ID: 1035960287

View in Genome Browser
Species Human (GRCh38)
Location 8:4128921-4128943
Sequence CCACCATGCCCGGCTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2164
Summary {0: 2, 1: 2, 2: 48, 3: 409, 4: 1703}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035960287_1035960296 18 Left 1035960287 8:4128921-4128943 CCTGTTTTAGCCGGGCATGGTGG 0: 2
1: 2
2: 48
3: 409
4: 1703
Right 1035960296 8:4128962-4128984 GCTACTTGGGAAGCTGAGGCAGG 0: 3151
1: 82470
2: 183763
3: 221046
4: 224580
1035960287_1035960290 4 Left 1035960287 8:4128921-4128943 CCTGTTTTAGCCGGGCATGGTGG 0: 2
1: 2
2: 48
3: 409
4: 1703
Right 1035960290 8:4128948-4128970 TGCCTGTAGTCCCAGCTACTTGG 0: 31791
1: 131261
2: 147110
3: 126565
4: 181119
1035960287_1035960294 14 Left 1035960287 8:4128921-4128943 CCTGTTTTAGCCGGGCATGGTGG 0: 2
1: 2
2: 48
3: 409
4: 1703
Right 1035960294 8:4128958-4128980 CCCAGCTACTTGGGAAGCTGAGG 0: 4249
1: 98735
2: 208990
3: 249224
4: 261078
1035960287_1035960291 5 Left 1035960287 8:4128921-4128943 CCTGTTTTAGCCGGGCATGGTGG 0: 2
1: 2
2: 48
3: 409
4: 1703
Right 1035960291 8:4128949-4128971 GCCTGTAGTCCCAGCTACTTGGG 0: 29903
1: 154936
2: 253675
3: 221513
4: 364385

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035960287 Original CRISPR CCACCATGCCCGGCTAAAAC AGG (reversed) Intronic
Too many off-targets to display for this crispr