ID: 1035954569

View in Genome Browser
Species Human (GRCh38)
Location 8:4061994-4062016
Sequence CTGAGAGGTCAAGGTGTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035954564_1035954569 -10 Left 1035954564 8:4061981-4062003 CCTGCTGCCCTGTCTGAGAGGTC 0: 1
1: 0
2: 24
3: 359
4: 2851
Right 1035954569 8:4061994-4062016 CTGAGAGGTCAAGGTGTAGTGGG No data
1035954563_1035954569 -9 Left 1035954563 8:4061980-4062002 CCCTGCTGCCCTGTCTGAGAGGT 0: 1
1: 0
2: 26
3: 371
4: 2316
Right 1035954569 8:4061994-4062016 CTGAGAGGTCAAGGTGTAGTGGG No data
1035954561_1035954569 -8 Left 1035954561 8:4061979-4062001 CCCCTGCTGCCCTGTCTGAGAGG 0: 1
1: 0
2: 4
3: 30
4: 347
Right 1035954569 8:4061994-4062016 CTGAGAGGTCAAGGTGTAGTGGG No data
1035954559_1035954569 -2 Left 1035954559 8:4061973-4061995 CCAAACCCCCTGCTGCCCTGTCT 0: 1
1: 1
2: 2
3: 42
4: 481
Right 1035954569 8:4061994-4062016 CTGAGAGGTCAAGGTGTAGTGGG No data
1035954560_1035954569 -7 Left 1035954560 8:4061978-4062000 CCCCCTGCTGCCCTGTCTGAGAG 0: 1
1: 0
2: 3
3: 61
4: 640
Right 1035954569 8:4061994-4062016 CTGAGAGGTCAAGGTGTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035954569 Original CRISPR CTGAGAGGTCAAGGTGTAGT GGG Intronic
No off target data available for this crispr