ID: 1035966121

View in Genome Browser
Species Human (GRCh38)
Location 8:4193863-4193885
Sequence CCAGTTCTGCTGAGGCTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 253}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035966121_1035966125 -1 Left 1035966121 8:4193863-4193885 CCGAGAAGCCTCAGCAGAACTGG 0: 1
1: 0
2: 2
3: 26
4: 253
Right 1035966125 8:4193885-4193907 GCCACCTCCACGAAGGAAAGCGG No data
1035966121_1035966131 27 Left 1035966121 8:4193863-4193885 CCGAGAAGCCTCAGCAGAACTGG 0: 1
1: 0
2: 2
3: 26
4: 253
Right 1035966131 8:4193913-4193935 GAAAGTACAATGTTTAATGGTGG No data
1035966121_1035966132 28 Left 1035966121 8:4193863-4193885 CCGAGAAGCCTCAGCAGAACTGG 0: 1
1: 0
2: 2
3: 26
4: 253
Right 1035966132 8:4193914-4193936 AAAGTACAATGTTTAATGGTGGG No data
1035966121_1035966130 24 Left 1035966121 8:4193863-4193885 CCGAGAAGCCTCAGCAGAACTGG 0: 1
1: 0
2: 2
3: 26
4: 253
Right 1035966130 8:4193910-4193932 GGAGAAAGTACAATGTTTAATGG No data
1035966121_1035966124 -8 Left 1035966121 8:4193863-4193885 CCGAGAAGCCTCAGCAGAACTGG 0: 1
1: 0
2: 2
3: 26
4: 253
Right 1035966124 8:4193878-4193900 AGAACTGGCCACCTCCACGAAGG No data
1035966121_1035966128 3 Left 1035966121 8:4193863-4193885 CCGAGAAGCCTCAGCAGAACTGG 0: 1
1: 0
2: 2
3: 26
4: 253
Right 1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035966121 Original CRISPR CCAGTTCTGCTGAGGCTTCT CGG (reversed) Intronic
900491691 1:2952466-2952488 CCTGTGCTGCTGAGGGTGCTGGG + Intergenic
900625114 1:3604424-3604446 CCATTGCTGCGGAGGCTTCTCGG - Intronic
901786077 1:11625900-11625922 CCAGTCCAGCTGGGGCTTCGTGG + Intergenic
904826602 1:33277383-33277405 TGAGTTCTGCTGAGGCTTCGAGG + Intronic
905253394 1:36664638-36664660 TCAGTTCTGCTGACGCTGCCAGG - Intergenic
906186120 1:43863384-43863406 CCAGTTTTTCTGAGGCTCCGGGG - Intronic
908328850 1:63050785-63050807 TCAGTGCTGCTGGGGATTCTGGG - Intergenic
910900699 1:92117468-92117490 GCCTTTCTACTGAGGCTTCTGGG + Intronic
912096259 1:106148725-106148747 CAACTTCTGCTGAAGTTTCTAGG + Intergenic
912427866 1:109610542-109610564 CCAGTTCTCCTCAGCCTTCCAGG + Exonic
913520158 1:119638011-119638033 CCAGTACTATTGAGGCTTCATGG - Intronic
915614999 1:157030864-157030886 GCAGTGATGATGAGGCTTCTTGG - Intronic
915994177 1:160547374-160547396 CTTCTTCTGCTGAGGCTGCTTGG + Intronic
916870341 1:168907356-168907378 CCACGTGTGCTGAGGCCTCTGGG + Intergenic
917392124 1:174549170-174549192 CCATTTCTGCTGACTCTTATTGG + Intronic
917788797 1:178486744-178486766 CCAGCCCTGCTGCGGCCTCTCGG - Intergenic
917832358 1:178905900-178905922 CCAGTTCTGTTGAGGGCTCTTGG - Intronic
920509528 1:206540583-206540605 CCAGTTCTGCTGAAGCATGCAGG - Intronic
