ID: 1035966120

View in Genome Browser
Species Human (GRCh38)
Location 8:4193846-4193868
Sequence TCTCGGTGCTGAAGAATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035966120_1035966124 9 Left 1035966120 8:4193846-4193868 CCATTCATTCTTCAGCACCGAGA 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1035966124 8:4193878-4193900 AGAACTGGCCACCTCCACGAAGG No data
1035966120_1035966128 20 Left 1035966120 8:4193846-4193868 CCATTCATTCTTCAGCACCGAGA 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG No data
1035966120_1035966125 16 Left 1035966120 8:4193846-4193868 CCATTCATTCTTCAGCACCGAGA 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1035966125 8:4193885-4193907 GCCACCTCCACGAAGGAAAGCGG No data
1035966120_1035966122 -6 Left 1035966120 8:4193846-4193868 CCATTCATTCTTCAGCACCGAGA 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1035966122 8:4193863-4193885 CCGAGAAGCCTCAGCAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035966120 Original CRISPR TCTCGGTGCTGAAGAATGAA TGG (reversed) Intronic
903107841 1:21099758-21099780 TCTAAGTTCTGAAAAATGAATGG - Intronic
906480376 1:46195594-46195616 TCTGGGTGCTGAAGATACAATGG - Intronic
907342177 1:53743131-53743153 TCTAGGTTCTGAAGATAGAAAGG - Intergenic
910030962 1:82722387-82722409 TCTAGGTACTGAAAAATGAATGG + Intergenic
910069744 1:83197731-83197753 CCTAGGTGCTTAAGAAGGAAAGG + Intergenic
910682767 1:89884090-89884112 TCTCATTGCTGAAGAAAGTAGGG + Intronic
914994190 1:152527057-152527079 TCTGGGTGCTGAGGAATTGAGGG - Intronic
920503633 1:206501229-206501251 TGTCTCCGCTGAAGAATGAAGGG - Intergenic
920703504 1:208235258-208235280 TCTCTATGCTAAAGAATAAAGGG - Intronic
921071811 1:211666167-211666189 TCTCAGTGCGGCAGAGTGAAGGG + Intronic
922386146 1:225085655-225085677 TCTGTGTGGTGAAGAATTAAAGG - Intronic
1063602810 10:7497395-7497417 TCTTGGTGGTGAGGAAGGAAGGG + Intergenic
1064306287 10:14169750-14169772 TGTTGGAGCTGAAGAATGACAGG - Intronic
1068472038 10:57477722-57477744 TCTCGGTGGTAAACAAGGAAAGG - Intergenic
1071295285 10:84214898-84214920 TCTCAGCCCTGAAGAATGGAGGG - Exonic
1077095008 11:795549-795571 TCTCTGTGCTGAAGGATGTGGGG - Intronic
1082549942 11:54383327-54383349 TCTCAAAGCTGAAGTATGAAAGG - Intergenic
1082550702 11:54393564-54393586 TCTCAAAGCTGAAGTATGAAAGG - Intergenic
1082553212 11:54526894-54526916 TCTCAAAGCTGAAGTATGAAAGG - Intergenic
1082553675 11:54533036-54533058 TCTCAAAGCTGAAGTATGAAAGG - Intergenic
1085837585 11:79973190-79973212 TCTCTGTGGTGAGGACTGAAGGG + Intergenic
1093785067 12:23183466-23183488 TCTCTGTGTTCATGAATGAATGG + Intergenic
1097316893 12:58181121-58181143 TTGGGGTGGTGAAGAATGAAGGG - Intergenic
1098842284 12:75490659-75490681 TCTCTGGGCAGAAGAATTAAAGG - Intronic
1104263921 12:127212714-127212736 TCTGGAAGCTGAAGAAGGAAAGG - Intergenic
