ID: 1035966123

View in Genome Browser
Species Human (GRCh38)
Location 8:4193871-4193893
Sequence GGAGGTGGCCAGTTCTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 655
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 620}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035966123_1035966130 16 Left 1035966123 8:4193871-4193893 CCTCAGCAGAACTGGCCACCTCC 0: 1
1: 0
2: 2
3: 32
4: 620
Right 1035966130 8:4193910-4193932 GGAGAAAGTACAATGTTTAATGG No data
1035966123_1035966128 -5 Left 1035966123 8:4193871-4193893 CCTCAGCAGAACTGGCCACCTCC 0: 1
1: 0
2: 2
3: 32
4: 620
Right 1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG No data
1035966123_1035966135 27 Left 1035966123 8:4193871-4193893 CCTCAGCAGAACTGGCCACCTCC 0: 1
1: 0
2: 2
3: 32
4: 620
Right 1035966135 8:4193921-4193943 AATGTTTAATGGTGGGAGGTGGG No data
1035966123_1035966131 19 Left 1035966123 8:4193871-4193893 CCTCAGCAGAACTGGCCACCTCC 0: 1
1: 0
2: 2
3: 32
4: 620
Right 1035966131 8:4193913-4193935 GAAAGTACAATGTTTAATGGTGG No data
1035966123_1035966125 -9 Left 1035966123 8:4193871-4193893 CCTCAGCAGAACTGGCCACCTCC 0: 1
1: 0
2: 2
3: 32
4: 620
Right 1035966125 8:4193885-4193907 GCCACCTCCACGAAGGAAAGCGG No data
1035966123_1035966136 28 Left 1035966123 8:4193871-4193893 CCTCAGCAGAACTGGCCACCTCC 0: 1
1: 0
2: 2
3: 32
4: 620
Right 1035966136 8:4193922-4193944 ATGTTTAATGGTGGGAGGTGGGG No data
1035966123_1035966132 20 Left 1035966123 8:4193871-4193893 CCTCAGCAGAACTGGCCACCTCC 0: 1
1: 0
2: 2
3: 32
4: 620
Right 1035966132 8:4193914-4193936 AAAGTACAATGTTTAATGGTGGG No data
1035966123_1035966133 23 Left 1035966123 8:4193871-4193893 CCTCAGCAGAACTGGCCACCTCC 0: 1
1: 0
2: 2
3: 32
4: 620
Right 1035966133 8:4193917-4193939 GTACAATGTTTAATGGTGGGAGG No data
1035966123_1035966134 26 Left 1035966123 8:4193871-4193893 CCTCAGCAGAACTGGCCACCTCC 0: 1
1: 0
2: 2
3: 32
4: 620
Right 1035966134 8:4193920-4193942 CAATGTTTAATGGTGGGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035966123 Original CRISPR GGAGGTGGCCAGTTCTGCTG AGG (reversed) Intronic
900418332 1:2545167-2545189 GGGGGTGGCCAGGTAGGCTGTGG - Intergenic
900830017 1:4959287-4959309 GGATGTGGACAGATCTCCTGGGG + Intergenic
900944588 1:5822675-5822697 GGTGGTGGCCAGACCTGCTCTGG - Intergenic
901019173 1:6247286-6247308 GCAGCTGGCCAGCCCTGCTGTGG + Intergenic
901419920 1:9143981-9144003 GGAGGTGGGCAGATCACCTGAGG - Intergenic
901450708 1:9335267-9335289 TGAGGTGGCCAGATCACCTGAGG + Intronic
901648993 1:10732694-10732716 GGAGGTGGCCCCTTCTGCCTTGG + Intronic
901725249 1:11236741-11236763 CGAGGTGGCCAGATCACCTGGGG - Intronic
901911341 1:12460952-12460974 GCAGGTCAGCAGTTCTGCTGTGG + Intronic
901956817 1:12792252-12792274 TGAGGTGGGCAGATCTCCTGAGG - Intronic
902021107 1:13346273-13346295 TGAGGTGGGCAGATCTCCTGAGG + Intronic
