronic
998823236 5:146075737-146075759 TGCCCAAGGCTGGAGTACAGTGG - Intronic
999290286 5:150420874-150420896 TACCCAAGGCTGGAATACAGTGG + Intergenic
999329433 5:150662536-150662558 AGTCCAAGGCTGAAAGAAGTTGG - Intronic
999797650 5:155003255-155003277 TGACCTAGGCTGAAGTACAGTGG - Intergenic
1000196984 5:158969260-158969282 TGCCCAAGGCTGGAGCACAGTGG - Intronic
1000412633 5:160949487-160949509 TGTCCAAGGTTGAAAAGCACTGG + Intergenic
1000514713 5:162226041-162226063 TTTCCCAGGCTGAAATGCAGTGG + Intergenic
1001264232 5:170260937-170260959 TGACCAAGGCCCAAAGACAGAGG + Intronic
1001918558 5:175582277-175582299 TTTCAAAGGCAGAAAGGCAGAGG - Intergenic
1002192710 5:177486972-177486994 TCTCCCAGGCTGGAAGGCAGTGG + Intronic
1002562884 5:180094299-180094321 TTTCCCAGGCTGGAATACAGTGG + Intergenic
1003092058 6:3112568-3112590 TGGCCCAGGCTGAAGTACAGGGG + Intronic
1003580380 6:7334686-7334708 TGTCCCAGGCTGAAGTGCAGTGG - Intronic
1003900515 6:10650988-10651010 TGTCCCAGGCTGGAGTACAGCGG + Intergenic
1004029711 6:11854632-11854654 ATGCCAAGGCTGAAAGACACTGG + Intergenic
1004201954 6:13556744-13556766 TGTCCCAGGCTGTAGTACAGTGG + Intergenic
1004469823 6:15919532-15919554 TTTCCCAGGCTGGAATACAGTGG + Intergenic
1004516295 6:16325155-16325177 TGTCCAAGGCTGGAGTGCAGTGG + Intronic
1004651880 6:17617803-17617825 TTTCCCAGGCTGGAAGGCAGTGG - Intronic
1005078914 6:21937015-21937037 TCACCAAGGCTGCAATACAGTGG - Intergenic
1005422882 6:25671361-25671383 TCTCCAGGGCTGAAAACCAGGGG - Intronic
1005603687 6:27453686-27453708 TGTTCCAGGCTGAAACACATGGG - Intronic
1006476260 6:34256477-34256499 TTGCCAAGGCTGAAGGGCAGTGG - Intergenic
1006486108 6:34343499-34343521 TGGCCTAGGCTGGAATACAGTGG - Intronic
1006938073 6:37732339-37732361 TGTCCAGGACTGAACCACAGAGG - Intergenic
1007176574 6:39901669-39901691 TGTCCTAGGCAGGAAGAAAGTGG + Intronic
1007456395 6:41980992-41981014 AGTACAATGCTGAAAGAAAGTGG - Intronic
1007472428 6:42099514-42099536 TGTGCAAAGCTGTAGGACAGAGG - Intergenic
1007528481 6:42519138-42519160 TCACCCAGGCTGAAATACAGTGG + Intergenic
1007889375 6:45271954-45271976 TGTGCAAGTCTGAAATCCAGTGG - Intronic
1008177697 6:48288649-48288671 TGAACTAGGCTGAGAGACAGTGG - Intergenic
1009309710 6:62134787-62134809 CGTGCAAGTCTGAAATACAGTGG - Intronic
1009545433 6:65013823-65013845 TTTCCCAGGCTGAAATGCAGTGG - Intronic
1010425358 6:75723189-75723211 TGTCCCAGGCTGAAGTGCAGTGG - Intergenic
1010548837 6:77194161-77194183 GGCCCAAGGCAGGAAGACAGAGG + Intergenic
1011281427 6:85681526-85681548 TTACCAAGGCTGGAAGGCAGAGG - Intergenic
1011698807 6:89936488-89936510 TGTCCAAGGCAGAGAGGAAGTGG + Intronic
1012833714 6:104239156-104239178 TCACCCAGGCTGAAGGACAGTGG + Intergenic
