ID: 1035966118

View in Genome Browser
Species Human (GRCh38)
Location 8:4193837-4193859
Sequence TGAAGAATGAATGGGAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 0, 2: 5, 3: 71, 4: 578}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035966118_1035966125 25 Left 1035966118 8:4193837-4193859 CCGTGTTTCCCATTCATTCTTCA 0: 1
1: 0
2: 5
3: 71
4: 578
Right 1035966125 8:4193885-4193907 GCCACCTCCACGAAGGAAAGCGG No data
1035966118_1035966128 29 Left 1035966118 8:4193837-4193859 CCGTGTTTCCCATTCATTCTTCA 0: 1
1: 0
2: 5
3: 71
4: 578
Right 1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG No data
1035966118_1035966122 3 Left 1035966118 8:4193837-4193859 CCGTGTTTCCCATTCATTCTTCA 0: 1
1: 0
2: 5
3: 71
4: 578
Right 1035966122 8:4193863-4193885 CCGAGAAGCCTCAGCAGAACTGG No data
1035966118_1035966124 18 Left 1035966118 8:4193837-4193859 CCGTGTTTCCCATTCATTCTTCA 0: 1
1: 0
2: 5
3: 71
4: 578
Right 1035966124 8:4193878-4193900 AGAACTGGCCACCTCCACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035966118 Original CRISPR TGAAGAATGAATGGGAAACA CGG (reversed) Intronic
901774919 1:11553927-11553949 TGAACAATGAAGGGAAAACAAGG + Intergenic
901793855 1:11669065-11669087 TGAAGAATGAGAAGGAACCAAGG - Intronic
903565373 1:24261375-24261397 TGAAGAATGAATAGGAATTAGGG - Intergenic
903866075 1:26398871-26398893 AGAAGAAAGGATGGGAATCAGGG + Intergenic
904138901 1:28336289-28336311 TGATAGATGAATGGGAAAAAAGG - Intergenic
905292635 1:36933028-36933050 TGCAGAATGAATGGTAAACGTGG - Intronic
906794203 1:48683869-48683891 TGGAGAATGAATGAGGAAGACGG + Intronic
907150902 1:52286590-52286612 GGAGGAATGAATAGGAGACAGGG - Intronic
907189693 1:52638234-52638256 TGGAGAAAGAATGGTAGACAGGG + Intronic
907687761 1:56630664-56630686 TAAAGTAGGAATGGAAAACAGGG + Intronic
908110036 1:60887685-60887707 TGAAGATACAATGGGAAACAAGG + Intronic
908290243 1:62658651-62658673 TGAAGAATGAAGGGGAAGGCCGG + Intronic
908633062 1:66131763-66131785 AGAACAATGAATGAGAAACATGG + Intronic
908749490 1:67406714-67406736 TGAAGAATGTATTGGAAGCCTGG - Intergenic
908980959 1:69958379-69958401 TGAAGTGTGAATGGGAGATAAGG + Intronic
909265722 1:73555924-73555946 TAAAGATTGACTGGGAAACCCGG - Intergenic
909294160 1:73924634-73924656 TGAAGAGAGAATGGGGACCAGGG - Intergenic
909318654 1:74254205-74254227 TGAAGACTGAAGTGGCAACAGGG - Intronic
909537044 1:76748815-76748837 TCAAGAATGTAAGGGAACCATGG - Intergenic
909910578 1:81252970-81252992 TGAACAATGAATGAGAAATCTGG + Intergenic
910037143 1:82802014-82802036 TGAAGAAGGAAATGGGAACATGG + Intergenic
910218438 1:84865339-84865361 TGCTGAATGAATGGGAATGATGG + Intronic
910690819 1:89963966-89963988 TGCAGAATGCATGGGCAGCATGG - Intergenic
910785231 1:90990472-90990494 TGAACCCTGAAAGGGAAACAAGG + Intronic
910909591 1:92218905-92218927 TGAGGAATGAATCAGAAACCTGG - Intronic
911882093 1:103252379-103252401 TGGAAAGTGAAGGGGAAACAAGG - Intergenic
911905893 1:103568543-103568565 TGAATTAAGGATGGGAAACAGGG + Intronic
911931464 1:103909252-103909274 TAAAGAGTGAAAGGGAAAGAAGG + Intergenic
912322418 1:108726932-108726954 TGAAGGATGAATGGGAATGTAGG + Intronic
912662967 1:111550503-111550525 AGAAAAATGTATGGGATACAGGG - Intronic
912802807 1:112731358-112731380 AGAATGAAGAATGGGAAACATGG + Intergenic
912845565 1:113071995-113072017 TGAAGTATATATTGGAAACAAGG - Intergenic
913274874 1:117127186-117127208 TAGAGAATGAATTGAAAACAGGG - Intergenic
914795410 1:150915970-150915992 GAAAGAAGGAATGGGAAACAAGG - Intergenic
914993953 1:152523762-152523784 TGAAGAAGGAAAGGAAAAAAAGG - Intronic
915282691 1:154833395-154833417 GGAAGCATGGCTGGGAAACACGG - Intronic
915937017 1:160095595-160095617 TGAGGAAGGAATGGCAGACATGG - Intronic
915971199 1:160356459-160356481 AGAAGAAAGAAAGGAAAACAGGG - Intronic
916349524 1:163833263-163833285 TGAGGAATGAATGGGAAATGAGG - Intergenic
916463333 1:165048539-165048561 GGAAGATTTAAAGGGAAACATGG - Intergenic
917076731 1:171213955-171213977 GGAAGAATTAAAAGGAAACAGGG + Intergenic
917265177 1:173213262-173213284 TGAAGAATGAAAGGGAAAATTGG - Intergenic
918544109 1:185663138-185663160 TGACAAATGAATGAGAAACGCGG + Intergenic
918559550 1:185848179-185848201 TGAAGAGTGAATGGCAGAAATGG - Intronic
919060966 1:192632273-192632295 TGAAGCATGAATGAGAAAAGTGG + Intergenic
919062044 1:192645630-192645652 AGAAGAATGGAGGGGACACAAGG + Intronic
919880722 1:201898969-201898991 TGCAGAATGAAAGAGAAGCATGG + Intronic
920242857 1:204566255-204566277 TGGAGACTGAATGGTAAAAATGG - Intergenic
920832410 1:209477502-209477524 TGAAGAAAGACTGGAAAAGAAGG - Intergenic
921180706 1:212629411-212629433 TGAAGAAAGAATGGGGAGAAAGG + Intergenic
921376694 1:214481648-214481670 TGAAGTAAGATTGGTAAACAAGG + Intronic
921655160 1:217726164-217726186 TGAAGAATAAATTGGAGAAATGG + Intronic
921873012 1:220161601-220161623 TGAAATATGAATGAGAAAAAAGG + Intronic
922251599 1:223854108-223854130 TGAAGAATCCATGCTAAACAAGG - Intergenic
922409844 1:225361997-225362019 TGAATAATGAATGAAAGACATGG - Intronic
923183476 1:231546980-231547002 TTAAGGAAGAATGGGAAATACGG + Intronic
924191911 1:241562462-241562484 TGAAGAATAAATGGGATGCATGG + Intronic
924807489 1:247372963-247372985 TAGAAAATGAATGGGAAACCCGG + Intergenic
1063087439 10:2832427-2832449 TGAAGACTTATTTGGAAACAGGG - Intergenic
1064252916 10:13720638-13720660 TGAAGCACAAATGGGAACCAGGG + Intronic
1064364059 10:14691256-14691278 TGAGGGAAGAATGAGAAACATGG + Intronic
1064510687 10:16087319-16087341 AAAAAAAAGAATGGGAAACATGG + Intergenic
1064856798 10:19777652-19777674 TTGAGAATGTATGGGAAACTGGG + Intronic
1064940153 10:20725228-20725250 CAAAGAATGAATGGGAAATCAGG - Intergenic
1067438085 10:46292809-46292831 GGTAAAATGAATGGGCAACAAGG + Intronic
1067574887 10:47402946-47402968 GGTAAAATGAATGGGCAACAAGG + Intergenic
1067856870 10:49801964-49801986 TGAAGAGTGAGGGGGATACAGGG - Intergenic
1067966037 10:50913784-50913806 TAAAGAAAGAATAGGACACAAGG - Intergenic