902223229 1:14980119-14980141 GGAGGTGGGCAGATCACCTGAGG - Intronic
902797420 1:18808588-18808610 GGAGGTGACAAGGTCTTCTGGGG - Intergenic
902920500 1:19663923-19663945 GGAGGTGGGCAGATCACCTGAGG - Intergenic
902969473 1:20036895-20036917 TGAGGTGGGCAGGTCAGCTGAGG - Intronic
903261976 1:22136431-22136453 GGCTCTGGACAGTTCTGCTGGGG - Intronic
903382312 1:22905858-22905880 GGAGTTGCCCAGTTCTTATGGGG + Intronic
903724008 1:25427623-25427645 GGAGATGGGCAGTCCTGCTCTGG + Intronic
903789442 1:25882458-25882480 GTATGTAGCCAGTCCTGCTGAGG - Intergenic
904183951 1:28688050-28688072 GGAGGTGGGCAGATCACCTGAGG + Intronic
904194714 1:28776490-28776512 GGAGGTGGCCGGATCACCTGAGG - Intergenic
904231274 1:29075243-29075265 CGAGGTGGGCAGATCTCCTGAGG + Intronic
905065242 1:35175332-35175354 CGAGGTGGGCAGTTCACCTGAGG + Intergenic
905195916 1:36277199-36277221 AGAGGTGGGCAGATCTCCTGAGG - Intronic
905243027 1:36593492-36593514 CGAGGTGGGCAGATCTCCTGAGG + Intergenic
905555185 1:38876958-38876980 CGAGGTGGCCAGATCATCTGAGG - Intronic
905762782 1:40574172-40574194 GGAGGTGGGCAGATCACCTGAGG + Intergenic
905795059 1:40811237-40811259 GGAGGGGGAAAGCTCTGCTGGGG - Intronic
905894088 1:41534102-41534124 GGTGGTGGCCAGGGCTGGTGGGG - Intronic
906043190 1:42805410-42805432 GGAGGGGCCCACATCTGCTGAGG - Intergenic
906096939 1:43230314-43230336 GGAGGCTGCCAGTTTGGCTGAGG - Intronic
906286485 1:44591183-44591205 GGAGGTGGACAGATCATCTGAGG - Intronic
906327585 1:44857295-44857317 TGAGGTGGGCAGTTCTCCTGAGG + Intronic
906466277 1:46082830-46082852 GGAGGCGGACAGATCAGCTGAGG + Intronic
906496426 1:46307275-46307297 TGAGGTGGCCAGATCACCTGAGG - Intronic
906711025 1:47930081-47930103 GGAGGTGCCCAGTTCTGGAGTGG + Intronic
906944099 1:50280937-50280959 GGACATGGCCAGGTCTGCTCTGG - Intergenic
907046199 1:51301810-51301832 GGAGGAGTCCCGGTCTGCTGTGG - Intronic
907094370 1:51763236-51763258 GGAGGTGGACAGATCACCTGAGG - Intronic
907499005 1:54864932-54864954 GGAAGTGGCTAGTTCTGCCTAGG - Intronic
908308189 1:62846942-62846964 CGAGGTGGCCAGATCACCTGAGG + Intronic
908322446 1:62991464-62991486 TGAGGTGGCCAATTCAGCAGAGG - Intergenic
909411360 1:75355977-75355999 GGAGGTGGGCAGATCATCTGAGG + Intronic
910670598 1:89769176-89769198 GAAGCTGGCCAGTTGTGTTGAGG + Intronic
910804175 1:91173996-91174018 GTAGGGAGCCACTTCTGCTGGGG + Intergenic
911632086 1:100194576-100194598 CGAGGTGGCCAGATCACCTGAGG - Exonic
912769632 1:112451855-112451877 GGAGGTGGCAGGTACTGCAGAGG - Intronic
913223127 1:116675322-116675344 GGAGGTGGCTATTTTTGATGGGG + Intergenic
913231061 1:116741091-116741113 GGATGTGGCCTCTTCTGCTAGGG + Intergenic
913578901 1:120206607-120206629 GGAGGTGGGCAGATCACCTGAGG - Intergenic
913629272 1:120691762-120691784 GGAGGTGGGCAGATCACCTGAGG + Intergenic
913681948 1:121194447-121194469 GGAGGTGGGCAGATCACCTGAGG + Intronic
914033785 1:143982071-143982093 GGAGGTGGGCAGATCACCTGAGG + Intergenic
