ID: 1035966119

View in Genome Browser
Species Human (GRCh38)
Location 8:4193845-4193867
Sequence CTCGGTGCTGAAGAATGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 1, 2: 1, 3: 19, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035966119_1035966122 -5 Left 1035966119 8:4193845-4193867 CCCATTCATTCTTCAGCACCGAG 0: 1
1: 1
2: 1
3: 19
4: 207
Right 1035966122 8:4193863-4193885 CCGAGAAGCCTCAGCAGAACTGG No data
1035966119_1035966128 21 Left 1035966119 8:4193845-4193867 CCCATTCATTCTTCAGCACCGAG 0: 1
1: 1
2: 1
3: 19
4: 207
Right 1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG No data
1035966119_1035966125 17 Left 1035966119 8:4193845-4193867 CCCATTCATTCTTCAGCACCGAG 0: 1
1: 1
2: 1
3: 19
4: 207
Right 1035966125 8:4193885-4193907 GCCACCTCCACGAAGGAAAGCGG No data
1035966119_1035966124 10 Left 1035966119 8:4193845-4193867 CCCATTCATTCTTCAGCACCGAG 0: 1
1: 1
2: 1
3: 19
4: 207
Right 1035966124 8:4193878-4193900 AGAACTGGCCACCTCCACGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035966119 Original CRISPR CTCGGTGCTGAAGAATGAAT GGG (reversed) Intronic
902108905 1:14061326-14061348 CTAAGAACTGAAGAATGAATAGG + Intergenic
902723199 1:18318030-18318052 GTGGGGGCTGAAGAATGCATGGG + Intronic
903460514 1:23517373-23517395 CTAGGTCTTAAAGAATGAATAGG - Intronic
904833181 1:33318698-33318720 CTGGGTGCTGAGGAATGATGCGG - Intronic
905172364 1:36116667-36116689 CTGGGTCCTGAAGGATGAGTCGG + Intronic
905246447 1:36617853-36617875 CTGAGGCCTGAAGAATGAATAGG + Intergenic
905456440 1:38091445-38091467 CTGGGTCCTAAAGAATGATTAGG + Intergenic
905791834 1:40793794-40793816 CTGGGAGTTGAAGGATGAATAGG - Intronic
906086915 1:43144088-43144110 AGCGGTGCTGAAGCAGGAATTGG - Intergenic
906442357 1:45859406-45859428 CTGGGTTTTGAAGAATGAATAGG + Intronic
906480375 1:46195593-46195615 CTGGGTGCTGAAGATACAATGGG - Intronic
907787103 1:57623290-57623312 CTCGGTGCTGAAGAAGAGACAGG - Intronic
907909222 1:58812547-58812569 CTGAGGGCTGAAGGATGAATAGG + Intergenic
907918537 1:58892685-58892707 CTGGGTTCTGAAGAAGGAGTAGG + Intergenic
908245782 1:62226817-62226839 CTGGGTCTTGAAGCATGAATAGG - Intergenic
910205587 1:84746036-84746058 CTGGGTTTTGAAGGATGAATAGG - Intergenic
910611462 1:89147731-89147753 CTTTGTGCTGCAGAATGAAGAGG - Exonic
910615086 1:89188746-89188768 CTTTGTGCTGCAGAATGAAGAGG - Exonic
912224962 1:107722916-107722938 CTGGGTCCTCAAGAATGAACAGG - Intronic
912334287 1:108847710-108847732 CTGGGTGTTGCAGAAGGAATAGG - Intronic
915248329 1:154571375-154571397 CTTGGTGCTGAAGAGTGAGGTGG + Exonic
917884729 1:179372489-179372511 CTGGGGGCTGAAGAACGAGTTGG + Intronic
920374257 1:205498822-205498844 CTGGATTTTGAAGAATGAATAGG + Intergenic
920824761 1:209414962-209414984 CCAGGTGCTGAAGAGAGAATAGG + Intergenic
924199241 1:241641851-241641873 CTCAGCAATGAAGAATGAATAGG - Intronic