1068437305 10:57009315-57009337 TGCTGAATGAATGAGAAACAGGG - Intergenic
1068481390 10:57592369-57592391 TGAAAAGTGAATAGAAAACAAGG + Intergenic
1068539594 10:58276490-58276512 TGAAGAATGACTTTGAAACCTGG + Intronic
1068852822 10:61763859-61763881 TGAAGAATGACAAGGAAACACGG + Intronic
1068935794 10:62634328-62634350 ACAAAAATGACTGGGAAACAGGG + Intronic
1069035413 10:63641706-63641728 TGAAGACTGCATGGTAATCAGGG - Intergenic
1069290148 10:66768940-66768962 TGAAGAGTGAATGAGAGATAAGG + Intronic
1070191858 10:74118536-74118558 GGAAGAGTGAATGGGAGCCAAGG - Exonic
1070390195 10:75963450-75963472 TGAAGAATGAGAGGCAAATAAGG - Intronic
1071266360 10:83968262-83968284 TGATGAATGACTGAGACACAGGG + Intergenic
1072295863 10:94009119-94009141 TGCAGACTGCATAGGAAACATGG + Intronic
1072348975 10:94539459-94539481 TGAAGAATCAGTGGGAGGCAAGG + Intronic
1072779494 10:98237192-98237214 TAAACAATGATTGGAAAACATGG - Intronic
1072853807 10:98925441-98925463 TGAAGGCTGAATGGGCAACCTGG - Intronic
1073900721 10:108217021-108217043 AGAAGAATTAATGGGACTCATGG - Intergenic
1074282086 10:112062201-112062223 TTTAGAATGAATAGGAAAGAGGG - Intergenic
1074820928 10:117177870-117177892 TGCAGAATGTATGGGAGGCATGG + Intergenic
1075110490 10:119576802-119576824 TGAAGAAAGAGTGGGAGACAAGG + Intronic
1075533709 10:123252646-123252668 AGGAGAATGGATGGGAAAGAAGG - Intergenic
1075754046 10:124796697-124796719 TCAAGAGGTAATGGGAAACAAGG - Intergenic
1076560041 10:131356566-131356588 AGAGGAACGAATGGGAAAAACGG + Intergenic
1077449655 11:2631263-2631285 TAAAGAATGAAAAGGTAACAAGG - Intronic
1077452624 11:2658590-2658612 TGGAGAATGAATAGAAAACCTGG + Intronic
1077837859 11:5939863-5939885 TTAAGATTGAAACGGAAACATGG - Intergenic
1077890957 11:6418348-6418370 TTAAGAATGAATGGGAAGTAAGG + Intronic
1078488803 11:11750069-11750091 TGAAGAATGACTAGGACAAATGG - Intergenic
1079758527 11:24298392-24298414 GGAAGAATGAATAGCAAGCATGG - Intergenic
1080177560 11:29384412-29384434 TTAAGAATGATTTGTAAACATGG + Intergenic
1080752099 11:35160098-35160120 TGAAAAATGAATGGGAAGCTGGG - Intronic
1080838925 11:35966498-35966520 TGATGAAATAATAGGAAACAAGG + Intronic
1081032892 11:38109584-38109606 AGAAAAATTAATCGGAAACAAGG - Intergenic
1083514549 11:63244484-63244506 TCAAGAAGGAATTGGAAATAAGG + Intronic
1083661074 11:64252005-64252027 GGAAGAACGAATGGAAAACGGGG - Intronic
1084368534 11:68720387-68720409 TAAAGAATGAATGGGAGATGAGG - Intronic
1084999007 11:73011800-73011822 TTAAAAAGGAAAGGGAAACAAGG - Intronic
1086134113 11:83429817-83429839 GGAAGAAAGAATGGGAAGTAAGG + Intergenic
1086791281 11:91041467-91041489 TGAAGGATGGATTGGAATCAGGG + Intergenic
1087080645 11:94168051-94168073 TGAAGAGTGAATGGGAGGTAAGG + Intronic
1088635750 11:111818820-111818842 TGAAGAATGCATGAAAAAAAGGG + Intronic
1088970121 11:114766595-114766617 AGAAGAATGAAGGGGAAAGAAGG - Intergenic
1089694146 11:120206212-120206234 TCAAGAGTCAATGGGCAACATGG + Intergenic
1089891474 11:121885848-121885870 TGAAGGGTGACTGTGAAACAAGG + Intergenic
1090442325 11:126734840-126734862 TGAAGAATGAATGGGAGTTAGGG + Intronic
1091113405 11:132992663-132992685 AGAATAATGAATGGGGAGCAAGG + Intronic
1091257398 11:134201628-134201650 TGAACAATGCACTGGAAACATGG + Intronic
1091417123 12:297824-297846 TGCAGACTGACTGGGAAAGAAGG - Intronic
1091788250 12:3256151-3256173 TGATGAAAGAATGAGAAAGAGGG + Intronic
1091863998 12:3814054-3814076 TGGAGAATAAATGGTATACATGG - Exonic
1092811202 12:12272877-12272899 TGAGAAATGAAGGGGAAACAGGG + Intergenic
1093227975 12:16508255-16508277 TAATGAATGAGTGGGAAAGAAGG - Intronic
1093303031 12:17477873-17477895 TGAAGAAAGAATTGGGGACAAGG - Intergenic
1093317615 12:17669920-17669942 TAAAAAATGAATGGGAAGTAAGG + Intergenic
1093425927 12:19028862-19028884 TGAAGAATGAATGAGAATAAGGG + Intergenic
1093660883 12:21755158-21755180 TGTTGAATGAGTGGGAAAAAAGG + Intronic
1093684268 12:22038591-22038613 TGGCGAATGATTGGCAAACATGG - Intergenic
1093935974 12:25001230-25001252 AGAAGAAAGCCTGGGAAACATGG + Intergenic
1094739726 12:33275072-33275094 TGAAGGCTGAGTGGGAAACTAGG + Intergenic
1095231061 12:39740683-39740705 GGAAGAAAGAATGGGAGACTTGG + Intronic
1095670898 12:44859062-44859084 TGAAGAATGATTAGAAAACTAGG - Intronic
1097354662 12:58587569-58587591 TGTAGAATGAATGGGAGCCCCGG - Intronic
1097937659 12:65271577-65271599 GGAATATTGAATAGGAAACATGG - Intergenic
1099223762 12:79944252-79944274 TGAGGAATGAATAGAAAACGTGG - Intergenic
1099486639 12:83236910-83236932 AAAAGAATGAATTGGAAACCTGG - Intergenic
1099831429 12:87847992-87848014 TGAAAAATGTAAGGGACACAGGG - Intergenic
1100412289 12:94331835-94331857 AGAAGAATGTATGTAAAACATGG + Intronic
1101096212 12:101344105-101344127 TGAAGAATGAGTATAAAACAGGG - Intronic
1101539760 12:105654198-105654220 GGAAGGATAAATGGGAACCATGG + Intergenic
1101658689 12:106747154-106747176 GGAAGAATGAGTGGGTAATAAGG + Intronic
1102461218 12:113100714-113100736 GGAAGCAGGAATGGGAATCAGGG - Intronic
1102723288 12:115035968-115035990 GGAAGAGTGAATGGGAAATGGGG + Intergenic
1103271761 12:119679499-119679521 TGAAGAATGAAACGGATACCTGG - Intronic
1103640416 12:122346915-122346937 TGGAGAAGGAAATGGAAACATGG - Intronic
1104192499 12:126496318-126496340 TGCAGATTGAGTGGGAAAAAAGG + Intergenic
1105969707 13:25417159-25417181 CCAAGAATTAATGGGAAACTGGG - Intronic
1106001783 13:25730377-25730399 TGAAGAACAAAAGGGAATCATGG + Intronic
1106019811 13:25903767-25903789 TGAAAAGTGACTTGGAAACAGGG - Intronic
1106185000 13:27401512-27401534 GGGAGTAGGAATGGGAAACAAGG + Intergenic
1106423985 13:29608302-29608324 TGTAGTATGATTGGGAAAGATGG - Intergenic
1106952940 13:34905116-34905138 GGAAGAATTAATGGGGAACTGGG + Intergenic
1107125943 13:36846645-36846667 TGGAGAATTATTGGAAAACAGGG + Exonic
1107525673 13:41228909-41228931 GGAAGAAAGAATGGGAGAAATGG + Intronic
1107835215 13:44407470-44407492 TGAAGGATGATGAGGAAACAAGG + Intergenic
1107963789 13:45581120-45581142 TGGGGACTGGATGGGAAACATGG + Intronic