914155662 1:145085901-145085923 GGAGGTGGGCAGATCACCTGAGG - Intronic
914196691 1:145451499-145451521 GGAGGGGGCTGGGTCTGCTGTGG - Intergenic
914612004 1:149312168-149312190 GGAGGTGGGCAGATCACCTGAGG + Intergenic
915038564 1:152948756-152948778 GGTGGGGGGCAGTACTGCTGAGG - Intergenic
916081357 1:161234905-161234927 GGAGGTGGGCAGATCGCCTGAGG + Intronic
916220383 1:162438213-162438235 GGAGGTGGGCAGATCACCTGAGG + Intergenic
916494504 1:165333389-165333411 GGAGGTGGGCAGATCACCTGAGG - Intronic
916757343 1:167785397-167785419 GGAAGTGGCAAGGTCTGTTGAGG + Intronic
916766991 1:167870558-167870580 CGAGGTGGGCGGATCTGCTGAGG + Intronic
916774479 1:167946186-167946208 TGAGGTGGCCAGATCACCTGAGG - Intronic
917855010 1:179092612-179092634 GGAGGCGGGCAGATCAGCTGAGG + Intronic
918709567 1:187710097-187710119 CGAGGTGGGCAGGTCAGCTGAGG + Intergenic
919182590 1:194104381-194104403 GGTGGGAGCCAGTTGTGCTGTGG + Intergenic
919802426 1:201361743-201361765 GGAGTTGGCCCGACCTGCTGGGG + Intronic
920150236 1:203900408-203900430 GCCGGTGGCCAGCACTGCTGGGG - Intergenic
920224920 1:204431584-204431606 GGAGGTGGTCAGGGCTGCAGGGG - Intronic
920328893 1:205190390-205190412 GGAGGTGGGCAGATCACCTGAGG + Intronic
920469264 1:206212956-206212978 GGAGGTGGGCAGATCACCTGAGG + Intronic
921377276 1:214487391-214487413 TGAGGTGGGCAGATCAGCTGAGG + Intronic
921380897 1:214523705-214523727 GTTGGTGGCCAGTACTCCTGGGG - Intronic
921531686 1:216290749-216290771 GGAGATGGCAAGTTCTGTTGTGG - Intronic
922184514 1:223262238-223262260 TGGTGTGGACAGTTCTGCTGTGG - Intronic
922574445 1:226652684-226652706 GCAGGTGGCCAGCTCTGCCCTGG - Intronic
923393401 1:233536123-233536145 GGCTTTGGCCAGGTCTGCTGAGG + Intergenic
924227735 1:241935819-241935841 CGAGGTGGGCAGTTCACCTGAGG + Intergenic
924236206 1:242001379-242001401 GGAGGTGGGCAGATCACCTGAGG + Intergenic
924485400 1:244478793-244478815 GGAGGTGGGCAGATCACCTGAGG + Intronic
924550683 1:245073366-245073388 CGAGGTGGCCAGATCACCTGAGG - Intronic
924605730 1:245533207-245533229 GAAAATGGCCAGTGCTGCTGTGG - Intronic
1062854632 10:773827-773849 GATGGTGGCAGGTTCTGCTGGGG + Intergenic
1063095755 10:2907478-2907500 GGAAGTGGGCAGATCTGCAGAGG - Intergenic
1063267720 10:4473027-4473049 TGAGGTGGGCAGATCTTCTGAGG - Intergenic
1063429663 10:5977551-5977573 GGAGGTGGCGAGCGCTGCTCTGG + Exonic
1063993410 10:11592102-11592124 TGAGGTGGCCAGATCACCTGAGG - Intronic
1064271918 10:13872941-13872963 GGAGGGGGGCAGATCAGCTGAGG + Intronic
1064280344 10:13945746-13945768 GGAGGTGGCAAGATTTCCTGGGG - Intronic
1064934392 10:20663729-20663751 TGAGGTGGCCAGATCACCTGAGG - Intergenic
1065346332 10:24751333-24751355 CGAGGTGGCCAGATCACCTGAGG - Intergenic
1065914352 10:30340684-30340706 GGAGGTGGGCAGATCACCTGAGG + Intronic
1066496216 10:35944759-35944781 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1067375007 10:45719868-45719890 GGAGGTGGCCTGTTCAGTGGGGG - Intergenic
