ID: 1035963712

View in Genome Browser
Species Human (GRCh38)
Location 8:4166774-4166796
Sequence TAGCCCTACCAAAATGATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035963705_1035963712 28 Left 1035963705 8:4166723-4166745 CCAAAACCACCTATTGCCCCAAA 0: 1
1: 0
2: 9
3: 31
4: 314
Right 1035963712 8:4166774-4166796 TAGCCCTACCAAAATGATCAGGG No data
1035963707_1035963712 19 Left 1035963707 8:4166732-4166754 CCTATTGCCCCAAAACTATTGAA 0: 2
1: 7
2: 114
3: 336
4: 681
Right 1035963712 8:4166774-4166796 TAGCCCTACCAAAATGATCAGGG No data
1035963704_1035963712 29 Left 1035963704 8:4166722-4166744 CCCAAAACCACCTATTGCCCCAA 0: 1
1: 2
2: 77
3: 523
4: 1624
Right 1035963712 8:4166774-4166796 TAGCCCTACCAAAATGATCAGGG No data
1035963708_1035963712 12 Left 1035963708 8:4166739-4166761 CCCCAAAACTATTGAAGCATAAA 0: 1
1: 0
2: 11
3: 155
4: 973
Right 1035963712 8:4166774-4166796 TAGCCCTACCAAAATGATCAGGG No data
1035963710_1035963712 10 Left 1035963710 8:4166741-4166763 CCAAAACTATTGAAGCATAAAAA 0: 1
1: 0
2: 2
3: 97
4: 711
Right 1035963712 8:4166774-4166796 TAGCCCTACCAAAATGATCAGGG No data
1035963709_1035963712 11 Left 1035963709 8:4166740-4166762 CCCAAAACTATTGAAGCATAAAA 0: 1
1: 0
2: 13
3: 233
4: 1234
Right 1035963712 8:4166774-4166796 TAGCCCTACCAAAATGATCAGGG No data
1035963706_1035963712 22 Left 1035963706 8:4166729-4166751 CCACCTATTGCCCCAAAACTATT 0: 1
1: 6
2: 96
3: 314
4: 608
Right 1035963712 8:4166774-4166796 TAGCCCTACCAAAATGATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035963712 Original CRISPR TAGCCCTACCAAAATGATCA GGG Intronic
No off target data available for this crispr