1012901738 6:105014185-105014207 TGGCCCAGGCTGCAATACAGTGG + Intronic
1013082835 6:106827692-106827714 GGTCCAGGGCTGAAGTACAGTGG + Intergenic
1014941815 6:127449610-127449632 TCTCCAAGGCTGGAAAGCAGTGG - Intronic
1015299741 6:131639316-131639338 TTGCCCAGGCTGGAAGACAGTGG + Intronic
1016185843 6:141196716-141196738 TGAACTAGGCTGAGAGACAGTGG - Intergenic
1017008945 6:150049342-150049364 TGTTCAAGACTGACAGTCAGAGG + Intergenic
1017154862 6:151314065-151314087 TCTCCCAGGCTGAAGTACAGTGG + Intronic
1017445138 6:154501005-154501027 TGAACAAGGCAGAAAGACAGAGG + Intronic
1018869454 6:167770072-167770094 TGTCACAGGGAGAAAGACAGTGG + Intergenic
1019497483 7:1347215-1347237 TCTCCCAGGCTGGAATACAGTGG + Intergenic
1019889463 7:3934709-3934731 TGCGCAAGGCTGAAAGAGATGGG + Intronic
1020268590 7:6578165-6578187 TGGCCCAGGCTGGAAGGCAGTGG + Intronic
1021270688 7:18581284-18581306 TGCCCAAGACTGAGAGAAAGTGG - Intronic
1021296245 7:18910026-18910048 TGTCCAATGCTGAGAGAGTGGGG + Intronic
1021447520 7:20749265-20749287 TCGCCTAGGCTGAAATACAGTGG + Intronic
1021915109 7:25423638-25423660 TGTGCAAGGCTGTAAGATAGAGG - Intergenic
1022060071 7:26784673-26784695 TGTAGAAGGCTGACACACAGTGG + Intronic
1022168109 7:27792920-27792942 TCACCCAGGCTGAAACACAGTGG - Intronic
1022320563 7:29284133-29284155 TGTCCCAGGCTGAAGTGCAGTGG + Intronic
1023621129 7:42074344-42074366 TGGCCCAGTCTGAGAGACAGTGG - Intronic
1023762189 7:43475588-43475610 TGTCCTAGGCTGAAATGCAGTGG + Intronic
1023801728 7:43840661-43840683 TGTCCCAGGCTGTAGTACAGTGG + Intergenic
1025262092 7:57426297-57426319 TGGCCAAGGCTGAGAGACTCTGG + Intergenic
1025320605 7:58089308-58089330 TGGCCCAGGCTGAAATACACTGG - Intergenic
1026090435 7:67295233-67295255 TCTCCCAGTCTGAAATACAGTGG + Intergenic
1026141169 7:67708134-67708156 TGGCCAAGGCTGCAATGCAGTGG + Intergenic
1026404629 7:70052284-70052306 TGGCCAAGGGGGAATGACAGGGG + Intronic
1026684515 7:72496837-72496859 TTGCCCAGGCTGAAATACAGTGG - Intergenic
1027120032 7:75510546-75510568 TCTCCCAGTCTGAAATACAGTGG + Intergenic
1027271798 7:76525063-76525085 TCTCCCAGTCTGAAATACAGTGG - Intergenic
1027704430 7:81510867-81510889 TATCCAAGTCTGAAATCCAGCGG - Intergenic
1027996054 7:85426795-85426817 TGTGCTGGGCTGAAAGCCAGAGG + Intergenic
1028750385 7:94376292-94376314 TGTCCCAGGCTGGAATGCAGTGG + Intergenic
1028756535 7:94441320-94441342 TTGCCCAGGCTGAAATACAGTGG + Intergenic
1028898028 7:96063913-96063935 TCTCCAAGGCTGAATCCCAGAGG + Intronic
1028962849 7:96769172-96769194 TGCCCAAGGCTGAAGGCCTGAGG - Intergenic
1029487046 7:100849673-100849695 TGCCCAAGGCTGTAGGGCAGTGG - Intronic
1029717473 7:102339477-102339499 TCTCCCAGTCTGAAATACAGTGG - Intergenic
1030263104 7:107586765-107586787 TCACCAAGGCTGAAATGCAGTGG + Intronic