1067378720 10:45752653-45752675 GGAGGTGGCCTGTTCAGTGGCGG + Exonic
1067464568 10:46488000-46488022 GGAGGTCCCCAGTGCTTCTGGGG + Intergenic
1067622627 10:47896653-47896675 GGAGGTCCCCAGTGCTTCTGGGG - Intergenic
1067882821 10:50061509-50061531 GGAGGTGGCCTGTTCAGTGGGGG - Intergenic
1067886419 10:50093333-50093355 GGAGGTGGCCTGTTCAGTGGGGG + Exonic
1069180233 10:65350143-65350165 GGAGGGGGGCAGATCTCCTGAGG + Intergenic
1069373154 10:67768017-67768039 GGAGGTGGGCGGATCAGCTGAGG + Intergenic
1070295963 10:75161802-75161824 CGAGGTGGCCAGGTCACCTGAGG + Intronic
1070549636 10:77480875-77480897 GGAGGTGGGCAGATCACCTGAGG + Intronic
1070761021 10:79024501-79024523 GGATGAGGCCAGGTCTGGTGTGG + Intergenic
1070900025 10:80020527-80020549 TGAGGTGGGCAGATCTCCTGAGG - Intergenic
1070901233 10:80030554-80030576 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1071702762 10:87958877-87958899 TGAGGTGGGCAGATCAGCTGAGG + Intronic
1072202237 10:93170864-93170886 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1072587704 10:96797430-96797452 CGAGGTGGACAGATCTCCTGAGG - Intergenic
1072653672 10:97315567-97315589 TGAGGTGGGCAGATCAGCTGAGG - Intergenic
1072667235 10:97402702-97402724 GGAGGTGGGCAGATCACCTGAGG - Intronic
1073031450 10:100529439-100529461 GGCGGCGGCCCGTTCTTCTGGGG + Exonic
1073264333 10:102215917-102215939 GGAGGTGGGCAGATCATCTGAGG - Intergenic
1073296596 10:102443463-102443485 CGAGGTGGGCAGTTCACCTGAGG - Intergenic
1073576729 10:104632031-104632053 GGAAGAGGTCAGTTCTGCTTGGG + Intergenic
1073701156 10:105928256-105928278 CGAGGTGGGCAGATCTCCTGAGG + Intergenic
1073706319 10:105988470-105988492 TGAGGTGGGCAGATCAGCTGAGG + Intergenic
1074978570 10:118600694-118600716 TTAGGTGGCCAGTCCTGGTGTGG - Intergenic
1075001957 10:118805254-118805276 GGATCTGCCCAGGTCTGCTGGGG + Intergenic
1075257514 10:120937427-120937449 GGAGGTGACCAGTAATGTTGAGG + Intergenic
1076450535 10:130554179-130554201 GCAGGTGGCCAGTGCTGGGGTGG + Intergenic
1076878438 10:133228499-133228521 TGAGGTGGGCAGATCTCCTGAGG - Intergenic
1077539018 11:3138025-3138047 GGAAGTGGCCTGCACTGCTGAGG + Intronic
1078045129 11:7906663-7906685 GCAGGTAGGCAGCTCTGCTGGGG + Intergenic
1078549343 11:12269641-12269663 GGAGCTGCTCAGCTCTGCTGAGG + Intergenic
1079010613 11:16825219-16825241 GGAGGTGGTCAGTGCTCCTAGGG - Intronic
1079049322 11:17139454-17139476 GGAGGTGGGCAGATCACCTGAGG - Intronic
1079253552 11:18806672-18806694 TGAGGTGGCCAGATCACCTGAGG - Intergenic
1079796300 11:24807228-24807250 GGAGGTGGGCAGATCACCTGAGG + Intronic
1079938166 11:26643521-26643543 TGAGGTGGGCAGTTCACCTGAGG + Intronic
1080547721 11:33337586-33337608 GGAGGTGGGCAGTTCTCTTGAGG - Intronic
1081351302 11:42055637-42055659 CGAGGTGGGCAGATCTCCTGGGG + Intergenic