1108281430 13:48866066-48866088 GGAAGGATGAGTGGAAAACATGG - Intergenic
1108286434 13:48913849-48913871 TAAAGAATAAATGGGAGAGAAGG - Intergenic
1108303434 13:49105108-49105130 AGAAGAATAGGTGGGAAACATGG + Intronic
1108545531 13:51489451-51489473 TGAAGAATTGATGGGAGAGAAGG - Intergenic
1108554440 13:51579320-51579342 TGAAGAGAGAATGGGAAATGAGG + Intergenic
1109237279 13:59840039-59840061 TGAAGAAGAAATGGTAAACCAGG + Intronic
1109350277 13:61171124-61171146 TGATGAATGAGATGGAAACAAGG - Intergenic
1110521395 13:76482687-76482709 TGAAGAAAGAATGAGAAAACTGG - Intergenic
1111038903 13:82718095-82718117 TGAAGAGTGAATGTGATATAAGG - Intergenic
1111224260 13:85248920-85248942 TAGAGAATGAATGTGAAACAAGG - Intergenic
1111317672 13:86583061-86583083 TTCAGAATGAATGGAGAACATGG - Intergenic
1112732613 13:102382734-102382756 TGAAGAATGAATTTTAAAAAGGG + Intronic
1112930953 13:104737496-104737518 AGAAGAATGATTTGAAAACAAGG - Intergenic
1113014331 13:105810736-105810758 GGAAGAATTACTGGGAATCAAGG + Intergenic
1113014338 13:105810801-105810823 GGAAGAATTACTGGGAAGCAAGG + Intergenic
1114820179 14:26008969-26008991 AGAAGAATGTAAAGGAAACAGGG + Intergenic
1115030193 14:28785426-28785448 TGAAGACTGAAGGGGAAAGAGGG - Intronic
1115164804 14:30436254-30436276 TCCAGAATGAATGAGAAGCAGGG - Intergenic
1115321202 14:32080976-32080998 TGAAGAGTTAATGGTAAAAATGG + Intronic
1115687976 14:35816649-35816671 TCAAGAATGAAAGAGACACAAGG - Intergenic
1115751585 14:36498798-36498820 TGAAGAATGGAATGGAAATAGGG - Intronic
1116384030 14:44308977-44308999 TGAAAAGTGAAGGGGAAGCAAGG - Intergenic
1116394767 14:44434313-44434335 AGGAGAATGAAGGAGAAACAGGG + Intergenic
1116505942 14:45681362-45681384 TGAAGAATGAATTGCAGAAAGGG - Intergenic
1116604488 14:46972094-46972116 AGAAGTATGGATGGCAAACAGGG + Intronic
1117075549 14:52099905-52099927 TGAAGTTTCAATGGCAAACAAGG - Intergenic
1117233146 14:53742973-53742995 AGAGGCATAAATGGGAAACAAGG - Intergenic
1117313145 14:54548362-54548384 TGGAGAATGAATGGGTATGATGG - Intergenic
1117720138 14:58620828-58620850 TGAATAATGAAAGGGTAAAATGG + Intergenic
1118121265 14:62846633-62846655 TAAAGAATGAATTGTAAAGATGG - Intronic
1118935654 14:70285414-70285436 TGAAGAAAGAATGGGAAGTAAGG - Intergenic
1119291577 14:73499506-73499528 AAAAGAATGAATCAGAAACAGGG + Intronic
1119528385 14:75341359-75341381 TGATGAATGAATGACAAGCAGGG + Intergenic
1119977299 14:79039410-79039432 TGAAGAAAGAAAAGGAAATAAGG - Intronic
1120045011 14:79795930-79795952 AGAAGAAAGAAAGGGAAAAAGGG + Intronic
1120101797 14:80453109-80453131 TCAAGAAAGAATGGGAGACTGGG - Intergenic
1120328816 14:83061330-83061352 TTAAGATTTAATGGGAACCACGG + Intergenic
1120776197 14:88440275-88440297 TGAAGACTGAATGTCAAATAGGG - Intronic
1120794145 14:88613434-88613456 TATAGAACAAATGGGAAACAAGG + Exonic
1121628393 14:95404249-95404271 TGCAGGCTGAACGGGAAACATGG - Intergenic
1122253257 14:100456060-100456082 TCAAGAATGAATGTGAAGCCAGG + Intronic
1123783884 15:23649448-23649470 AGGAGAATGAAAGGGATACATGG - Intergenic
1124125568 15:26935795-26935817 TCAAGGATGAAAGGGAAGCAGGG - Intronic
1124907483 15:33884819-33884841 TGAAGAGTGAATGTGAAAGATGG + Intronic
1126033192 15:44520868-44520890 AGAATAATGAATGGGAGATATGG + Intronic
1126283022 15:46978911-46978933 TCAAGCAGGAATGAGAAACAAGG + Intergenic
1127519539 15:59729671-59729693 TGCACAATGACTGGGAAACATGG - Intergenic
1127680660 15:61294205-61294227 TCAAGAATGAATGTGAAATAAGG + Intergenic
1127829008 15:62733331-62733353 TGGAGAATGGATGGGAAGCAAGG + Intronic
1128239617 15:66093063-66093085 TGAGCCATGACTGGGAAACAGGG - Intronic
1128478387 15:68016656-68016678 TGCAGGCTGAATAGGAAACATGG - Intergenic
1129636973 15:77330539-77330561 AGGAGAATGTATGGGAAACAGGG - Intronic
1130106133 15:80929872-80929894 TGGAGAATGAATGGGTGACTTGG + Intronic
1130367473 15:83253447-83253469 TTGATAATGAATGGGAAAGAAGG + Intergenic
1131683811 15:94750717-94750739 TTAAGAAAGAAGGGGAAATACGG + Intergenic
1131826403 15:96325200-96325222 AGAAGAATAATGGGGAAACACGG - Intergenic
1132301628 15:100779694-100779716 AGAAGAATGATTTGGAAAAAAGG - Intergenic
1133658378 16:7889476-7889498 TGATGAATAAATGGGAGACAGGG + Intergenic
1133930278 16:10226698-10226720 TGAAAAAGCAAAGGGAAACATGG + Intergenic
1134297716 16:12961614-12961636 TGAAGAAAGAAGGGGGAAGAAGG + Intronic
1135656928 16:24258099-24258121 TGAAGAACCAATGGCAAGCAGGG - Intronic
1135975990 16:27109333-27109355 GGGAGAATGAAAGGGAAAGAAGG + Intergenic
1137677079 16:50309039-50309061 TGAAGAATGAATGGGATGTCAGG - Intronic
1138165917 16:54801493-54801515 TGAATAATTAACTGGAAACACGG + Intergenic
1138255277 16:55552510-55552532 TTCAGAATGAATGCAAAACAAGG - Intronic
1140325344 16:73996031-73996053 CGGAGAAAGAAGGGGAAACATGG - Intergenic
1140343320 16:74187356-74187378 TCAAAAATGAAAGGGAAATAAGG - Intergenic
1140865365 16:79056341-79056363 TGAAGAATGACTGTAATACATGG + Intronic
1141498825 16:84429635-84429657 TGGAGAATCGATGGGAATCAAGG + Intronic
1141525462 16:84608183-84608205 TAAAGAAAGGATGGGAGACAAGG + Intronic
1141609718 16:85174531-85174553 TGTTGAATGAATGGGAAGGAGGG - Intronic
1142907198 17:3051941-3051963 TCAACAATGCATGTGAAACAGGG - Intergenic
1142953309 17:3502564-3502586 TGAAATATGAAAGAGAAACAAGG + Exonic
1143266551 17:5642333-5642355 ACAAGGATGAATGGGAATCAAGG - Intergenic
1143365028 17:6401876-6401898 TGCAGACTGTATGGGAACCATGG + Intronic
1143594909 17:7908296-7908318 TGAATAATGAAAGGGAACTAAGG - Intronic
1144150185 17:12435664-12435686 TGCAGGCTGTATGGGAAACATGG - Intergenic
1144323161 17:14150581-14150603 TGAACACAGAATGGGATACAAGG - Intronic
1144732368 17:17536182-17536204 TGCAGATTGAATAGGATACATGG - Intronic
1146927922 17:36757723-36757745 TGCAGAAGGAGTAGGAAACACGG + Intergenic
1146994885 17:37311157-37311179 TTAAGAATGAATGGGAGATGAGG + Intronic
1147200230 17:38796574-38796596 GGAAGAATGTGTAGGAAACAAGG - Intronic
1148065073 17:44863065-44863087 AGAAGGATGAATAGGAGACATGG + Intronic