1064577141 10:16757975-16757997 CTCTGGGCTGAAGATTGAGTGGG - Intronic
1065060899 10:21899609-21899631 CCCAGTGAGGAAGAATGAATTGG - Intronic
1066010918 10:31192681-31192703 CTGGGTTTTGAAGTATGAATAGG + Intergenic
1067012920 10:42731174-42731196 CTCTGGGCTGGAGATTGAATGGG + Intergenic
1068658819 10:59602513-59602535 CTATATGCTGAAGAAAGAATTGG - Intergenic
1069128694 10:64671453-64671475 CCTGGTGCTGAAGATTCAATCGG + Intergenic
1071566229 10:86672782-86672804 CTGGGTCCTGGGGAATGAATTGG + Intronic
1077678176 11:4215751-4215773 CTGGGGGCTGAAGTGTGAATAGG - Intergenic
1077867862 11:6238086-6238108 CTGGGTTCTGCAGGATGAATAGG - Intronic
1078356605 11:10636789-10636811 CTAGGTCTTGAAGGATGAATAGG + Intronic
1078969824 11:16395391-16395413 CAGGGACCTGAAGAATGAATAGG + Intronic
1081507433 11:43732991-43733013 CTCAGTGGTGAAGAGTGACTTGG + Intronic
1081654037 11:44845592-44845614 CTGGGTCTTGAAGGATGAATAGG + Intronic
1082105722 11:48219202-48219224 CTAGGTCTTGAAGAATGTATAGG - Intergenic
1084464595 11:69314750-69314772 CTGGGTGTTGAAGGATGAGTAGG + Intronic
1085849850 11:80107639-80107661 CTGGGTGCTGAAGAATGAATAGG - Intergenic
1087185500 11:95188652-95188674 CTAGGTCTTGAAGAATAAATGGG - Intronic
1088917139 11:114236084-114236106 TGCTGTTCTGAAGAATGAATGGG - Intronic
1089772115 11:120810497-120810519 CTGGATGCTGAAGTATGAGTGGG + Intronic
1090939169 11:131372487-131372509 CTGGGTGCACAAGAATGAAGTGG + Intronic
1091779832 12:3206868-3206890 CTGGGTTTTGAAGGATGAATAGG + Intronic
1091791750 12:3275935-3275957 CTGGGCTTTGAAGAATGAATAGG - Intronic
1091875173 12:3927815-3927837 CTGGGTTTTGAAGGATGAATAGG - Intergenic
1093785068 12:23183467-23183489 CTCTGTGTTCATGAATGAATGGG + Intergenic
1094653959 12:32403015-32403037 CTAGGTGCTATAGAATGAACTGG - Intronic
1096467082 12:51852589-51852611 TTGGGTTCTGAAGGATGAATAGG - Intergenic
1096524053 12:52200301-52200323 CTGGGTGCTGAAGGATGAGGCGG - Intergenic
1101030956 12:100659691-100659713 CTGGGTCCTGAAGATTGAGTAGG + Intergenic
1104047406 12:125173162-125173184 CTTGGTTCTGAAGAAGGAACAGG + Intergenic
1107048081 13:36015312-36015334 CTCAGTGATGAAGAAGGAAGGGG + Intronic
1108468093 13:50739148-50739170 CTAACTGCTGAAGAATGAGTAGG - Intronic
1110569153 13:76985933-76985955 CTTGGACCTCAAGAATGAATTGG + Intergenic
1111150505 13:84247731-84247753 CTTGGTGTTGAATATTGAATGGG - Intergenic
1111709004 13:91787547-91787569 CTCAGTGCTGAAGAAAGTAGGGG + Intronic
1113472965 13:110559771-110559793 CTTGGTGCTGAAGAAGCAAGAGG + Intronic
1116028848 14:39546709-39546731 CTGGGTCTTGAAAAATGAATAGG + Intergenic
1116523328 14:45874988-45875010 CTCTGCACTAAAGAATGAATGGG + Intergenic
1116932831 14:50706727-50706749 CTAGCTGCTGAAAAATGAGTGGG + Intergenic
1119196985 14:72724467-72724489 CACTGTGCTGAGAAATGAATGGG - Intronic
1119556551 14:75557863-75557885 CTGGGTGCTCCAGAAAGAATAGG - Intergenic
1120877871 14:89391601-89391623 CTTGGTGCTGAGGCTTGAATTGG - Intronic