921753620 1:218826340-218826362 CCATTTCTGCTGTGGCAGCTTGG + Intergenic
922484568 1:225963249-225963271 CCTGTACTGCTGAGGATTCTGGG - Intergenic
922950766 1:229557318-229557340 TCACTTCTGCTGGGGCTTCTAGG - Intronic
922959949 1:229637844-229637866 ACAGTGCTGCTGGGGCCTCTTGG - Exonic
924606999 1:245543575-245543597 CCTGATCTGCTCAGGCTTCTGGG + Intronic
1065543860 10:26798766-26798788 CCTGTTCTGCTAAGTGTTCTAGG - Intronic
1066071084 10:31813976-31813998 GCATTTCTGTTGAGGCCTCTAGG - Intronic
1066194865 10:33089349-33089371 CCTTTCCTGCTGAGGCTTCTGGG + Intergenic
1067035192 10:42910030-42910052 CCAGCTCAGCTGAGGAATCTAGG - Intergenic
1069121720 10:64576586-64576608 CCACTTCTTCTGAGACTTGTTGG - Intergenic
1069162776 10:65111247-65111269 CCAGTTCTAGTGAAGCCTCTGGG + Intergenic
1070890944 10:79941898-79941920 CCAGTTCTCCTGTGCCTGCTTGG - Intronic
1073084899 10:100882040-100882062 CCCATTCTGGGGAGGCTTCTGGG + Intergenic
1074922095 10:118024926-118024948 CCATCTCTGCAGAGGCTTCAAGG + Intronic
1075246087 10:120823279-120823301 CCAGCCCTGCAGAGGCCTCTGGG + Intergenic
1075391396 10:122095139-122095161 CCAGTTCAGCACAGGCATCTGGG - Intronic
1076139300 10:128066785-128066807 CCTTTTTTGCTGTGGCTTCTTGG - Intronic
1077753851 11:5004306-5004328 CCAGGTGAGCTGAGGCTTGTAGG + Intergenic
1077933910 11:6762655-6762677 TCAGATCTGGTGAGGCTTCAGGG - Intergenic
1078759332 11:14239155-14239177 CAAGTTCTCCTGAGGCTTTGTGG + Intronic
1080100511 11:28454428-28454450 GAAGTTCTTCTGAGGCCTCTTGG + Intergenic
1081914430 11:46721616-46721638 CCACTTTTGCTGAGACTTCAGGG + Intronic
1081964760 11:47162726-47162748 CCTGTTCTGCTTGGGCTTCTGGG - Intronic
1083265088 11:61542887-61542909 CGAGTGCTGCTGAGGCTGCGTGG + Intronic
1083692930 11:64421865-64421887 CAGGTTCAGATGAGGCTTCTAGG + Intergenic
1085904709 11:80746486-80746508 CCAGTGCTGGTGAGGCGTGTGGG - Intergenic
1087785294 11:102347315-102347337 CCGGCTCTGCGGAGGCCTCTAGG + Intronic
1088741967 11:112774636-112774658 CCAGGTCGGCTGAGGCTTTATGG - Intergenic
1089347891 11:117803023-117803045 CCTTTTCTGCTCTGGCTTCTCGG + Intronic
1089460519 11:118650441-118650463 CCAGGTCTGCCGTGGCTACTTGG + Exonic
1089632219 11:119790993-119791015 CAAATTCTGGGGAGGCTTCTGGG + Intergenic
1089759228 11:120710933-120710955 CCAGTTCTGCACTGCCTTCTGGG - Intronic
1090873118 11:130765456-130765478 CCATCTCTGCTGACCCTTCTGGG + Intergenic
1091078081 11:132640080-132640102 CAGGTTCTTCTGAGGTTTCTAGG - Intronic
1091351886 11:134904348-134904370 CGAGTTGTGCTGAGGAGTCTTGG - Intergenic
1091543822 12:1487025-1487047 TCAGTTCTGCTGAGACTTTAGGG + Intronic
1092437744 12:8465126-8465148 CCAGTTCTGCTCAGTAATCTTGG - Intronic