1148121810 17:45217455-45217477 TGGGGAGGGAATGGGAAACAGGG + Intergenic
1148697920 17:49572262-49572284 TCATGAATGAATGGGAAATGGGG - Intergenic
1149136164 17:53367193-53367215 TGTAGAATGAAAGGGCAAAATGG + Intergenic
1149440974 17:56673597-56673619 TGAAGAAAGCAAGTGAAACAGGG + Intergenic
1149736966 17:59004131-59004153 TTAAGAATGAAGGGGATAAAGGG + Intronic
1150853196 17:68725404-68725426 GGAAGAATGAATGGGTAAGGTGG - Intergenic
1152831278 17:82498230-82498252 AGAAGAGTGAATAGTAAACATGG - Intergenic
1152992315 18:374715-374737 ACAAGAATGAATGGGGAAGAAGG - Intronic
1153362617 18:4214388-4214410 TGCTGAATGAATAGGAAAAATGG - Intronic
1154321572 18:13357841-13357863 TCAAGGATGACTGGGAAACTTGG - Intronic
1155183963 18:23371613-23371635 TGAGGAATGAGAGGGAACCAAGG - Intronic
1155718113 18:28971896-28971918 TGTATATTGAATGGGAAAAATGG - Intergenic
1155904937 18:31438842-31438864 TGAAGGAGGGATGGGGAACAAGG + Intergenic
1156602099 18:38619602-38619624 TGAAGGATGAAGGGGAAAAGAGG - Intergenic
1156768550 18:40689646-40689668 AGAATAATGAAGGGGAGACAGGG - Intergenic
1157461011 18:47894037-47894059 TGTAAAAAGAATGGGAAATAAGG + Intronic
1157676837 18:49574976-49574998 GGCAGAATGAATGGGACAAATGG + Intronic
1159034203 18:63261558-63261580 TGTTGAATGAATAGGAAAAAGGG + Intronic
1159222771 18:65486618-65486640 TATAGCATGAATGTGAAACAGGG + Intergenic
1159810806 18:73016177-73016199 TTAAGAATGAATGTGCAAGAGGG - Intergenic
1159947286 18:74454004-74454026 TGCAGAATGAATGAGAAGCCAGG + Intronic
1161434727 19:4256297-4256319 ATAAGAATGGATGGGAAATATGG - Intronic
1162302823 19:9853835-9853857 TGAGGAATGGGTGGGAAGCAAGG + Exonic
1162769962 19:12943513-12943535 TGGAGGATGAATGGGAAGGATGG - Intronic
1163384012 19:16988091-16988113 GGAAAAATGAATGGCAGACACGG + Intronic
1163982331 19:20912760-20912782 TGATGAATGAATGGGTGACAGGG - Intergenic
1164019790 19:21290418-21290440 TTAAGAGTGAATGTTAAACATGG - Intronic
1164889667 19:31812523-31812545 GGAAGAATGAATGGCAATCAAGG + Intergenic
1166346224 19:42167814-42167836 TGGAGAATGAATGGGTCAGAAGG - Intronic
1166636099 19:44452936-44452958 TGAAGAGTAACTGGGAAACGTGG + Intergenic
1167767815 19:51495888-51495910 TGAAGGATGAATAGGAATCAGGG + Intronic
925258566 2:2510237-2510259 TGAAGAATTCATGGGAAGCAGGG - Intergenic
925290150 2:2742499-2742521 TGAAGAATGTCTGGAAAATAAGG + Intergenic
925651106 2:6090278-6090300 TGGAAGATGAAGGGGAAACAAGG + Intergenic
925676547 2:6368024-6368046 TGAAAAATGAATGGGAGGCCGGG + Intergenic
925680691 2:6418167-6418189 TGAGGAAAGAAGGGGAGACAAGG - Intergenic
925761621 2:7190325-7190347 TGGAGACTGAATGAGAATCAAGG + Intergenic
925767738 2:7253197-7253219 TGAGGAGTGAATGGGATTCATGG + Intergenic
926184630 2:10679536-10679558 GGAAGAAAGAATGTGAAACATGG - Intronic
926791708 2:16578497-16578519 TGAATAATGTATGGTAAAAATGG + Intronic
926947192 2:18201233-18201255 TGAAGAAGGAAGAGGCAACATGG - Intronic
927737955 2:25539175-25539197 TTGTGAATGAATGGAAAACATGG - Intronic
928111171 2:28509943-28509965 TGAAGATTCAAAGGGAAACTTGG - Intronic
928189863 2:29154350-29154372 TGGGGACTGGATGGGAAACAAGG - Intronic
928292442 2:30051310-30051332 TGATGAAAGAATGGGGACCAGGG + Intergenic
928343199 2:30464144-30464166 TGAAAAAGTAATTGGAAACATGG + Intronic
928586057 2:32759718-32759740 TGGGGAACGAAGGGGAAACAGGG - Intronic
928926448 2:36584607-36584629 CAAAGAATAAATGGGCAACAAGG + Intronic
929096752 2:38269744-38269766 GGTAGAAAGGATGGGAAACATGG + Intergenic
929603731 2:43221020-43221042 TTAGGAATGAAGTGGAAACAAGG + Intergenic
930302249 2:49631344-49631366 TGAAGACTGAAGGGGAGAAAGGG - Intergenic
931452522 2:62380072-62380094 TGCAGATTGAATGGGGATCAAGG + Intergenic
931984935 2:67732597-67732619 GGCAGAATAAATGGAAAACAAGG - Intergenic
932209373 2:69914817-69914839 TATAGAACCAATGGGAAACAAGG + Intronic
932967443 2:76493203-76493225 TGAAGAATGAACGAGAAGCAAGG - Intergenic
933031973 2:77339782-77339804 TGAGGAGTGAAGGGGAAAAAGGG + Intronic
933512255 2:83255710-83255732 GGAAGAAGGAATGGGAAGCGAGG + Intergenic
933737885 2:85509941-85509963 TGAAGCATCAATGTTAAACAGGG + Intergenic
934035127 2:88082751-88082773 AGAGAAATGAATGGGAAGCAAGG + Intronic
934575350 2:95397149-95397171 TGAGGAATGAATGGGAGACAAGG + Intergenic
934688245 2:96337071-96337093 TGAAAAATGAGTGGGAAATGAGG + Intronic
935503142 2:103866944-103866966 TGCAGAAAGAATGGGCCACAGGG - Intergenic
936582848 2:113719633-113719655 TGAAGAAGAAATGAGCAACATGG - Intronic
937161298 2:119764398-119764420 TTAAGCACGAATGAGAAACAAGG - Intronic
937509283 2:122575515-122575537 TGAAGAATTAAAAGGAAATATGG + Intergenic
937933695 2:127225470-127225492 TTAAGAATTAATGGGTAAAAAGG + Intergenic
938576256 2:132607100-132607122 TGTAGAATGAAAAGGAAGCAGGG + Intronic
939019189 2:136938904-136938926 TACAGAATTAATGGGAAAAAAGG + Intronic
939148025 2:138440075-138440097 TGAAGAATGAATAGAAATGATGG - Intergenic
939435951 2:142178006-142178028 TGCAGAATGAGGGGGAAAAAAGG - Intergenic
939707056 2:145468157-145468179 TGTGGAAGGAATGAGAAACAAGG - Intergenic
939952097 2:148487889-148487911 TGAAGAATGTAAGAGAAATAGGG + Intronic
940768036 2:157810826-157810848 TGAAGACTGGATGGGGGACATGG - Intronic
940818195 2:158319996-158320018 TGAAGAATAAAATGGTAACATGG - Intronic
941115841 2:161471453-161471475 TGAAAAATGGGTGGGAATCAAGG + Intronic
941290816 2:163672168-163672190 TGAAGAATGAGGGGAAAAAATGG - Intronic
941517826 2:166501892-166501914 TCAAGAATGTATGGGAAAAAAGG + Intergenic
941615165 2:167710667-167710689 TGCAAAATGAATGGGAAACAGGG - Intergenic
942421795 2:175815337-175815359 TGAAGAATGAGTGGGAATTAGGG - Intergenic
942488765 2:176468423-176468445 TGAGGAAGGAATAGGAAATAAGG + Intergenic
942998252 2:182291670-182291692 GGAAGAATGAGTGGAAAATAGGG + Intronic
943490006 2:188540271-188540293 TGAAGAATGAATAATTAACACGG + Intronic
944895634 2:204160956-204160978 TGAAAAATGAATGGAATTCAGGG + Intergenic
945180961 2:207090714-207090736 TGGAGAATGAATCCAAAACAGGG + Intronic
945385497 2:209195227-209195249 TGAAGAACTAATGAAAAACAAGG - Intergenic