1031601163 7:123712041-123712063 AGTCCCAGGCAGAAGGACAGTGG - Intronic
1031622490 7:123951659-123951681 TCACCAAGGCTGAAGTACAGTGG + Intronic
1031740690 7:125426326-125426348 TGCCCTAGGCTGTAAGTCAGGGG - Intergenic
1031905672 7:127457744-127457766 TGTCCTGGGCTCAGAGACAGTGG + Intergenic
1032024844 7:128432965-128432987 TCACCCAGGCTGAAGGACAGTGG + Intergenic
1032898964 7:136284437-136284459 TGTCCCAGGCTGGAATGCAGTGG - Intergenic
1033680775 7:143594410-143594432 TGTCTCAGGCTGAAGTACAGTGG + Intergenic
1033704117 7:143867403-143867425 TGTCTCAGGCTGAAGTACAGTGG - Intronic
1034055158 7:148026409-148026431 TCACCCAGGCTGAAAGGCAGTGG - Intronic
1034167262 7:149035140-149035162 TGTCTAAGACTAAAAGACATTGG - Intergenic
1035306585 7:157936886-157936908 TGGCCATGGCGGAAAGACAGGGG - Intronic
1035950560 8:4016008-4016030 TGTCCAAGGCTGAAAGACAGTGG - Intronic
1036577266 8:10039841-10039863 TGTTCAGGTCTGAAACACAGTGG - Intergenic
1037162804 8:15793365-15793387 TGTGCAAGGCTGGAGTACAGGGG - Intergenic
1037256447 8:16960985-16961007 TTGCCCAGGCTGAAATACAGTGG + Intergenic
1037336038 8:17792822-17792844 TGTCACAGGCTGGAGGACAGTGG - Intronic
1037683764 8:21120088-21120110 TCTCCCAGGCTGGAATACAGTGG - Intergenic
1037704887 8:21310473-21310495 AGTCCAGGGCTGAGAGGCAGTGG + Intergenic
1037704956 8:21310772-21310794 AGTCCAAGGCTGGGAGTCAGTGG + Intergenic
1037705263 8:21312031-21312053 AGTCCAGGGCTGAGAGTCAGTGG + Intergenic
1038153835 8:24968452-24968474 TCACCAAGGCTGAAATGCAGTGG + Intergenic
1038373567 8:27015507-27015529 TTTCCCAGGCTGGAATACAGTGG - Intergenic
1038802888 8:30765311-30765333 TCACCAAGGCTGAAGCACAGTGG + Intronic
1038847885 8:31246628-31246650 TCACCCAGGCTGAAACACAGTGG + Intergenic
1038965486 8:32566891-32566913 TGGCCCAGGCTGAAATGCAGTGG + Intronic
1039052076 8:33504334-33504356 TCACCTAGGCTGAAGGACAGTGG + Intronic
1039059312 8:33560889-33560911 TCTCCAAGGCTGGAATACAGTGG - Intronic
1039318852 8:36405657-36405679 TGTCCCAGGCTGGAGGGCAGTGG + Intergenic
1039682678 8:39759180-39759202 TGTCCAATACTGAAAGAAAATGG + Intronic
1039856962 8:41423577-41423599 TTGCCAAGGCTGGAATACAGTGG + Intergenic
1040018888 8:42722599-42722621 TCTCCAAGGCTGGAATGCAGTGG + Intronic
1040512485 8:48107262-48107284 TGTTCAATGCTAGAAGACAGTGG - Intergenic
1041128661 8:54672189-54672211 TTTGGAAGGCTAAAAGACAGAGG - Intergenic
1041224993 8:55689354-55689376 TGCCCAAGGCTGGAAGAAATCGG - Intergenic
1041240062 8:55841658-55841680 TGTCCCAGGCTGAAGTGCAGTGG - Intergenic
1041530350 8:58858646-58858668 TGTCAAATGCTGACAGACAGGGG - Intronic
1041680780 8:60588241-60588263 TGGCCTAGGCTGGAATACAGTGG - Intronic
1041692676 8:60704291-60704313 TGCCCAAGGCTGGTGGACAGTGG + Intronic