1093186080 12:16021278-16021300 TCCTTTCAGCTGAGGCTTCTAGG - Intronic
1093203755 12:16221920-16221942 ACAGTTCTGCTTATGCTTCCAGG + Intronic
1094173179 12:27515890-27515912 CCAGTTCTCATGAGGCTTGACGG - Intergenic
1096080612 12:48830042-48830064 CCAGGTCTCCTGGGGCATCTAGG + Exonic
1096451206 12:51743593-51743615 CCATTACTGCTGAGACTGCTGGG + Intronic
1096601542 12:52733270-52733292 CCAGGTCTCCTGGGGCATCTAGG - Intergenic
1099483182 12:83193957-83193979 CTAGTTTTGTTGATGCTTCTGGG + Intergenic
1100013383 12:89980213-89980235 CCAATGCTGCTGGGGCTTTTTGG - Intergenic
1100208439 12:92376392-92376414 CAAGTTCTGGAGAGGCTTCAGGG - Intergenic
1100592916 12:96045879-96045901 GCATTTCTGATGAGGCTTCTAGG - Intergenic
1100819659 12:98419647-98419669 CCAATCCTGCTGAGTCTTCTAGG - Intergenic
1101594478 12:106151782-106151804 CAGGTTCTGCTTAGGCATCTTGG + Intergenic
1101871144 12:108566477-108566499 CCAATTCTGCTAACCCTTCTTGG - Intronic
1101900776 12:108789686-108789708 ACACTTCAGCTGAGGCTTCTGGG + Intronic
1102221774 12:111199665-111199687 TCAATTCTGCTGAGACGTCTGGG + Intronic
1105574359 13:21636535-21636557 ACAGTTCTGCTGAGCCTGCCCGG + Intergenic
1105810751 13:23993068-23993090 CCATCTCTGCTGATGCTTCCAGG - Intronic
1106789123 13:33136892-33136914 CCAGCCCTGCTGCTGCTTCTTGG - Intronic
1108916540 13:55620325-55620347 ACAGTTCTGCTCAGGCTTAGTGG + Intergenic
1109632135 13:65063403-65063425 CCATTTATGCTGAGACCTCTAGG - Intergenic
1109722956 13:66299820-66299842 CCATTTCTTCTCAGGCTTCTTGG - Intergenic
1110122486 13:71900347-71900369 CCACTTTTACTGAGGCATCTGGG - Intergenic
1110708652 13:78625703-78625725 CCAGTTGTGCTCAGGCCCCTTGG - Intronic
1113474081 13:110567642-110567664 CCAGTTCTGGGAAGGCCTCTAGG - Intergenic
1113533996 13:111049935-111049957 CCACTTCTGCAGAGGCTGCGAGG + Intergenic
1114431478 14:22665389-22665411 CTGCTTCTGCTGAGGCTTCAAGG + Intergenic
1114543660 14:23482726-23482748 CCAGCACTGCTCTGGCTTCTTGG - Intronic
1116125254 14:40775736-40775758 CCAGTTCTGCTGAGTTTTCTTGG - Intergenic
1118750903 14:68807345-68807367 CCAGATCTGCTGCAGCTGCTGGG + Intergenic
1121865087 14:97355487-97355509 GAAATTCTGCTGGGGCTTCTGGG - Intergenic
1122900741 14:104781381-104781403 CCAGTCCTGCTGGGTCTTCGTGG + Intronic
1123200303 14:106657169-106657191 CCAGTTCAGCTGAGGGTCCGAGG - Intergenic
1124355569 15:28992623-28992645 TGAGTTCTGCTGTGGATTCTGGG + Intronic
1124493145 15:30170709-30170731 CGAGGTCTGATGAGCCTTCTTGG + Intergenic
1124750389 15:32367616-32367638 CGAGGTCTGATGAGCCTTCTTGG - Intergenic
1124991154 15:34674996-34675018 CCAGCTCTGACAAGGCTTCTAGG + Intergenic
1125422029 15:39513540-39513562 CCAGTTCTGCAGAGGCCCCCTGG + Intergenic