945408699 2:209483843-209483865 GGAAGATTAAATGGGACACATGG + Intronic
946176412 2:217924540-217924562 TGAAGAATGAAAGTGATTCAAGG + Intronic
946379577 2:219336638-219336660 TTAAGAATGAAAGTGAAATAAGG + Intergenic
946594263 2:221288732-221288754 TGAAGAATGAGTAGCCAACATGG + Intergenic
946793687 2:223327383-223327405 TGAAGAATTAAAAGGAAACTGGG - Intergenic
946846020 2:223859660-223859682 TGAAGACTAAATGGGAGAAATGG - Intronic
1169008442 20:2229386-2229408 TTAAGAATGGATGGGTAAGAAGG + Intergenic
1169210940 20:3766015-3766037 TGAAGAAGGAATGAGAAATGAGG - Intronic
1169408480 20:5346743-5346765 GGAAGAAAGAATGGGGAACATGG + Intergenic
1171107458 20:22448532-22448554 TGGAGAAGAAATGAGAAACAGGG - Intergenic
1171203528 20:23260863-23260885 TGAAGAATGAGTTGGAGATAAGG + Intergenic
1172101364 20:32485328-32485350 TGAACAATCCATGGTAAACAAGG + Intronic
1172439113 20:34953109-34953131 TGAAAAATGAATGAGTATCAGGG - Intronic
1173886316 20:46462219-46462241 TAAAGAATGAGTGGGATCCAAGG + Intergenic
1174175288 20:48640761-48640783 TGATGAATGAATGGGTAGAAGGG + Intronic
1174981438 20:55399554-55399576 TGAAGTCTGAATGGGGAACATGG + Intergenic
1175072425 20:56345590-56345612 TGAAGGATAAATGGGAGACAGGG + Intergenic
1175329501 20:58153555-58153577 TGAAGGCTGAATCGGAAGCACGG + Exonic
1175421863 20:58839861-58839883 AGAAGAAGGGATGGGAAAAAAGG - Intronic
1177484022 21:21731858-21731880 TGAAGAAGGAGTGGGTAACCCGG + Intergenic
1177778634 21:25598673-25598695 TCAAGAAAGAATGAGAAAAAGGG - Intronic
1177805391 21:25869964-25869986 TGAAGGATGAATGGGAACAGTGG + Intergenic
1178124780 21:29504750-29504772 TCACGAAGGAATGGGGAACATGG + Intronic
1178146599 21:29747527-29747549 TGAAGAAAGAATAGAAAGCATGG + Intronic
1178340686 21:31783577-31783599 TGAAGATGGAAAGGGAGACATGG - Intergenic
1178807832 21:35854278-35854300 TGTGGGATGCATGGGAAACAAGG + Intronic
1179290138 21:40011338-40011360 GGAAGAAAGGATGGGAAAGAAGG + Exonic
1180724932 22:17939717-17939739 TGGAGAGTGACTGGGAAACCAGG + Intronic
1181581170 22:23828921-23828943 ACAAGCATGAAGGGGAAACAGGG + Intronic
1181932360 22:26412497-26412519 TGTAGGATGAATGGGGAAGAGGG + Intergenic
1182199770 22:28556369-28556391 TTAAGAATGAAAGAGAAATAGGG - Intronic
1183314882 22:37131420-37131442 TCAAGAATGAAGGGGGGACATGG - Intronic
1183515966 22:38266263-38266285 TGAAGACTGAAGGAGAAACGTGG - Intronic
1184321277 22:43743929-43743951 TGATGAATGAATGGGACAGATGG + Intronic
1184878160 22:47288553-47288575 GGAAGAATGAGTGGGTGACAAGG - Intergenic
1184990213 22:48162710-48162732 AAAAGAATGAAGGAGAAACAGGG - Intergenic
949646811 3:6105289-6105311 GGAAGAAAGAAAGGGAAAAAAGG - Intergenic
950063638 3:10093341-10093363 GGAAGAATAAATATGAAACAGGG - Intronic
950163139 3:10774791-10774813 TGACCCATGAATGGGAAAGAAGG + Intergenic
950803200 3:15572261-15572283 GATAGAATCAATGGGAAACATGG + Intronic
951388711 3:22075346-22075368 TGAAGAATGAATTGGGATGAGGG - Intronic
951403386 3:22263233-22263255 TGAAGAATGACTGGGTTAGATGG - Intronic
951590215 3:24256318-24256340 TGAAGAGTAAATGGGAGATAAGG + Intronic
952624549 3:35388635-35388657 TGAAGAATAAAAAGGAAAAATGG + Intergenic
952929522 3:38348185-38348207 AGAGGAAGGAATGGGAAGCAAGG - Intronic
953148058 3:40297129-40297151 AGAAGAAGGAATGGGTAACAAGG - Intergenic
954102221 3:48382437-48382459 AGATGAATGAAGGGAAAACAGGG + Intronic
954656275 3:52196143-52196165 TAGAGAAAGATTGGGAAACAAGG - Intergenic
955400863 3:58590592-58590614 TGAAAAGTGAAGGGGAAGCAAGG + Intronic
956084413 3:65595153-65595175 CCAAGAATGAATAGAAAACAAGG + Intronic
956745501 3:72307775-72307797 TAAAGACTTAATGGGTAACAAGG - Intergenic
957249539 3:77756113-77756135 TGAAAAATGAACTGGAAACCTGG + Intergenic
957252569 3:77792586-77792608 TGAAGAAAGAAAGGAAAACAGGG + Intergenic
957618032 3:82557008-82557030 TCTATAATGAATGGGAAACAAGG - Intergenic
957622619 3:82614012-82614034 TGAAGAGTGAGTGAGACACATGG - Intergenic
957823342 3:85407680-85407702 TGAAGAATTAATGAGTAATAAGG + Intronic
957887458 3:86306954-86306976 TAAAGAATAAGTGGGAAATAGGG - Intergenic
958639914 3:96792795-96792817 TGAATAATGTATGAGAAAAATGG - Intergenic
959129689 3:102339449-102339471 TCAAGAAAGAAGGGGAAGCAGGG - Intronic
960949545 3:122990272-122990294 TGCAGAGTCAATGGGAGACATGG + Intronic
961077548 3:123996035-123996057 TAAGGAAGGAAGGGGAAACAAGG - Intergenic
961383901 3:126513710-126513732 GGAAGAAAGAATGGGCAGCATGG - Intronic
961783009 3:129332322-129332344 TATAGAATGAAGGAGAAACAAGG - Intergenic
962296402 3:134192572-134192594 TTAAGAATGAATGGGAATTAAGG - Intronic
963055188 3:141180801-141180823 AGCAGAATAAATGGAAAACATGG - Intergenic
963096950 3:141553192-141553214 TAAAGCATGAATGACAAACAAGG - Intronic
963286865 3:143441985-143442007 GGAAGGATGAATGGGTAATAAGG - Intronic
963545098 3:146647235-146647257 TGAAGACTGGATAGGAAAAAAGG + Intergenic
964526192 3:157617113-157617135 CAAAGAATGAGTGGGACACATGG - Intronic
965098458 3:164266602-164266624 TAAAGAATGAGTGTGAAATATGG + Intergenic
965701785 3:171465473-171465495 TGAAAAAAGAAAAGGAAACAAGG + Intergenic
965941200 3:174183797-174183819 TGAATAATGACTGGAAAAGAAGG - Intronic
966193794 3:177294468-177294490 TGAACAATGACCGGGGAACAGGG + Intergenic
966829786 3:183997678-183997700 TGTAGAATGTAAGGGAAAGAAGG - Intronic
967092058 3:186143245-186143267 TGAAGAATGAAGTGGCAGCAAGG + Intronic
967218716 3:187231348-187231370 TGTGGAATGAATGGCAAACGGGG - Intronic
969053918 4:4390103-4390125 TGGCCAATGAATGGGAAATAAGG - Intronic
969086247 4:4658761-4658783 GGAAGAAAGAAAGGGGAACAGGG + Intergenic
970105149 4:12574329-12574351 TGCAGAATGTATGAGAAACATGG + Intergenic
970153432 4:13116219-13116241 TAAAGAATGCATGGGAAATTAGG + Intergenic
970816423 4:20161547-20161569 TGTAGAATGAGTGGGAAATTTGG - Intergenic
971199434 4:24498711-24498733 TTAAAAATGAATGGGAAGCTGGG + Intergenic
971224494 4:24738350-24738372 AGAAGGGTGAATGGGAAGCAAGG - Intergenic
972244221 4:37227433-37227455 AGAAGAATGAGTGTGAGACAGGG - Intergenic