1081446273 11:43134160-43134182 TGAGATGGGCATTTCTGCTGAGG + Intergenic
1081620538 11:44616770-44616792 GGAGGTGGCGTGTGCTGCTGGGG + Intronic
1084132957 11:67151581-67151603 GGAGGTGGGCAGATCACCTGAGG - Intronic
1084264999 11:68000430-68000452 GGAGGTGGGCAGATCACCTGAGG + Intronic
1084265087 11:68000960-68000982 GGAGGTGGGCAGATCACCTGAGG + Intronic
1084454270 11:69258501-69258523 ACAGGGGGCCAGTTCTCCTGGGG - Intergenic
1084753435 11:71219656-71219678 TGAGGTGGGCAGATCAGCTGAGG + Intronic
1084758972 11:71256312-71256334 GCAGGTGAACAGTCCTGCTGGGG + Intergenic
1084785803 11:71441000-71441022 GAAGATGGCCAGGTCAGCTGTGG - Intronic
1085119894 11:73960412-73960434 AGAGGTGGGCAGATCAGCTGAGG - Intronic
1085146246 11:74200613-74200635 CGAGGTGGGCAGATCAGCTGAGG - Intronic
1088896660 11:114083621-114083643 GGGGTTGCCCTGTTCTGCTGTGG + Intronic
1089197856 11:116705476-116705498 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1089883301 11:121795376-121795398 GGAGGTTGCCAGCTTTGCTAAGG - Intergenic
1090126975 11:124096590-124096612 GGAGATGGGCAGTTCTCCAGCGG + Intergenic
1090737757 11:129625820-129625842 GGAGGCTGGCAGTACTGCTGAGG - Intergenic
1090945796 11:131428516-131428538 GGAGGTGGCCAGGTCCATTGAGG - Intronic
1090964412 11:131585467-131585489 GGAGGAGTTCAGTCCTGCTGGGG - Intronic
1091299749 11:134500030-134500052 GGAGGTCTCCAGAGCTGCTGGGG + Intergenic
1091321658 11:134656517-134656539 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321670 11:134656573-134656595 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321684 11:134656629-134656651 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321698 11:134656685-134656707 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321706 11:134656713-134656735 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321714 11:134656741-134656763 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321730 11:134656797-134656819 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321738 11:134656825-134656847 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321754 11:134656881-134656903 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091321786 11:134657021-134657043 GGAGGTGCCCGGCTGTGCTGTGG + Intergenic
1091769500 12:3141851-3141873 GGAGGTGACTTGTTCTGATGTGG - Intronic
1091806959 12:3363794-3363816 GGAGGTGGCCACTTTAGATGGGG + Intergenic
1092363090 12:7854747-7854769 CGAGGTGGGCAGATCAGCTGAGG - Intronic
1092365030 12:7870894-7870916 GGATGTGGCCCCTTGTGCTGTGG - Intronic
1094311644 12:29090678-29090700 TGAGGTGGCCAGATCCCCTGAGG + Intergenic
1095418032 12:41997088-41997110 GGATGGGGGCAGTTCTGCTTTGG - Intergenic
1096219035 12:49816279-49816301 GGAGATCACCAGTTCTGCAGGGG - Intronic
1096283556 12:50278041-50278063 CGAGGTGGGCAGATCTCCTGAGG + Intronic
1096471310 12:51878344-51878366 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1097468731 12:59961117-59961139 GGAGGAAGCCAGTACTCCTGGGG + Intergenic