1127538402 15:59913091-59913113 CCAGGACGGCTGAGGCTGCTTGG - Intergenic
1127717348 15:61662080-61662102 CCAGATCTGCTGGGGCTTGTTGG - Intergenic
1127802927 15:62493311-62493333 CCAGCTATGTTGAAGCTTCTGGG + Intronic
1128144638 15:65326049-65326071 CCAGGTCTGCTGAGCCTCCTGGG + Intergenic
1128334924 15:66779589-66779611 CCTGTTCTTCTGGGGCTTCTAGG + Intronic
1129234798 15:74217653-74217675 CCAGTTCTCCTGAGGCTCTCTGG - Intergenic
1129242184 15:74258290-74258312 TCAGATCTGCTGTGGCTGCTGGG - Intronic
1129672786 15:77616403-77616425 CCAGGGCTTCTGAGGCTGCTGGG + Intronic
1129766780 15:78174606-78174628 CCAGCTGTGCTGAGGCTTCCGGG - Intronic
1132114664 15:99126531-99126553 CCAGGTCTGCTGAGGCTGGTGGG + Intronic
1132115160 15:99130774-99130796 CGTGTTCTCCTGAGGCTGCTTGG - Exonic
1132825518 16:1903360-1903382 CGAGCGCTGCTGAGGCTTCCAGG - Intergenic
1133101805 16:3484548-3484570 CCAGCTCTGCAGAGGCTTAGCGG + Intronic
1135431432 16:22387023-22387045 ATAGTTCTGCTGAGGCTTAAAGG - Intronic
1136102124 16:28004033-28004055 CCAGGCCTGCTGGGGCTGCTGGG + Intronic
1137694641 16:50453539-50453561 CCAGTTAGACTGAAGCTTCTCGG + Intergenic
1137973943 16:53014493-53014515 CCAGGGCTGCTGAGGGATCTGGG + Intergenic
1142561932 17:815074-815096 CAAATTCAGCTGAGTCTTCTAGG + Intronic
1143662231 17:8332727-8332749 CCAGTTCTGCGGAGTGTTTTTGG - Intergenic
1144733441 17:17541637-17541659 ACAGGTTTGTTGAGGCTTCTGGG + Intronic
1144760465 17:17704195-17704217 CCAGTGCTGTTGAGGCAGCTGGG + Intronic
1144932911 17:18874659-18874681 CCAGCTCTGCTGAGAATCCTGGG - Intronic
1145328337 17:21850084-21850106 CCAGAGCTGCTGAGCATTCTGGG + Intergenic
1145415263 17:22709374-22709396 CCAGAGCTGCTGAGCATTCTGGG + Intergenic
1145695120 17:26781428-26781450 CCAGAGCTGCTGAGCATTCTGGG + Intergenic
1147161394 17:38571433-38571455 CCAGCACTGCTCAGCCTTCTGGG + Intronic
1148087977 17:45006199-45006221 CCAATTCTGCAGGGGCTTGTAGG - Intergenic
1148126737 17:45241268-45241290 ACAGGCCAGCTGAGGCTTCTAGG + Intronic
1148198837 17:45734450-45734472 CCAGCTTTGCTCGGGCTTCTGGG + Intergenic
1149983652 17:61331167-61331189 CCCTGTGTGCTGAGGCTTCTAGG - Intronic
1150279252 17:63919331-63919353 CCACTTCTGCTGAGGACTCCTGG + Intergenic
1150795807 17:68235735-68235757 CCTGCTCTGCTGTGGCTTTTTGG + Intergenic
1150875500 17:68965675-68965697 CAAGTACAGCTGATGCTTCTCGG - Intergenic
1150930425 17:69578931-69578953 CCAGATGTGCTGATGTTTCTGGG - Intergenic
1152461955 17:80446199-80446221 CCAGTACTCCTGAGGGGTCTTGG - Intergenic
1152763365 17:82121504-82121526 GCAGGTCTGCTGAGGGCTCTGGG + Intronic
1153044166 18:840526-840548 CCAGTTCATCTCAGGCTGCTGGG - Intergenic
1155367130 18:25059690-25059712 CCAGTCGTGTGGAGGCTTCTAGG + Intergenic