973181892 4:47279059-47279081 CTAAGAAAGAGTGGGAAACAAGG - Intronic
973695905 4:53490879-53490901 TGAAAAAGAAATGGAAAACACGG - Intronic
973768087 4:54181930-54181952 TTAAGAATGGCTGGGAAACACGG - Intronic
973808572 4:54548671-54548693 TGGAGAATGAAAGGAAAAGAAGG - Intergenic
973843700 4:54889389-54889411 TGAAGAATGATAGGGAAACTGGG + Intergenic
974125825 4:57693983-57694005 TGAAAAGTGAAGGGGAAGCAAGG - Intergenic
974573015 4:63679810-63679832 TTAATGATAAATGGGAAACAGGG + Intergenic
974650993 4:64754256-64754278 TGAAGACTGTATGAGAAGCATGG - Intergenic
974903319 4:68027948-68027970 TGAAGAATAAAAGAGATACAGGG + Intergenic
975071323 4:70142857-70142879 TGAAGAATGAATGAGAGAACAGG + Intronic
975557638 4:75680599-75680621 GGAAGGATGGATGGGAAACCTGG - Intronic
975673027 4:76801100-76801122 TGAAGAATGACTAGGAGACCAGG - Intergenic
976422222 4:84858989-84859011 GGAAGAAAGAAATGGAAACAGGG + Intronic
977406022 4:96599845-96599867 TGCAGAAGGAATTGAAAACAAGG + Intergenic
977486724 4:97657929-97657951 TGAAGACTGTGTGAGAAACATGG + Intronic
977655615 4:99517551-99517573 TGAAGAAAGAAAGAGAAAGAGGG - Intronic
978066569 4:104411561-104411583 TGTTAAATGAATGGGAAGCAGGG - Intergenic
978200198 4:106016768-106016790 GGAGGAAAGAAGGGGAAACAGGG + Intergenic
979220086 4:118212531-118212553 AAAAGAATGAATGAAAAACAAGG - Intronic
979595303 4:122528161-122528183 TGCAGGCTGAATGGGAAGCATGG + Intergenic
979626034 4:122846767-122846789 AGAAGAATGAATGGGAAGTGAGG + Intronic
980215809 4:129851785-129851807 AGAAAAATGAATGGGAGAAAGGG + Intergenic
981227930 4:142318686-142318708 TCAAGATGGAATAGGAAACATGG - Intronic
981466895 4:145082690-145082712 TGTAGAATGGATGGAGAACATGG - Intronic
981519793 4:145649491-145649513 GGAAGAAGGAAAGGGAAATAAGG + Intronic
981773015 4:148331856-148331878 AGAAGAATGAATGAGCACCAAGG - Intronic
981834336 4:149038012-149038034 TGGAGAATCAATACGAAACAAGG - Intergenic
982190473 4:152849614-152849636 TGTTGAATGAATGGGAGAGAGGG + Intronic
982374751 4:154677569-154677591 TGAGAAATGAATGGGAAATAAGG + Intronic
982818294 4:159914572-159914594 TCTAGAAAGAATGGGAAAAAAGG - Intergenic
982841030 4:160186748-160186770 TGAGGAATGAATGAGAGGCAAGG - Intergenic
983231983 4:165138099-165138121 TGTAGAAGGAGAGGGAAACAGGG + Intronic
983476480 4:168218333-168218355 TTAAGGATGTATAGGAAACAAGG - Intronic
984066356 4:175052852-175052874 AGAAAAATGAATGGTAATCAAGG + Intergenic
985105083 4:186491918-186491940 TGGAGAAATAATGGGAAACTGGG + Intronic
985873151 5:2575012-2575034 TGAAGAAGGAATTAGAAAGATGG + Intergenic
986881918 5:12184835-12184857 TGCAGGCTGTATGGGAAACATGG + Intergenic
987211533 5:15688682-15688704 GGAAACATGAATGGGAAACTTGG + Intronic
987344043 5:16963223-16963245 TGTAGAAAGAAAGGGAAAGATGG + Intergenic
987444639 5:18002470-18002492 TGAAGGAGGAAGGGCAAACATGG + Intergenic
987548397 5:19344495-19344517 TTAAGAAGGAACTGGAAACACGG - Intergenic
988186871 5:27875624-27875646 TGAATATTGAGTAGGAAACAAGG - Intergenic
988241980 5:28623682-28623704 TGAAGAATGCATGTTAAATAAGG + Intergenic
988310182 5:29547633-29547655 TGGAAAGTGAAAGGGAAACAAGG + Intergenic
988656519 5:33217921-33217943 TGAAGAATGAAGGAGAAATAAGG - Intergenic
989484898 5:41978022-41978044 TGCAGTCTGAATGAGAAACATGG + Intergenic
989530015 5:42497126-42497148 TTAGGAATGAATGGGAAACAAGG - Intronic
989703674 5:44301575-44301597 AGAAAAATGAATTGGAAACGAGG - Intergenic
990830275 5:59948532-59948554 TGAAGACAGAATGAGAAAAATGG + Intronic
992830386 5:80588062-80588084 AGAGGACTGAATGGGAAAGAAGG - Intergenic
992868949 5:80986783-80986805 TGGAGAATGAATTGGAAAGGAGG - Intronic
993631149 5:90287351-90287373 TGAAGAATGAATTGGTAGCAGGG - Intergenic
993842476 5:92897583-92897605 AGTGGAATCAATGGGAAACATGG - Intergenic
993971630 5:94427004-94427026 TGAAGACTGTATGGTATACAAGG + Intronic
994737191 5:103569665-103569687 TGAGGAATGGCAGGGAAACAGGG - Intergenic
994872694 5:105373661-105373683 TGAAGAATTAATGTACAACATGG - Intergenic
995165004 5:109029561-109029583 TCAAGAATGAATGGAAAACAAGG - Intronic
995376280 5:111477637-111477659 TTAAAAATGAATGGGAAAAGTGG - Intronic
995538005 5:113156766-113156788 TGTAAAATGAATGTGAAGCAGGG - Intronic
997693274 5:135842469-135842491 TTAAGAGGTAATGGGAAACATGG - Intronic
997980751 5:138466164-138466186 CGAGGAATGAAAGGGAAACCCGG - Intronic
998516534 5:142760262-142760284 TGAAGACTGAATAGGAAATAAGG - Intergenic
998585306 5:143420794-143420816 TCAACAATCATTGGGAAACACGG + Intronic
999686858 5:154110923-154110945 TGAAGCATGCATGGAAAGCAAGG - Intronic
1000223910 5:159239598-159239620 GGAAGAAAGAATAGGAAAAAAGG - Intergenic
1000528717 5:162391130-162391152 TGAAGAAAAAATGGTGAACATGG + Intergenic
1001187513 5:169589306-169589328 TGAAGAATGAATGGCATGAATGG - Intronic
1001666651 5:173438666-173438688 TGGACAATGAACGGGAAACCAGG - Intergenic
1002584167 5:180231211-180231233 TGGAGAATGAATGTAAAATATGG + Intergenic
1003340208 6:5213385-5213407 TGAAGAATGAGTGGAAAGCAGGG + Intronic
1003556911 6:7148181-7148203 TAAAGGATCAATGGGAATCAAGG - Intronic
1004149845 6:13105873-13105895 TTAAGAATAAAAGGGTAACAGGG + Intronic
1004366719 6:15019216-15019238 TGAAGAGAGAATAGGAAAGAAGG + Intergenic
1004828008 6:19445327-19445349 GGCAGAATGAGAGGGAAACATGG - Intergenic
1004990686 6:21134615-21134637 CGAATAATGCATGGGAAACAAGG + Intronic
1005444910 6:25912553-25912575 AGAAGAATGAATGTGAAGGAAGG - Intergenic
1007070213 6:39031410-39031432 AGAAGGATGAGAGGGAAACAAGG - Intergenic
1007147935 6:39656135-39656157 TAAAGAATAAATGTGCAACAGGG + Intronic
1007695223 6:43727939-43727961 GAAAGAATGACTGGGAAACCAGG - Intergenic
1008142223 6:47845105-47845127 TGAAGAATGACTGGGAAATGAGG - Intergenic
1008247404 6:49194884-49194906 TGAAGCAAGAACTGGAAACAAGG - Intergenic
1008333653 6:50273739-50273761 GGAAGAAAGAATGGCAAATATGG - Intergenic
1008584798 6:52938741-52938763 AGAAGAATGAATGGGGCAGAAGG + Intergenic
1009312801 6:62176467-62176489 TGAAGAGTGAATGTGAAGCAAGG - Intronic
1009319773 6:62273306-62273328 TGAAGAATGAATAGGAAGTGAGG - Intronic