1105859477 13:24396077-24396099 TCTTGGAGCTGAAGAATTTAAGG + Intergenic
1105943519 13:25171107-25171129 TCTCGCTGCTGAAGAAGAACGGG - Exonic
1107048080 13:36015311-36015333 CCTCAGTGATGAAGAAGGAAGGG + Intronic
1108630662 13:52278694-52278716 TCTTGGAGCTGAAGAATTTAAGG - Intergenic
1108656026 13:52533846-52533868 TCTTGGAGCTGAAGAATTTAAGG + Intergenic
1108954287 13:56133060-56133082 TCTACATGCTGAAGAATAAAAGG - Intergenic
1111150506 13:84247732-84247754 TCTTGGTGTTGAATATTGAATGG - Intergenic
1111317673 13:86583070-86583092 TCTAGCTGCTTCAGAATGAATGG - Intergenic
1111466794 13:88623581-88623603 TCACAGAGCTGAAGAATAAACGG + Intergenic
1111709003 13:91787546-91787568 ACTCAGTGCTGAAGAAAGTAGGG + Intronic
1112993323 13:105541196-105541218 TCAAGGAGCTGAAGAATGAAAGG - Intergenic
1113236345 13:108279403-108279425 TTTCAGTACTGAAGGATGAATGG + Intronic
1115053975 14:29099726-29099748 CCTCGGTACTGAAGAATGAAGGG - Intergenic
1116055231 14:39855563-39855585 TCTCCGTGAGGAAGAAAGAAAGG - Intergenic
1116932830 14:50706726-50706748 TCTAGCTGCTGAAAAATGAGTGG + Intergenic
1126316763 15:47378194-47378216 TCTCAATGTTGAAGATTGAAAGG + Intronic
1128311046 15:66631979-66632001 TCTCTGTGCAGAGGAAGGAAGGG + Intronic
1134410946 16:14002882-14002904 TCTCGGTGGGGAGGAAGGAATGG + Intergenic
1135787615 16:25364414-25364436 TCTCAGTGCTGAAGACGGAAGGG + Intergenic
1137833118 16:51563359-51563381 TCTCAGTGGTGGAGAATGAGAGG - Intergenic
1138526331 16:57609674-57609696 TCTGGCTGCTGAAGAAAGAGAGG - Intergenic
1138641775 16:58393309-58393331 TCTGGTTGCTGAAGGATTAAAGG - Intronic
1142205517 16:88781174-88781196 TTTCGGTGCTCAAAGATGAAGGG - Intronic
1145832730 17:27930181-27930203 TGTCGGAGCTGACGAAGGAATGG - Intergenic
1146673735 17:34758940-34758962 CCATGGTGCTGATGAATGAAGGG + Intergenic
1150869022 17:68884360-68884382 TCTCTTTTCTGAAGAACGAATGG - Exonic
1151194747 17:72423565-72423587 TCTGGGAGCGGAAGAATGCAAGG + Intergenic
1157990722 18:52492572-52492594 TCTCCTTGCTGAAGTGTGAAAGG + Intronic
1158702607 18:59762264-59762286 TCTTGGTGCTGGATAATGTATGG - Intergenic
1162194434 19:8973408-8973430 GGTCTGTGGTGAAGAATGAATGG + Exonic
1163344816 19:16733959-16733981 TCTCGGTGCTAAAGAATTCAGGG + Intronic
1166281529 19:41797424-41797446 TAGAGGTGCTGAAGAAAGAAAGG + Intronic
1168688802 19:58364521-58364543 TCTAGGTGCTGAAAAAGGCAAGG - Intergenic
926106162 2:10153020-10153042 CCTAGGTGTTGATGAATGAAGGG + Intronic
926835386 2:17013494-17013516 TCTGGATGCTGTAGAATGAATGG + Intergenic
928402313 2:30987959-30987981 TCTCGTTACTGAAAAAAGAAGGG - Intronic
928790249 2:34941474-34941496 TCTCTGTGAAGAAGAATTAAAGG - Intergenic
930302252 2:49631353-49631375 TCTCAGTTTTGAAGACTGAAGGG - Intergenic
931688108 2:64811932-64811954 TCTGGGGGCTGAAGAAGGACAGG + Intergenic