1159761344 18:72430254-72430276 CCAGTTTCTCCGAGGCTTCTGGG + Intergenic
1160365280 18:78319340-78319362 CCTGTCCTGCTGAGGGTTCCAGG + Intergenic
1164336362 19:24325026-24325048 CCAGTTCTGGTGAAGCCTCAGGG - Intergenic
1165167676 19:33868514-33868536 CTAATTCTGCTGAGGTTCCTGGG + Intergenic
1165413881 19:35679247-35679269 ACAGGGCTGCTGAGGCTTATAGG + Intergenic
1168250396 19:55138170-55138192 CCAGTGCCGCAGAGGCTGCTGGG + Intronic
1168458832 19:56537880-56537902 CCAGTTCTGATAAGGCCCCTGGG + Intergenic
1168608268 19:57777134-57777156 CCAGCTCTTCAGAGGCTACTCGG + Intronic
925267712 2:2578611-2578633 CCAGTGCAGCTGAGAGTTCTTGG - Intergenic
928212929 2:29337184-29337206 CCAGTCCTGCTGAGGGCTTTGGG + Intronic
929821986 2:45281338-45281360 ACAGTTCTGAGGAGGCTTCCTGG - Intergenic
930095168 2:47561165-47561187 CCAGGTGTGCTGAGGCCTCTTGG - Intronic
930308809 2:49712106-49712128 GCAGTTCTGTTGCGGCTTTTTGG + Intergenic
930373621 2:50536614-50536636 CCAGTTGTTCTGATGCCTCTTGG - Intronic
931507614 2:62948699-62948721 AGAGCTCTGCTGAGACTTCTGGG - Exonic
934723060 2:96595360-96595382 CCAGATCTGCTGAGGAGTCTGGG + Exonic
934950624 2:98572847-98572869 CCAGAGCTGCTGCGGTTTCTGGG + Exonic
935658325 2:105443820-105443842 CTAGTGCTGCTGAGCCTGCTGGG + Intergenic
938300175 2:130205088-130205110 CCAGTGCTTCTGAAGCATCTTGG + Intergenic
938456546 2:131469408-131469430 CCAGTGCTTCTGAAGCGTCTTGG - Intronic
940633088 2:156263408-156263430 CCAGCTCAGCTGAGGAATCTAGG + Intergenic
941073447 2:160980842-160980864 CCAGGGCTGAGGAGGCTTCTTGG + Intergenic
941908104 2:170736483-170736505 CCAGCGCTGATGAGGTTTCTCGG - Intergenic
942665839 2:178316156-178316178 CCAGCACTGGTGAGGCTTCAAGG + Intronic
943600128 2:189907626-189907648 CCTGCTCTGTTGAGGTTTCTGGG - Intronic
943795629 2:191989508-191989530 CCAGTTATACTGAGGTTACTTGG - Intronic
945612227 2:212018221-212018243 CTAGTCCTGCTGTGGCTTGTTGG - Intronic
945890457 2:215425499-215425521 CCAGCTCAGCTGGGGCTACTGGG + Intronic
946845653 2:223856684-223856706 CAAGTCCTGCTGAGGCCTCAGGG + Intronic
947529052 2:230897059-230897081 GCAGTTGTGCTGAGGATTCTGGG - Intergenic
947773513 2:232689633-232689655 CCAGCCCTGCTGGTGCTTCTGGG - Intergenic
1169202347 20:3717938-3717960 CCACTTCTGCTCCGGCCTCTGGG - Intergenic
1171321327 20:24246996-24247018 CCAGTCCTTCTGTTGCTTCTGGG - Intergenic
1171518573 20:25758730-25758752 CCAGAGCTGCTGAGCATTCTGGG + Intergenic
1171558282 20:26097479-26097501 CCAGAGCTGCTGAGCATTCTGGG - Intergenic
1171721324 20:28566067-28566089 TCAGTTTTGCTGAGGGTTTTAGG - Intergenic
1172583037 20:36063799-36063821 CCAGTTTTCCAGTGGCTTCTTGG + Intergenic
1172645605 20:36467402-36467424 CTAGTTTTGCTGAGGCATCAGGG + Intronic