1122263138 14:100534565-100534587 ATGGGTGTTGAAGGATGAATAGG - Intergenic
1124085875 15:26549970-26549992 CTTGGTACTGAGCAATGAATGGG - Intronic
1124345719 15:28920219-28920241 CTGGGTTTTGAAGAATGAATAGG + Intronic
1126926312 15:53591100-53591122 CTGGGAGCTGAAGGATGAACAGG - Intronic
1127669969 15:61185946-61185968 CTGGGTGGTGAAGGATGTATAGG - Intronic
1129392522 15:75227654-75227676 CTCTGTGTTGAGGAATGAAGAGG + Intergenic
1129471870 15:75760530-75760552 CTCTGTGTTGAGGAATGAAGAGG - Intergenic
1129616134 15:77099913-77099935 CTGGGTTTTGAAGGATGAATAGG - Intergenic
1133117310 16:3584773-3584795 GCCGGTGCTGAAGAAGGAACTGG - Exonic
1134410947 16:14002883-14002905 CTCGGTGGGGAGGAAGGAATGGG + Intergenic
1135587175 16:23679900-23679922 CGCTGTGCTGGAGAAGGAATGGG + Intronic
1136010749 16:27362180-27362202 CTGGGCTTTGAAGAATGAATAGG + Intronic
1138574993 16:57901837-57901859 CTGGGTTCTGAAGAATGAGTAGG - Intronic
1140955520 16:79861456-79861478 CTCTGTGCTGAAGACTGGACTGG - Intergenic
1141813220 16:86390535-86390557 CTGGGTTTTGAAGAATGCATAGG - Intergenic
1141916225 16:87099035-87099057 CTGGGTTCTGAAGCATGAGTAGG + Intronic
1143597009 17:7920867-7920889 CTGAGAGCTGAAGCATGAATAGG - Intergenic
1145832729 17:27930180-27930202 GTCGGAGCTGACGAAGGAATGGG - Intergenic
1146673736 17:34758941-34758963 CATGGTGCTGATGAATGAAGGGG + Intergenic
1147340094 17:39748170-39748192 CTGGGTGCTGAAGGATGTGTTGG - Intergenic
1147904211 17:43812593-43812615 CTGGGTTCTGAAGAGTAAATAGG - Intronic
1148501520 17:48095108-48095130 CTGGGTCTTGAAGAATGGATAGG - Intronic
1148517572 17:48235111-48235133 CTGGGTTTTGAAGGATGAATAGG + Intronic
1149645719 17:58240164-58240186 CTGGGTTTTGAAGAATGAATAGG + Intronic
1150718576 17:67594424-67594446 CTGGGTGGTGAAAAAGGAATAGG - Intronic
1153605050 18:6824773-6824795 CTCGCTGCCGAAGAATTAACAGG + Intronic
1153637701 18:7127423-7127445 CTGGGTGCTGAAGAAAGACCAGG - Intergenic
1153968831 18:10206066-10206088 CTGAATGCTGAAGAATGACTGGG + Intergenic
1157021293 18:43785519-43785541 ATGGGTGGTGAAGAATAAATGGG - Intergenic
1157497763 18:48168613-48168635 TTAGGTGCTGAAGAAGAAATAGG + Intronic
1157734140 18:50031478-50031500 ATTGGTGCTCAAGAAAGAATAGG - Intronic
1157752085 18:50188264-50188286 CTGGGGCCTAAAGAATGAATAGG - Intronic
1158702606 18:59762263-59762285 CTTGGTGCTGGATAATGTATGGG - Intergenic
1158928803 18:62300347-62300369 CTCTGTCCTGAAGGATGAGTAGG - Intronic
1159070516 18:63618220-63618242 ATCAGTACCGAAGAATGAATTGG - Intergenic
1159257394 18:65964745-65964767 CTCGATGCTGAAGAATGCTCCGG - Intergenic
1160328582 18:77971846-77971868 CTCTGAGCTGAAGACTGAAGCGG + Intergenic
1160960162 19:1717358-1717380 CTGGGTGCAGGAGGATGAATGGG + Intergenic
1161690136 19:5727646-5727668 CTGGGTTTTGAAGGATGAATAGG + Intronic
1164576770 19:29409660-29409682 CTGGGTCTTGAAGGATGAATAGG + Intergenic