933297835 2:80510487-80510509 GCTGGGTCTTGAAGAATGAATGG - Intronic
933938581 2:87226808-87226830 TATCGGTGCTGCAGAGAGAAAGG - Intergenic
936354554 2:111738966-111738988 TATCGGTGCTGCAGAGAGAAAGG + Intergenic
937210073 2:120262807-120262829 TTTGGGTGATGAAGAAAGAAGGG + Intronic
939373906 2:141339061-141339083 TGTCAGTTCTGAAGAATAAAAGG - Intronic
942204421 2:173605230-173605252 TCTAGGTGCTGAAGTCTGCATGG + Intergenic
945034138 2:205689753-205689775 TCTCAGTGTTGAAGGATGGAAGG - Intronic
946420805 2:219563458-219563480 TCGTGGTGCTGGAGAATGAGGGG - Exonic
947946760 2:234110415-234110437 CCTAGGTGCTGAGGAGTGAATGG + Intergenic
948096325 2:235337090-235337112 TCTCTGTGCTGAAGAGAGAAAGG - Intergenic
1170386200 20:15820108-15820130 ACTGTGTGCTGAAGCATGAATGG + Intronic
1171147107 20:22794558-22794580 CCTCAGTCCTGAAGAATTAAAGG + Intergenic
1171239467 20:23553445-23553467 TCTCTGTGCTGAACATTGACAGG + Intergenic
1175500185 20:59444566-59444588 TCTAGGTGTTGGAGAATGAGGGG - Intergenic
1175880568 20:62256170-62256192 GCTGGCTGCTGAAGGATGAACGG + Exonic
1178088185 21:29134046-29134068 TCACGGTGCTGAGGAAAGGAAGG + Intronic
1179224718 21:39443511-39443533 TTTGGGAGCTGAAGAATGAGGGG + Intronic
1181380878 22:22502760-22502782 GCTCGATGAAGAAGAATGAAAGG + Intronic
949868096 3:8563303-8563325 TCTCACATCTGAAGAATGAAAGG + Intronic
951553006 3:23894486-23894508 CCTGGGTGATGAAGAATGACAGG - Intronic
951807583 3:26663567-26663589 TATCAGTGCTGAAAAATGCAAGG - Intronic
957687585 3:83522285-83522307 TCACTGTGCTGAAGAAAGGAGGG - Intergenic
959743650 3:109750788-109750810 TCTTGCTGCTGAAGAAGAAATGG - Intergenic
959829822 3:110847440-110847462 ACTAGGTGCTACAGAATGAATGG + Intergenic
960321851 3:116246611-116246633 TCACGGTGCTGAAAAATGGAAGG - Intronic
961128501 3:124443673-124443695 TCTGCGTGCTGAAGAATAACAGG + Intronic
964913140 3:161806500-161806522 TCTAGGTGCTCAGGAGTGAAGGG - Intergenic
965204029 3:165697807-165697829 TCTCTCTGCTGAAGAATAAAAGG + Intergenic
967922900 3:194625838-194625860 TCGGCGTGCTGATGAATGAATGG + Intronic
968907675 4:3462243-3462265 TCTCGGGGGAGAAGAAGGAAGGG - Intergenic
969643210 4:8411533-8411555 GCCGCGTGCTGAAGAATGAATGG - Intronic
970345280 4:15147194-15147216 TCTCTGAGCTGCAGGATGAATGG - Intergenic
971945563 4:33271607-33271629 TTTGGGGCCTGAAGAATGAATGG - Intergenic
978018167 4:103774293-103774315 GCTCTGTGCTGAACAATTAATGG + Intergenic
978935797 4:114373710-114373732 TCTGGGTGCTGAAAAATCTATGG + Intergenic
982354197 4:154448806-154448828 TCATGGAGCTGAAGTATGAAGGG - Intronic
984188820 4:176579953-176579975 TCTCGGTGATGAAGGAGGTAAGG + Intergenic
986377898 5:7150960-7150982 TCTCGGTTCTGAAGAAGTCAGGG - Intergenic
986814644 5:11395267-11395289 GCTGTGTGCTGAAGTATGAAAGG - Intronic
992124550 5:73626709-73626731 TCCCGGAGCTGAAGCATGGATGG - Intronic