1041699883 8:60776515-60776537 TGTCCCAGGCTGAGAGAGAGGGG - Intronic
1042638819 8:70909746-70909768 TCACCAAGGCTGGAATACAGTGG + Intergenic
1043034697 8:75181567-75181589 TCACCCAGGCTGGAAGACAGTGG - Intergenic
1043400013 8:79875182-79875204 TCACCCAGGCTGGAAGACAGTGG - Intergenic
1043429123 8:80177500-80177522 TTGCCCAGGCTGAAATACAGTGG + Intronic
1044469573 8:92550858-92550880 TCTCCAAGGCTGGAATGCAGTGG + Intergenic
1044698593 8:94947684-94947706 CCCCTAAGGCTGAAAGACAGTGG + Intronic
1044837437 8:96310202-96310224 TGTCCCAGGCTGGAGGGCAGTGG + Intronic
1045130478 8:99146610-99146632 TCACCTAGGCTGAAATACAGTGG + Intronic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1045278355 8:100727014-100727036 TGTCCCAGGCTGAAGCACAGTGG - Intergenic
1045404621 8:101853430-101853452 TGTCAGAGCCTAAAAGACAGAGG + Intronic
1045990530 8:108301055-108301077 TAGCCCAGGCTGAAATACAGTGG - Intronic
1046623478 8:116552643-116552665 TGTTGAAGTCTGAAAAACAGGGG - Intergenic
1046941054 8:119931897-119931919 TCTCCAAGGATGAAGGCCAGTGG + Intronic
1047074749 8:121388448-121388470 AGACCAAGGCTGAAAGAGTGTGG + Intergenic
1047417001 8:124672768-124672790 TTTCCCAGGCTGAAATGCAGTGG - Intronic
1047486173 8:125333207-125333229 TCGCCAAGGCTGAAATACAGTGG + Intronic
1047717630 8:127610343-127610365 TCGCCAAGGCTGGAATACAGTGG - Intergenic
1049185334 8:141248528-141248550 TTTCCCAGGCTGAAATGCAGTGG - Intronic
1049736527 8:144209864-144209886 TAGCCAAGGCTGAAATGCAGTGG - Intronic
1050370030 9:4911442-4911464 TGTACAATGTTGAAAGATAGTGG + Intergenic
1050541875 9:6677560-6677582 TGGCCCAGGCTGGAGGACAGTGG - Intergenic
1052637948 9:31126267-31126289 TCTCCCAGGCTGAAGTACAGTGG - Intergenic
1054740677 9:68803140-68803162 TGTCCAAGCCTGAAATCAAGGGG - Intronic
1055106089 9:72514637-72514659 TGGCCCAGGCTGAAGCACAGTGG + Intergenic
1055812505 9:80165657-80165679 TGTCCAGGGAAGACAGACAGGGG + Intergenic
1056135429 9:83625372-83625394 TGTCCAAGTCTGAAGTTCAGAGG + Intronic
1056401009 9:86227184-86227206 TTGCCAAGGCTGAAATGCAGTGG + Intronic
1056514041 9:87333368-87333390 TGACCCAGGCTGAAATCCAGTGG - Intergenic
1056596567 9:88012630-88012652 TGGCCAAGGCTGGAGTACAGTGG - Intergenic
1057365751 9:94419151-94419173 TTGCCTAGGCTGAAATACAGTGG + Intronic
1058024760 9:100129451-100129473 TCCCCCAGGCTGAAATACAGTGG - Intronic
1058132112 9:101264935-101264957 TGTCCAGGGCAGTAGGACAGAGG - Intronic
1058639253 9:107067152-107067174 TCTCCAAAGGTGAAAGGCAGTGG - Intergenic
1058696352 9:107562446-107562468 TGTCCCAGGCTGAAGTGCAGTGG + Intergenic
1058715393 9:107718114-107718136 TGTCAAAGCCTGAAAGACATAGG - Intergenic
1058986945 9:110217362-110217384 TCTCCCAGGCTGAAGGGCAGTGG - Intergenic