1173329789 20:42065689-42065711 TCAGTTCTGCTTATGCTTATTGG + Intergenic
1175159994 20:57001277-57001299 CCTGTTCTGGTGAGGATTCAAGG - Intergenic
1175486380 20:59349802-59349824 CCAGTTCTGCACATGCTTCCTGG - Intergenic
1176125595 20:63473202-63473224 CCAGTCCTGCTCAGGCGGCTGGG - Intergenic
1180229738 21:46419934-46419956 CCTTTTCTACAGAGGCTTCTGGG - Intronic
1181930460 22:26396572-26396594 CAATTTCTGCTGAGGCTCATTGG - Intergenic
1183991845 22:41602337-41602359 ACAGCTCTGCTGAGGGATCTAGG - Intronic
1184085171 22:42257801-42257823 CCAGGTCTGCAGAGGCATTTTGG - Intronic
950123871 3:10499734-10499756 CCAGGTCTGCAGGGGCTCCTGGG - Intronic
953668250 3:44941399-44941421 GTAGTTCTGCTGAGGCTGATTGG - Intronic
954460411 3:50623456-50623478 TCACCTCTGCTGGGGCTTCTAGG + Intronic
955119998 3:56048712-56048734 CCAGGTCTGCAGAGGTTACTTGG - Intronic
955227568 3:57073699-57073721 CCAGTTCTGCTCTGACTTGTGGG + Exonic
955237337 3:57150914-57150936 CCTGCTCTGCTGAGGATTCCTGG + Intronic
955481157 3:59391939-59391961 CAAGTTCTGATCAGCCTTCTGGG + Intergenic
956016988 3:64894241-64894263 CTAGTATTGCTTAGGCTTCTTGG + Intergenic
958949684 3:100402665-100402687 TCAGTTTTGCTGTGGCCTCTTGG + Intronic
960005388 3:112776161-112776183 CCAATTGTGCTGAAGCTGCTAGG + Intronic
961960123 3:130845877-130845899 CCAGTGATGCTGATGCTGCTGGG - Intergenic
962741712 3:138367008-138367030 CCACTTCTCCTCAGGCTTCCAGG - Intronic
964659419 3:159104021-159104043 CCAGCCCTGCTGAGGCCTATAGG - Intronic
966570867 3:181441587-181441609 CCAGTCCAGCTCAGGATTCTGGG - Intergenic
966785189 3:183617158-183617180 CCACTTCTACTGGGGCTTCCTGG + Intergenic
968487056 4:867805-867827 CGAGTGCTGCAGAAGCTTCTGGG + Intronic
969296129 4:6271398-6271420 CCAGTGCTGGACAGGCTTCTGGG + Intronic
969335574 4:6507553-6507575 CCAGCTCAGCTGAGGCACCTTGG + Intronic
969652717 4:8477481-8477503 GGAGCTCTGCTGAGGCCTCTGGG + Intronic
969884714 4:10205123-10205145 CCAGTTCTTCAGAGGCTTAAAGG + Intergenic
970194958 4:13543930-13543952 TCAGGTCTGCTGCGGCTTCGCGG - Exonic
973782407 4:54300762-54300784 CAAGTCTTGCTGAGGCTGCTGGG - Intergenic
976596238 4:86897775-86897797 CCAGCTCTGCAGAGGATCCTAGG - Intronic
977200402 4:94108148-94108170 CCATCTCTTCTGAGGCTTCACGG - Intergenic
981846617 4:149176717-149176739 ACAGGTCTGCTGAGGCTTGCTGG - Intergenic
981932127 4:150201378-150201400 CCAGTTCTGGGGAGGCTAATGGG - Intronic
985482934 5:128762-128784 CCAGTTGTGAGGAGGATTCTGGG - Intergenic
986404272 5:7410101-7410123 CCAGATTTGGTGTGGCTTCTGGG - Intronic
986780471 5:11060615-11060637 CCACTACTGTTGAGGCATCTTGG - Intronic
989342091 5:40387569-40387591 CCAGGTCTGATGAGGCTCCCTGG - Intergenic
990518272 5:56551485-56551507 ATATTTCTGCTGAGGCTTGTGGG - Intronic