993059206 5:83018521-83018543 CCTCTGTACAGAAGAATGAATGG + Intergenic
996015080 5:118524519-118524541 TCTTGATACTGAAGAATAAAAGG - Intergenic
996355505 5:122591932-122591954 ACTGGGTGCTGGAGAGTGAAGGG - Intergenic
997879547 5:137577258-137577280 GCTGGGTGCTGAAGGATGAAAGG + Intronic
999695493 5:154185362-154185384 TCTGGGACCTGAAGGATGAAAGG + Intronic
1001217145 5:169866562-169866584 TCTGGCTGCTGAGGAAGGAATGG + Intronic
1003419672 6:5945747-5945769 CCTGGATGCTGAAAAATGAAGGG - Intergenic
1007915240 6:45555470-45555492 TTTGGGGGCAGAAGAATGAAGGG - Intronic
1009361830 6:62824401-62824423 TCTCTCTGCTGCAGAGTGAAGGG - Intergenic
1010040548 6:71377998-71378020 TCTAGGTGATGAGAAATGAAGGG + Intergenic
1012519782 6:100107282-100107304 TCTCTATGCTAAAGAATAAAAGG + Intergenic
1014779215 6:125543950-125543972 TCTTGGTGCCGTAGGATGAATGG + Intergenic
1015411997 6:132904002-132904024 TCTCTGTGCTTCAGACTGAAGGG - Intergenic
1021450006 7:20776526-20776548 CCTCTGTGCTAAAGAATGACTGG + Intronic
1028129312 7:87152048-87152070 TCTCAGTGCTGAAGAAAACAGGG - Intergenic
1032906613 7:136374775-136374797 TCTTTGGGCTGAAGAATGAATGG + Intergenic
1035966120 8:4193846-4193868 TCTCGGTGCTGAAGAATGAATGG - Intronic
1039904145 8:41773835-41773857 TCCCGGTGCTGGAGAAGGATGGG + Intronic
1040731027 8:50447127-50447149 TCTGGGTGTTGAGGAAAGAATGG + Intronic
1041090044 8:54293443-54293465 TCCCTGTGCTGAAGACTGGAGGG + Intergenic
1043841213 8:85107008-85107030 TGTAGGAGCTGGAGAATGAATGG - Intergenic
1043912975 8:85885211-85885233 TCTAGGTGCCAAAGAATTAAAGG - Intergenic
1046620255 8:116521648-116521670 TCTCGATTCTGAAAAATGTAAGG - Intergenic
1046797689 8:118390488-118390510 TCTAGGTTATGAAAAATGAAGGG - Intronic
1048340485 8:133534844-133534866 TCTCGGTGCTGGTGAGGGAAAGG + Intronic
1048588380 8:135797356-135797378 GCTGGGTGTTGAAGTATGAAAGG + Intergenic
1050138876 9:2496595-2496617 TCTAGGTGCTGAGGATTGATTGG - Intergenic
1051512132 9:17889757-17889779 TCTTCATGCTGGAGAATGAATGG + Intergenic
1051635015 9:19173690-19173712 TCTAGGTCCTGAAGGATGAGGGG + Intergenic
1057257641 9:93563329-93563351 ACTCGGTGCTGAAGAAAACATGG - Intronic
1058985317 9:110204384-110204406 TCTAGGAGCTGATCAATGAAAGG - Intronic
1059484854 9:114618690-114618712 ACTAAGTTCTGAAGAATGAATGG - Intronic
1062091334 9:134680136-134680158 ATTCCTTGCTGAAGAATGAAGGG - Intronic
1187119655 X:16392018-16392040 TCTGGATGCTGAATAATGGAAGG - Intergenic
1188784510 X:34328263-34328285 CCTCAGTGCTGATGAATAAAAGG + Intergenic
1191783657 X:64894673-64894695 TCAGGGTGCTGAAGAATGCCTGG + Intergenic
1191977048 X:66884659-66884681 TCTGCCTGCTGAAGAAAGAAAGG - Intergenic
1193726130 X:85041519-85041541 TCATGGTGCTGAGGAATGGACGG - Intronic
1197278958 X:124512884-124512906 TCTGGGTGATGGAGAAAGAAGGG - Intronic
1197622888 X:128770950-128770972 TCTAGATGCTGAAGAAAGAGTGG - Intergenic