1009468176 6:63999759-63999781 TGTAGAATGAATAGCAAAAATGG + Intronic
1009510240 6:64541570-64541592 TGAAGAAAGAATAGAAAACATGG - Intronic
1009886441 6:69629085-69629107 TGGAGACTGAATGGGATACCTGG + Intergenic
1010018013 6:71126906-71126928 AGAAGAATGAGAGGGAAAGAAGG - Intergenic
1010073440 6:71771796-71771818 TAAAGAATAAGTTGGAAACAAGG + Intergenic
1011180675 6:84616623-84616645 TGAATAATGAATGCAGAACAGGG - Intergenic
1011276517 6:85636935-85636957 TGAAAACTGAAGGGGAAAAAAGG + Intronic
1011580000 6:88852168-88852190 TGGAGAATGAATGGTAATGATGG - Intronic
1011609403 6:89135898-89135920 TGGATAGTGAAGGGGAAACAAGG - Intergenic
1012729976 6:102868987-102869009 TGAAGAATGAATGGCAAACCTGG - Intergenic
1012840484 6:104323404-104323426 AGAAGAGTTAAAGGGAAACATGG - Intergenic
1013535156 6:111057118-111057140 TGAAGAATGAACCCGAAATAAGG - Intergenic
1013872406 6:114781277-114781299 TGAAGAATGGATATGAAATAAGG - Intergenic
1014262970 6:119240938-119240960 TGAAGAATGAAGCAGAATCAGGG - Intronic
1014311426 6:119806934-119806956 TAAAGAGGGAATGAGAAACAGGG + Intergenic
1014600121 6:123401035-123401057 TGAATAATGATTGGGAGACAAGG + Intronic
1015129767 6:129795990-129796012 TGAAGTATGTAGGGGAAAGAGGG - Intergenic
1015283909 6:131463307-131463329 TGAAGACTGAGTAGGCAACATGG + Intergenic
1016140304 6:140600459-140600481 TGAAGGATTAATGGGAACTAAGG + Intergenic
1016305250 6:142677338-142677360 GGAAGGATGAATAGGACACAGGG + Intergenic
1016386249 6:143533501-143533523 AGAAGAATGAATGGGGAAGGGGG + Intergenic
1017880459 6:158559493-158559515 TCAAGAATGGATGAGAACCAAGG - Intronic
1018199977 6:161385484-161385506 TGAAGAATGAATGGGATTAGAGG + Intronic
1021335273 7:19393168-19393190 TGAAGAATTGGTAGGAAACAAGG + Intergenic
1021530971 7:21644593-21644615 TGAAGAAGGAATGAGAAAGAAGG + Intronic
1023128531 7:36979003-36979025 TAAAGATTGAAGGGGCAACATGG + Intronic
1023205380 7:37743434-37743456 TAAAAAATAAATGGGAAAAAAGG - Intronic
1023330627 7:39112462-39112484 TGAAAAAAGAATGGACAACAGGG - Intronic
1023658762 7:42452473-42452495 TGGAGAATGAATCTGAAAGATGG + Intergenic
1024136454 7:46413457-46413479 TGATGGATGAATGACAAACAAGG + Intergenic
1024366791 7:48529361-48529383 TGAAAAAAGAATGGGATACGAGG - Intronic
1024491805 7:49994378-49994400 TGCAGCAGGAATGGGGAACATGG + Intronic
1024697155 7:51869456-51869478 TGAAGAACATATGGGAATCAGGG + Intergenic
1026071395 7:67123922-67123944 AGAGGGATGAATGGGAAAGATGG + Intronic
1026456866 7:70580384-70580406 TGAAGAACTAATAGGAAACATGG - Intronic
1026705491 7:72688359-72688381 GGAGGGATGAATGGGAAAGATGG - Intronic
1027419255 7:78003912-78003934 TGGAGAATGAAAGGAACACAGGG + Intergenic
1027443049 7:78240976-78240998 TGAAGAAAAACTGAGAAACAGGG - Intronic
1027888082 7:83935251-83935273 TGAAAAATTTATGGGAAACGAGG + Intergenic
1028782317 7:94751044-94751066 TAAAGAGTTAAAGGGAAACATGG + Intergenic
1028826457 7:95279133-95279155 TGAAGAATGAATGGGCTATATGG + Intronic
1028920832 7:96308290-96308312 TGAAGAGTAACTGGGAAGCAAGG - Intronic
1029628495 7:101735328-101735350 GGAAGAAGAAATGTGAAACAAGG + Intergenic
1029694290 7:102202803-102202825 GGAAGGATGATAGGGAAACACGG - Intronic
1030075894 7:105736221-105736243 TGCAGAATGCATGAGGAACAGGG + Intronic
1030259740 7:107550541-107550563 TGAACAATAAATGGGAAAGCAGG - Intronic
1030402512 7:109070043-109070065 TGCAGACTGCATGGGAAATATGG + Intergenic
1030728660 7:112957424-112957446 TTAAAAGTGAATGGGAAGCAAGG - Intergenic
1030787150 7:113675931-113675953 TGGAGATTGAATGGGATAGAAGG + Intergenic
1030944368 7:115698232-115698254 GAAAAAATGAATGGAAAACAAGG + Intergenic
1030969239 7:116033905-116033927 TTAAGAAAGAATGGGAAAAGAGG - Intronic
1031926904 7:127647644-127647666 TGACTAAGGAATGGGAAAGAAGG + Intergenic
1032851187 7:135796960-135796982 TGAAGAATGAATGTTGCACAGGG - Intergenic
1032913196 7:136457906-136457928 TCAAGACAGACTGGGAAACATGG + Intergenic
1033063539 7:138130195-138130217 TGAAGAATGTATTGGGAACTGGG - Intergenic
1033177659 7:139140458-139140480 TTAAGAATAAAAGGGAAACATGG + Intronic
1033194113 7:139312223-139312245 CGAAGAATGCCTGCGAAACAAGG - Intergenic
1033844057 7:145411114-145411136 TGAGGAATGCTTGAGAAACAGGG - Intergenic
1033978841 7:147138630-147138652 TGCAGAATGAAAGGAAAAAAAGG + Intronic
1034707401 7:153157871-153157893 AGAAGAATGAAGGGGAAGCGAGG + Intergenic
1035732193 8:1860917-1860939 AAAAGCATGAGTGGGAAACAGGG - Intronic
1035836240 8:2755482-2755504 AGAAGAATGAATATGAAGCATGG - Intergenic
1035966118 8:4193837-4193859 TGAAGAATGAATGGGAAACACGG - Intronic
1036186087 8:6623414-6623436 AGGAGACTGAATAGGAAACATGG - Intronic
1037477686 8:19273574-19273596 TGAATAATGGATGTGAAAGAGGG - Intergenic
1037647872 8:20810256-20810278 AGAAGAATAAATGGGAAGAAAGG + Intergenic
1038207114 8:25477085-25477107 TCAAGAAAGAATGGGAGGCAAGG - Intronic
1038706165 8:29896091-29896113 GGATGAATGTATGTGAAACAAGG - Intergenic
1038743324 8:30234607-30234629 TGAAGAATGAAAAGGAAATGAGG - Intergenic
1038910793 8:31961723-31961745 TGAAGCATGAAGGGAAAACTAGG + Intronic
1039119288 8:34128030-34128052 TGAAAAATGAATAGGAATCTGGG + Intergenic
1039311938 8:36326048-36326070 TGAAGAAGGCATGGAAGACAAGG + Intergenic
1039361937 8:36885933-36885955 TGAAGAAGAAAGGAGAAACATGG + Intronic
1039553647 8:38461119-38461141 TGAAGACTGAATGGGCTGCATGG + Exonic
1040872919 8:52119371-52119393 AGAAGAATGAATCTGAACCAGGG + Intronic
1040987380 8:53311147-53311169 TGCAGCATGAATGGGAATGAGGG - Intergenic
1041286670 8:56269996-56270018 TTAAATAGGAATGGGAAACAAGG - Intergenic
1041503477 8:58566579-58566601 TGAATAAGGAGTGGGAAACATGG + Intronic
1041747872 8:61229374-61229396 TGAGGAATGAATGGGAACAGAGG - Intronic
1042190651 8:66183202-66183224 TGAAGAATGAATAGAAAATTTGG - Intergenic
1042318059 8:67445090-67445112 AGAGGAATGAATGGGAAGAAAGG + Intronic
1042413462 8:68491885-68491907 TGAAGGATGAATTGGAATCATGG - Intronic
1042459223 8:69043341-69043363 TGAAGCCTGAATTGGAACCAAGG + Intergenic