994877971 5:105449895-105449917 CCAGGTATGCTGCTGCTTCTAGG - Intergenic
998417726 5:141957814-141957836 CAACTTCTGCTGGGGCTTTTGGG - Exonic
999456887 5:151724392-151724414 TCATTTCTGCAGTGGCTTCTTGG - Intergenic
1000117029 5:158162917-158162939 ACTGTACTGCTGGGGCTTCTGGG + Intergenic
1000512507 5:162200791-162200813 CCAGCTCTAGAGAGGCTTCTTGG + Intergenic
1001580795 5:172796946-172796968 CCAGTTCTTCTGTGGCCCCTTGG + Intergenic
1002281028 5:178130324-178130346 TCAGTTCTCCTGAGATTTCTAGG + Intergenic
1006071175 6:31498877-31498899 CCAGTCCTTCTGAGGCCCCTGGG + Intronic
1006507800 6:34501504-34501526 CCAGTTCTGGGCAGGTTTCTTGG + Intronic
1007681936 6:43640080-43640102 CCAGTTCTGCCAGGGCTTGTTGG - Exonic
1008588129 6:52967506-52967528 GGAGTCCTGCTGAGGCTTTTTGG - Intergenic
1010327972 6:74587453-74587475 CCTGTTGTGGTGAGGCTTGTAGG - Intergenic
1013641480 6:112087268-112087290 CCAGATCGGCTGCTGCTTCTGGG - Exonic
1014209070 6:118689010-118689032 TCAGTTCTGCTGGGACTACTGGG - Intronic
1016548916 6:145255316-145255338 ACACTTCTTCTGGGGCTTCTGGG - Intergenic
1018426003 6:163681348-163681370 GCATTTGTGCTCAGGCTTCTGGG + Intergenic
1020892193 7:13892453-13892475 GGAGTTCTGCTGAGGGATCTAGG - Exonic
1021256749 7:18401569-18401591 CCAGTTCTGCTGAGGCATTGAGG - Intronic
1022520716 7:31005254-31005276 CCTCTTCTGCAGAGGATTCTGGG + Intergenic
1024157203 7:46638031-46638053 CCAGTTCTGCCAGGGCTCCTAGG - Intergenic
1025958214 7:66198893-66198915 ACAGTTCTCTTGAAGCTTCTGGG - Intergenic
1028367587 7:90052107-90052129 GCAGTTCTGCTTAGGCTTCTAGG - Intergenic
1030871938 7:114766229-114766251 ACCGTTCAGCAGAGGCTTCTGGG - Intergenic
1031657758 7:124379617-124379639 CCTGTGGTGCTGAGGCTTCCTGG - Intergenic
1032432973 7:131878017-131878039 ACAGTTCCGCTAAAGCTTCTGGG - Intergenic
1033250021 7:139750558-139750580 GCAGTTCTGCTGAGTGTTTTGGG + Intronic
1034958765 7:155351412-155351434 CCATTTCTGCTGAGGCCACATGG + Intergenic
1034994862 7:155571106-155571128 CCAGGTGGGCTGAGGCTGCTGGG - Intergenic
1035067036 7:156113639-156113661 CAAGTCCTCCTGAGCCTTCTGGG - Intergenic
1035343756 7:158183842-158183864 CAAGTTCTGGTGTCGCTTCTTGG + Intronic
1035966121 8:4193863-4193885 CCAGTTCTGCTGAGGCTTCTCGG - Intronic
1036500545 8:9310103-9310125 CCTGTTCAGCATAGGCTTCTTGG - Intergenic
1036597397 8:10226280-10226302 CCAGCTCTGCTGTTCCTTCTGGG + Intronic
1036647022 8:10617249-10617271 TCAGATCTGCAGGGGCTTCTCGG - Intronic
1037024511 8:14017161-14017183 CCAGTGCTGCTGAGGCAGCATGG + Intergenic
1037730138 8:21517288-21517310 CCAGCCCAGCTGAGGCTTCAGGG - Intergenic
1038168904 8:25110864-25110886 CCAGTTCTGCTGTGGGTTTTTGG - Intergenic