1165302372 19:34978626-34978648 CTGGGTGCTGAAGGATGAATAGG + Intergenic
1165824904 19:38700169-38700191 CTCGGTGGTGTGGAATGAACAGG - Intronic
1166938443 19:46348969-46348991 GGAGGTGCTGAAGAGTGAATGGG + Intronic
925906173 2:8540753-8540775 CTGGGTTCTGAAGGATGAAGAGG + Intergenic
928000954 2:27522733-27522755 CTGGGTTTTGAAGGATGAATAGG + Intronic
928052143 2:28010015-28010037 CTCAGTGCTAAAGAAGGACTGGG + Intronic
930879290 2:56253320-56253342 CTGAGAGCTGAAGAATGAGTAGG + Intronic
933297834 2:80510486-80510508 CTGGGTCTTGAAGAATGAATGGG - Intronic
933595673 2:84280750-84280772 CTCGGAGATGGAGAATGGATTGG + Intergenic
935700669 2:105809084-105809106 CTGGGTTTTGAAGAATGAATAGG + Intronic
937491857 2:122377906-122377928 CTGTGTGTTGAAGGATGAATAGG - Intergenic
937845986 2:126579368-126579390 TTGGGTTTTGAAGAATGAATAGG - Intergenic
939832990 2:147095090-147095112 CTGGGTCTTGAAGGATGAATAGG + Intergenic
942204422 2:173605231-173605253 CTAGGTGCTGAAGTCTGCATGGG + Intergenic
942671609 2:178381982-178382004 CTGGGTGTTAGAGAATGAATAGG - Intronic
946175861 2:217921637-217921659 CTCTTTGCTGGAGAATGAGTTGG - Intronic
946527109 2:220532497-220532519 CTCAGTTGTGAAGAATAAATAGG - Intergenic
946768920 2:223067889-223067911 CTAGGTTCTAAAGAATGAATAGG + Intronic
1170386201 20:15820109-15820131 CTGTGTGCTGAAGCATGAATGGG + Intronic
1170424179 20:16222218-16222240 CTCTGTGATGAAGCCTGAATAGG + Intergenic
1170984470 20:21244990-21245012 TTGGGTGTTGAAGGATGAATAGG - Intronic
1172963452 20:38815634-38815656 CTCAGTGCTGGAGAATAGATGGG - Intronic
1173308443 20:41873934-41873956 CTGAGTCCTGAAGGATGAATAGG - Intergenic
1173343387 20:42175427-42175449 CTGAGTGCTGAAGGATGAATAGG - Intronic
1173830743 20:46085552-46085574 CTGGGTCCTGAGGAATGAGTGGG + Intronic
1174138990 20:48399895-48399917 GTCAGGGCTAAAGAATGAATTGG + Intergenic
1174785424 20:53428084-53428106 ATCAGTGCTGGAGAATGATTTGG - Intronic
1176412505 21:6456775-6456797 CTGGGTTCTGAAGGGTGAATAGG + Intergenic
1177167815 21:17622766-17622788 CATGGAGCTGAAGAACGAATAGG + Intergenic
1179687999 21:43065097-43065119 CTGGGTTCTGAAGGGTGAATAGG + Intronic
1180020879 21:45125931-45125953 CTCGGTGCTCAAGCTAGAATAGG - Intronic
1181037024 22:20174661-20174683 CTCAGTGCTGAAGCAGGATTTGG - Intergenic
1181856699 22:25786365-25786387 CTGGGTTTTGAAGGATGAATAGG + Intronic
1182409549 22:30171813-30171835 CTGGGATCTGAAGAATGAGTAGG + Intronic
1183820504 22:40342271-40342293 CTCAGTGCTAAAGAATAAAGTGG + Intergenic
1184151949 22:42644501-42644523 CTAGGCTCTGAGGAATGAATAGG - Exonic
1184864526 22:47194920-47194942 CTGGGCCTTGAAGAATGAATAGG + Intergenic
1184951603 22:47846978-47847000 CTCTGTCCTGCTGAATGAATGGG - Intergenic
1185103556 22:48854591-48854613 CTGGGAGCTGAAGGATGGATAGG + Intergenic
949420966 3:3865193-3865215 CTAGGTACTGAAGTATGAAGAGG - Intronic
950107881 3:10399816-10399838 CTGGGTTTTGAAGGATGAATAGG - Intronic