1042711535 8:71722739-71722761 TGAAGGAGAAATGGGAAATATGG - Intergenic
1043266658 8:78274589-78274611 TGGAAGATGAATGGGAAGCAAGG - Intergenic
1043327747 8:79073182-79073204 TGAAGTATGCAGGGGAAAGAAGG - Intergenic
1043534788 8:81190451-81190473 TGAAAAATGAAGGGAAAAAAAGG + Intergenic
1043622380 8:82211186-82211208 GGAAGAAGGAATGGAAAAGAAGG + Intergenic
1043766620 8:84142212-84142234 TGAAGAATGAGTGAGAGACCAGG - Intergenic
1044159347 8:88893818-88893840 GGAAGAATGAAGGATAAACAAGG + Intergenic
1044946266 8:97392795-97392817 GGATGAATGAATGGGTAGCATGG - Intergenic
1045675540 8:104603772-104603794 GGAAGCAGTAATGGGAAACAAGG + Intronic
1045922598 8:107548554-107548576 TGAAGCATGTATGGTAACCAAGG + Intergenic
1045989270 8:108286569-108286591 TGAAGAAAGAATGGAAGACAGGG + Intronic
1045996208 8:108364995-108365017 TAAAGAATGAATGGCAGTCAGGG - Intronic
1046680226 8:117160856-117160878 TGAAAATAGAATGGGATACATGG + Intronic
1046842057 8:118870128-118870150 TGAAGAATGAATTGGAAGGGGGG - Intergenic
1046986597 8:120395270-120395292 TGCTGAATGAATGGGAAAGTTGG + Intronic
1047599777 8:126414420-126414442 GGAAGAAAGAAAGGGAAAGAAGG - Intergenic
1047916131 8:129585456-129585478 TGAAGAACAAATGAGAAAAATGG + Intergenic
1048235596 8:132686785-132686807 TGAAGATTGAAGGGGAAGAATGG + Intronic
1048361085 8:133697631-133697653 TGTAGAGTGAATGGGAGACAAGG + Intergenic
1048976489 8:139675754-139675776 TGAAAAATGAATGGGAAGTGAGG - Intronic
1049130836 8:140839080-140839102 TGAAGAATGTTTAGGCAACAGGG + Intronic
1049948046 9:617277-617299 TGAAAAATAAATGTTAAACAAGG - Intronic
1050144632 9:2553654-2553676 TAAAGAAGGAAGGAGAAACAAGG + Intergenic
1050457893 9:5850900-5850922 TAGAGAATGAATGAGGAACAAGG + Intergenic
1050809923 9:9732101-9732123 TGAGGAATGAATAGGAAATGGGG + Intronic
1051522141 9:18001063-18001085 GAAAAAATGAATGGGAATCAGGG + Intergenic
1051676197 9:19560800-19560822 TAAAGAATGAGTGGAAAAAAGGG - Intronic
1052050892 9:23849111-23849133 TGGAAAATGAATGAGAAAAAGGG + Intergenic
1052544725 9:29861408-29861430 TGAAGAATAAATGAGGAACATGG + Intergenic
1052617534 9:30860849-30860871 GGAGGAATGAATGGGATGCATGG + Intergenic
1052795358 9:32918911-32918933 GGAAGAAAAAAAGGGAAACAGGG - Intergenic
1052812506 9:33074083-33074105 ACAAGAATGAATAGGAAACTAGG - Intronic
1052832137 9:33224655-33224677 AGAAGAATGAATGGAAGAGATGG - Intronic
1052918561 9:33943696-33943718 AGAAGAAGGAGTGAGAAACAAGG + Intronic
1053556620 9:39144710-39144732 AAAAGAAAGAAGGGGAAACAGGG + Intronic
1053820732 9:41964993-41965015 AAAAGAAAGAAGGGGAAACAGGG + Intronic
1054089599 9:60833132-60833154 AAAAGAAAGAAGGGGAAACAGGG + Intergenic
1054111010 9:61108690-61108712 AAAAGAAAGAAGGGGAAACAGGG + Intergenic
1054609847 9:67222435-67222457 AAAAGAAAGAAGGGGAAACAGGG - Intergenic
1054715856 9:68557266-68557288 GGAAGAAAGAATTGGAAAGAAGG - Intergenic
1054751400 9:68911071-68911093 TGAGGAAAGAATGGGAAACTGGG + Intronic
1054898872 9:70346062-70346084 AGAAGATTGAAGGAGAAACAGGG + Intronic
1055239801 9:74169799-74169821 GAAAGAATGAAAGGGAAAGAAGG - Intergenic
1055570423 9:77610984-77611006 TGCAGAATGAATAGGAAAGGAGG + Intronic
1055658253 9:78473988-78474010 ACAAGAAAGAATGGGAACCAAGG + Intergenic
1055809227 9:80132676-80132698 AGCAGAATAAATGAGAAACAAGG + Intergenic
1056034043 9:82584994-82585016 TGCAGAGAGAATGGGAACCATGG - Intergenic
1057458763 9:95239595-95239617 GGAAGAAAGAATGTGTAACAAGG - Intronic
1058548224 9:106084185-106084207 TGAAGAATGAAGAGGACAGATGG - Intergenic
1058806546 9:108597893-108597915 AAAAGAATGAATGAAAAACAAGG + Intergenic
1058925487 9:109659326-109659348 TGAAGGATGCCTGGGCAACATGG - Intronic
1058959438 9:109978941-109978963 AGAAGACAGAAAGGGAAACAGGG - Intronic
1059309845 9:113380753-113380775 TGAGGATTCAGTGGGAAACAAGG + Intergenic
1059739457 9:117135543-117135565 TGTAGAATGAATGCCTAACAGGG - Intronic
1059919062 9:119137400-119137422 TAAAGAATGGATGGAAAACATGG + Intergenic
1059977145 9:119729743-119729765 TGAATAATGAATTGGGAAAATGG - Intergenic
1060056122 9:120414555-120414577 AGAAGAAGGAAGGGAAAACAGGG + Intronic
1060059740 9:120448453-120448475 TGAGGAATGTTTGGGAAACAAGG - Intronic
1060898382 9:127235177-127235199 TGAAGACAGTATGGGAAAAAAGG - Intronic
1060991816 9:127853918-127853940 TGAGGAATGGATGGGAAGGAGGG - Intronic
1185833976 X:3328549-3328571 TAGAGAGTGAATGGAAAACAGGG + Intronic
1186340227 X:8637415-8637437 TGATGAATGAATGGGTAAAGGGG - Intronic
1187111929 X:16311157-16311179 TGCAGACAGACTGGGAAACAAGG - Intergenic
1187574915 X:20543439-20543461 TGAAAGGTGAAGGGGAAACAAGG - Intergenic
1188322758 X:28760358-28760380 ACAAAAATGAATAGGAAACAGGG + Intronic
1188647715 X:32591423-32591445 TAAAGAAAGAAGGAGAAACATGG - Intronic
1188855122 X:35185282-35185304 TAAAGTAAGAATGTGAAACAAGG + Intergenic
1189138224 X:38572568-38572590 TGAAGAATGAATGGGAATTGAGG - Intronic
1189860925 X:45271087-45271109 TGATGAATGAATACCAAACATGG - Intergenic
1190461325 X:50678901-50678923 TGAAGAGTGAATGGGAGATGAGG - Intronic
1192295866 X:69847094-69847116 TGAAGAATGAAGGGGAACCCAGG + Intronic
1192606321 X:72522424-72522446 TGCAGAATAAATGGGAAATAAGG - Intronic
1194564237 X:95463520-95463542 TCAAGAATGGATGGAAAACTAGG + Intergenic
1194673686 X:96767672-96767694 TGAAGATTTAAAGGGAAAAATGG + Intronic
1194695729 X:97047140-97047162 TGAAGATTAAATGGAAAAGATGG + Intronic
1195793074 X:108610823-108610845 TGAAGAATGAAGGAGTTACATGG - Intronic
1196386869 X:115164747-115164769 TGAAGATAAAATGAGAAACATGG + Intronic
1197257437 X:124278758-124278780 TAACAGATGAATGGGAAACAGGG - Intronic
1197896007 X:131316386-131316408 TTAAGAATGAAAGATAAACATGG + Intronic
1198706777 X:139457627-139457649 TGATAAATGTATGGGAAAAAGGG - Intergenic
1199361412 X:146923520-146923542 GCAAGAATGACTGAGAAACATGG - Intergenic
1199971988 X:152868007-152868029 TGAGGAATGAGTGGGAGAAAGGG - Intronic
1201903633 Y:19067853-19067875 TAAAGCAGGAATGGGGAACAGGG - Intergenic
1202148744 Y:21825933-21825955 AGAAGAATGAATAAAAAACACGG - Intergenic