1038998919 8:32957818-32957840 CCATTTCAGATGAGGCTTTTGGG + Intergenic
1042714922 8:71762195-71762217 CCAATCCTGCTGAGTCATCTAGG + Intergenic
1043581108 8:81716306-81716328 CCAGTACTGCTGTGACTGCTGGG + Intronic
1045732297 8:105256161-105256183 CCATTTTCTCTGAGGCTTCTGGG + Intronic
1047691892 8:127364233-127364255 ACAGTTCATCTCAGGCTTCTAGG + Intergenic
1048021163 8:130540539-130540561 AGAGCTTTGCTGAGGCTTCTTGG - Intergenic
1049036759 8:140082415-140082437 CCCTTTCTGCTGATGCTTCTGGG - Intronic
1049118868 8:140715856-140715878 GCAGTGGTGATGAGGCTTCTTGG - Intronic
1049794740 8:144492002-144492024 CCAGTTATGCTTAGGCTTGGTGG - Intronic
1049935182 9:494699-494721 CCACTTCTGAGAAGGCTTCTTGG - Intronic
1050326670 9:4504546-4504568 CCATTTCTGCTGCCGCTTCTTGG + Intronic
1051036739 9:12756319-12756341 TCAGTTCTACTGAGGCTGTTAGG + Intergenic
1051936746 9:22451521-22451543 CCAGTTCTTCTGAGTTTGCTAGG - Exonic
1056678843 9:88699382-88699404 CCAGCTATGCTGGGGCTGCTGGG + Intergenic
1057900914 9:98947579-98947601 CCAGATCTGGTGGGGCTTCAAGG + Intronic
1058988165 9:110228743-110228765 CAGCTTCTCCTGAGGCTTCTTGG + Intergenic
1059768122 9:117403142-117403164 CCAGACCTGCTGAGGCTCCTGGG - Intronic
1060188851 9:121579633-121579655 CCGGTTCTGCTCAGGGCTCTGGG + Intronic
1060299278 9:122365131-122365153 CCAGCCCTGTTGTGGCTTCTCGG - Intergenic
1060861653 9:126959945-126959967 CTAGTTCTTCTGAGTGTTCTTGG + Intronic
1061025098 9:128043390-128043412 CCAGCTCTGCTGAGGATTGGTGG - Intergenic
1061420562 9:130471079-130471101 GCAGTTCTGCTGAGTGTTGTTGG + Intronic
1062382257 9:136292110-136292132 CCTGCTCTGCTGTGGCATCTGGG - Intronic
1189420983 X:40857455-40857477 CCAGTTCTGCTGAGTCTCTCTGG - Intergenic
1189431011 X:40947368-40947390 GGAGTTCAGCTGGGGCTTCTGGG + Intergenic
1191893662 X:65970948-65970970 CCCATTCTCCTGTGGCTTCTTGG + Intergenic
1191937992 X:66445522-66445544 ACAGTTTTGCTGAGTCTTCCAGG - Intergenic
1195069410 X:101264577-101264599 ACAGTACTTCTGTGGCTTCTTGG - Intergenic
1195765611 X:108293616-108293638 ACAGGTCTGCTGAGGCTACTTGG + Intronic
1198151475 X:133914463-133914485 CCAGTACTGCTTAGACTGCTCGG + Intronic
1199318720 X:146412765-146412787 TCACTTCCGCTGAGGGTTCTTGG + Intergenic
1199952453 X:152716569-152716591 CCAACCCTGCTGAGACTTCTGGG + Intronic
1199957230 X:152751879-152751901 CCAACCCTGCTGAGACTTCTGGG - Intronic
1200698826 Y:6385045-6385067 CTTGTTCTGCTGTGACTTCTTGG - Intergenic
1201035286 Y:9779654-9779676 CTTGTTCTGCTGTGACTTCTTGG + Intergenic
1202261618 Y:22976213-22976235 CCAGTCCAGCTGAGGCTCCCAGG - Intronic
1202414606 Y:24609954-24609976 CCAGTCCAGCTGAGGCTCCCAGG - Intronic
1202456179 Y:25060132-25060154 CCAGTCCAGCTGAGGCTCCCAGG + Intronic