953697483 3:45171303-45171325 CTGGGTGGTGAAGACTGGATAGG - Intergenic
955028757 3:55196193-55196215 CTAGGTTCTGAAAAATGAGTAGG - Intergenic
956175708 3:66471427-66471449 CTCTGTTCTGCAGAATGACTGGG - Intronic
956684049 3:71807831-71807853 CACTGTGCTGAAGAAGGCATTGG - Intergenic
959840995 3:110974379-110974401 CTCGATGTTGAAGAATCAGTAGG + Intergenic
960279695 3:115767396-115767418 CTCCCTGCTAAAGAAGGAATGGG - Intergenic
964629325 3:158792812-158792834 CTCAGTTCAGAAGAATGAAATGG + Intronic
965529505 3:169757127-169757149 TTCCGTTGTGAAGAATGAATTGG + Intergenic
967794794 3:193588330-193588352 ATTGGTGCTGAAGTGTGAATGGG - Intronic
967922901 3:194625839-194625861 CGGCGTGCTGATGAATGAATGGG + Intronic
969562337 4:7957424-7957446 CTGGGTACTGAAGGATGAATAGG + Intergenic
969643208 4:8411532-8411554 CCGCGTGCTGAAGAATGAATGGG - Intronic
969660395 4:8524043-8524065 CTGGGTACTGAGGAATGAACAGG + Intergenic
970734442 4:19149647-19149669 CTGGGACCTGAAGAATCAATAGG - Intergenic
972379428 4:38505329-38505351 CTTGGTCCTGAAGAATCAGTTGG - Intergenic
972764011 4:42134747-42134769 CTGGGTACTAAAGGATGAATAGG + Intronic
977121192 4:93104014-93104036 TTGGGGGCTGAAAAATGAATTGG - Intronic
978018168 4:103774294-103774316 CTCTGTGCTGAACAATTAATGGG + Intergenic
979631892 4:122912059-122912081 CTAGGTCTTGAAGAATGAGTAGG - Intronic
979800416 4:124901594-124901616 CTAGGTTCTGAAGATTAAATGGG - Intergenic
982456748 4:155619164-155619186 CTAGGTACTTAAGAATGAATCGG + Intergenic
984643208 4:182193196-182193218 CAAGGTTCTGAAAAATGAATGGG + Intronic
986814643 5:11395266-11395288 CTGTGTGCTGAAGTATGAAAGGG - Intronic
987599502 5:20048229-20048251 TTAGGTGCTGAAGAAGGAACCGG + Intronic
988376059 5:30437420-30437442 CCCCAAGCTGAAGAATGAATTGG + Intergenic
991439303 5:66629701-66629723 CTGGGAGCTGATGAAAGAATGGG + Intronic
992124548 5:73626708-73626730 CCCGGAGCTGAAGCATGGATGGG - Intronic
992750448 5:79856441-79856463 CTGGGTTTTGTAGAATGAATGGG + Intergenic
993631152 5:90287359-90287381 CTGAGTCCTGAAGAATGAATTGG - Intergenic
996361163 5:122648748-122648770 CTGGCAGCTGAAGGATGAATAGG - Intergenic
1001040902 5:168334466-168334488 CTCAGGGCTGAAGGATGAGTAGG - Intronic
1002436534 5:179235065-179235087 CTGGGTTTTGAAGACTGAATAGG - Intronic
1003419794 6:5946840-5946862 CTCAGTCCTTAAGAGTGAATTGG + Intergenic
1004047114 6:12036965-12036987 CTGGGTCTTGGAGAATGAATAGG + Intronic
1004180072 6:13373282-13373304 CTGGGTTCTGAAGCATGCATAGG + Intronic
1004507384 6:16258040-16258062 CTCGTGGCTGGAGAATGACTCGG + Intronic
1007947359 6:45838384-45838406 CCTGGTCCTGAAGGATGAATAGG - Intergenic
1009958250 6:70484118-70484140 CTAGGTGCTGAGGAAAGAATAGG + Intronic
1011531592 6:88328234-88328256 CTGAGAGATGAAGAATGAATAGG - Intergenic
1013474255 6:110493025-110493047 CTGCATCCTGAAGAATGAATAGG - Intergenic
1016587166 6:145702139-145702161 CAGGACGCTGAAGAATGAATAGG - Intronic