1059111887 9:111565560-111565582 TTGCCAAGGCTGGAGGACAGTGG + Intronic
1060125876 9:121044434-121044456 TCACCCAGGCTGGAAGACAGTGG - Intronic
1060401447 9:123352062-123352084 TCTCCCAGGCTGGAAGGCAGTGG + Intergenic
1061383238 9:130272278-130272300 TCTCCCAGGCTGGAATACAGTGG + Intergenic
1061612345 9:131755489-131755511 TCTCCCAGGCTGGAGGACAGTGG - Intergenic
1061734401 9:132643469-132643491 TGTCCATGGCTGGAAGCCCGGGG + Intronic
1185469154 X:372241-372263 TGTCAAAACCTGGAAGACAGAGG + Intronic
1185662631 X:1739302-1739324 TGGCCCAGGCTGAAATGCAGTGG + Intergenic
1185916190 X:4038004-4038026 TGTCGCAGGCTGAAAGAATGAGG + Intergenic
1186269699 X:7873493-7873515 TGTCCCAGGCTGAAGTGCAGTGG + Intergenic
1187166861 X:16812431-16812453 TGTCCCAGGCTGGAATGCAGTGG + Intronic
1187327960 X:18309159-18309181 TCTCCAAGGCTGAAGTGCAGTGG - Intronic
1187859504 X:23667672-23667694 TGTGCAGGGCTGGGAGACAGAGG + Exonic
1187948473 X:24449322-24449344 TTTCCAAAGCTGAAGGACAAAGG - Intergenic
1189461993 X:41250460-41250482 TCTCCCAGGCTGAAGTACAGTGG - Intergenic
1189463694 X:41262358-41262380 TTACCCAGGCTGGAAGACAGTGG + Intergenic
1190245926 X:48690162-48690184 TGTCCCAGGCTGGAGTACAGTGG + Intronic
1190395783 X:49981360-49981382 TGTGTAAGGCTCAGAGACAGGGG - Intronic
1190669217 X:52724638-52724660 TTACCAAGGCTGGAATACAGTGG + Intergenic
1190670200 X:52733766-52733788 TTACCAAGGCTGGAATACAGTGG - Intergenic
1193092473 X:77509880-77509902 TGTGCTGGGCTGAAAGCCAGTGG + Intronic
1193334423 X:80272162-80272184 TGTTGAAGGCTGAAAGAATGAGG + Intergenic
1194054947 X:89120196-89120218 TGGCCCAGGCTGAAGCACAGTGG - Intergenic
1194667251 X:96688909-96688931 TCGCCAAGGCTGTAATACAGTGG - Intronic
1195341485 X:103911175-103911197 TTGCAAAGGCTGAAGGACAGAGG - Intergenic
1196850269 X:119931143-119931165 TCTCCCAGGCTGAAGCACAGTGG - Intronic
1197256477 X:124268754-124268776 TCACCAAGGCTGAAGGGCAGTGG - Intronic
1198381399 X:136087248-136087270 TCACCCAGGCTGAAAGGCAGTGG + Intergenic
1198395665 X:136216558-136216580 TGGCCAAGGCTGGAGTACAGTGG - Intronic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1198800756 X:140445628-140445650 TCACCAAGGCTGGAATACAGTGG + Intergenic
1199458853 X:148060467-148060489 TCTCCAAGGCTGGAGGGCAGTGG + Intergenic
1199900038 X:152164211-152164233 TGTCCCAGGCTGAAGTACAGTGG + Intergenic
1200794986 Y:7332814-7332836 TCACCAAGGCTGAAGTACAGTGG + Intergenic
1201294277 Y:12450399-12450421 TGGCCCAGGCTGGAAGGCAGTGG + Intergenic
1201598506 Y:15699851-15699873 TTTTCAAGGATGAAAGACAATGG - Intergenic
1201920566 Y:19229361-19229383 TTTCCCAGGCTGGAATACAGTGG - Intergenic
1202391406 Y:24373899-24373921 TTTCCCAGGCTGGAATACAGTGG - Intergenic
1202479379 Y:25296218-25296240 TTTCCCAGGCTGGAATACAGTGG + Intergenic