ID: 1035959616

View in Genome Browser
Species Human (GRCh38)
Location 8:4122740-4122762
Sequence CTGTGAAAGGGGAAGATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035959612_1035959616 -6 Left 1035959612 8:4122723-4122745 CCTAGAAGTAACACTTTCTGTGA 0: 1
1: 0
2: 1
3: 17
4: 196
Right 1035959616 8:4122740-4122762 CTGTGAAAGGGGAAGATTTCTGG No data
1035959610_1035959616 7 Left 1035959610 8:4122710-4122732 CCCAGGATTTTTTCCTAGAAGTA 0: 1
1: 0
2: 2
3: 31
4: 287
Right 1035959616 8:4122740-4122762 CTGTGAAAGGGGAAGATTTCTGG No data
1035959611_1035959616 6 Left 1035959611 8:4122711-4122733 CCAGGATTTTTTCCTAGAAGTAA 0: 1
1: 0
2: 0
3: 24
4: 312
Right 1035959616 8:4122740-4122762 CTGTGAAAGGGGAAGATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035959616 Original CRISPR CTGTGAAAGGGGAAGATTTC TGG Intronic
No off target data available for this crispr