1018199976 6:161385476-161385498 CTCTTGACTGAAGAATGAATGGG + Intronic
1019331103 7:461257-461279 CTGGGTTTTGAAGACTGAATAGG + Intergenic
1020618165 7:10486009-10486031 CTTGGTGCTGGAGATTGAGTTGG + Intergenic
1021450007 7:20776527-20776549 CTCTGTGCTAAAGAATGACTGGG + Intronic
1022806148 7:33824429-33824451 CTGAGAGCTGAAGGATGAATAGG - Intergenic
1024254245 7:47528076-47528098 GTCAGTGCTGAAGAATGTGTTGG - Intronic
1024366792 7:48529369-48529391 CACAGTGCTGAAAAAAGAATGGG - Intronic
1026764886 7:73154427-73154449 CTGGGTTTTGAAGGATGAATGGG - Intergenic
1027041359 7:74964197-74964219 CTGGGTTTTGAAGGATGAATGGG - Intergenic
1027082282 7:75238179-75238201 CTGGGTTTTGAAGGATGAATGGG + Intergenic
1027448564 7:78303046-78303068 CTGAGTTTTGAAGAATGAATAGG + Intronic
1027538687 7:79439925-79439947 CACAGGGTTGAAGAATGAATAGG - Intronic
1028802073 7:94977716-94977738 CTAGGTGGTGAAGGATGACTTGG + Intronic
1029390845 7:100272684-100272706 CTGGGTTTTGAAGGATGAATGGG + Intergenic
1029463513 7:100710642-100710664 CTGGGTGTTGAAGGATGTATAGG + Intergenic
1029943477 7:104506328-104506350 CTGAGTCCTGAAGAATGAGTAGG - Intronic
1030356484 7:108548884-108548906 ATCAGTCCTGAAGGATGAATAGG + Intronic
1030601658 7:111600025-111600047 CTGGGTTCTGAAGAATAAATAGG + Intergenic
1032906614 7:136374776-136374798 CTTTGGGCTGAAGAATGAATGGG + Intergenic
1033145698 7:138868738-138868760 CTAGGTCTTGAAGAGTGAATGGG + Intronic
1034843738 7:154423733-154423755 CTCAGTGATGATTAATGAATTGG + Intronic
1035966119 8:4193845-4193867 CTCGGTGCTGAAGAATGAATGGG - Intronic
1038308044 8:26422177-26422199 CTCGGTGATGATGAATTTATAGG - Intronic
1039447455 8:37644006-37644028 CTCAGTACAGAAGAATGAACAGG + Intergenic
1040058218 8:43080290-43080312 CTGGGTGCTGAAGGATGAGATGG - Intronic
1040731028 8:50447128-50447150 CTGGGTGTTGAGGAAAGAATGGG + Intronic
1043299255 8:78705980-78706002 CTCTGTGATGAGGAATGGATTGG + Intronic
1044843994 8:96362457-96362479 CTTAGTCCTGAAGACTGAATAGG - Intergenic
1046967844 8:120187046-120187068 CTGGGTTTTGAAGGATGAATAGG + Intronic
1048588381 8:135797357-135797379 CTGGGTGTTGAAGTATGAAAGGG + Intergenic
1049084234 8:140465133-140465155 CTGGGGGTTGAAGAATGAACAGG - Intergenic
1049397936 8:142410402-142410424 CTGGGTGTTGAAGGATGAGTAGG + Intergenic
1049664343 8:143836359-143836381 CTGGGTACTGAAGGCTGAATAGG + Intronic
1051032092 9:12693581-12693603 CTTGGAGCTGAAGGAAGAATTGG - Intronic
1052418083 9:28203448-28203470 CTAGGTTCTGAAGGAGGAATAGG + Intronic
1054926829 9:70597961-70597983 CTGGGTGTTGGAGAAGGAATGGG - Intronic
1058932021 9:109730087-109730109 CTGGGTGTTCAAGAATGAGTAGG + Intronic
1060053461 9:120393147-120393169 CTGGGTCTTGAAGAATGACTAGG - Intronic
1061083330 9:128385237-128385259 CTCGGGTCTGAAGGATGAGTGGG - Intronic
1062745371 9:138208486-138208508 CCCAGTGCTGAAGGATGACTGGG - Intergenic
1198504188 X:137285101-137285123 CTGAGAGCTGAAGAATGAATAGG + Intergenic