1097468767 12:59961597-59961619 GGAGGAAGCCAGTGCTCCTGGGG - Intergenic
1100231149 12:92609354-92609376 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1101014510 12:100485764-100485786 CGAGGTGGGCAGATCAGCTGAGG - Intronic
1101378244 12:104189606-104189628 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1101627858 12:106462878-106462900 GGAGATAGTCAATTCTGCTGGGG - Intronic
1102327096 12:111995503-111995525 GGAGGTGGGCAGATCACCTGAGG + Intronic
1102370245 12:112376878-112376900 GGAGGTGGGCAGATCACCTGAGG + Intronic
1103298730 12:119910432-119910454 GGAGGTGGGCAGATCGCCTGAGG + Intergenic
1103398176 12:120624020-120624042 GAAGGTGGGCAGTTCTGCTGTGG - Intergenic
1103489518 12:121305999-121306021 TGAGGTGGGCAGATCTCCTGAGG - Intergenic
1103598858 12:122041335-122041357 GCAGGTGCCCAGGTCTGTTGGGG + Intronic
1103932916 12:124460046-124460068 GGAGGTGGACCGCCCTGCTGCGG - Intronic
1104039956 12:125123242-125123264 GGAGGTGGTCACTGCTGCTCAGG + Intronic
1104181581 12:126386699-126386721 AGAGGTGGGCAGTTCACCTGAGG + Intergenic
1104304072 12:127593532-127593554 TGAGGTGGACAGATCAGCTGAGG + Intergenic
1105004708 12:132714248-132714270 TGAGGTGGCCAGATCAACTGAGG - Intronic
1105011546 12:132760338-132760360 GCAGGTCGTCAGTTCTGCAGTGG + Intronic
1106472013 13:30064557-30064579 CGAGGTGGGCAGATCTCCTGAGG + Intergenic
1106514938 13:30445253-30445275 CGAGGTGGGCAGATCTCCTGAGG - Intergenic
1106845838 13:33736935-33736957 GCAGGTTGCCACTGCTGCTGGGG - Intergenic
1108671102 13:52689734-52689756 GGAGGTGGGCAGATCACCTGAGG + Intronic
1109375868 13:61492116-61492138 TGAGGTGGGCAGATCAGCTGAGG + Intergenic
1111787989 13:92815678-92815700 GGTGGTGGCCAGGACTCCTGTGG + Intronic
1112137831 13:96602561-96602583 AGATGTGGCCAGTGCTGCTCTGG + Intronic
1112447568 13:99478933-99478955 CGAGGTGGGCAGATCAGCTGAGG + Intergenic
1112481202 13:99777109-99777131 GGAGGTGGGCAGATCACCTGAGG - Intronic
1112493658 13:99888515-99888537 CGAGGTGGGCAGATCAGCTGAGG + Intronic
1112515486 13:100049584-100049606 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1113407407 13:110054408-110054430 GGAGGTGGCAAGGTTTGCAGTGG - Intergenic
1113766705 13:112886013-112886035 GGGTGTGGCCAGTCCTGCTGTGG - Exonic
1113834792 13:113321706-113321728 GAAGGTGGCCAGTTTGGCTCTGG + Exonic
1114256466 14:21006503-21006525 TGAGGTGGCCAGATCACCTGAGG - Intergenic
1114395473 14:22355113-22355135 CGAGGTGGCCAGATCTCCTGAGG + Intergenic
1115763335 14:36597608-36597630 GGAGGTGGGCAGCTGGGCTGTGG + Intergenic
1115822100 14:37223731-37223753 CGAGGTGGGCAGATCTCCTGAGG - Intronic
1117271858 14:54152536-54152558 TGAGGTGGGCAGATCTCCTGAGG + Intergenic
1117717374 14:58594810-58594832 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1117986133 14:61387913-61387935 TGAGGTGGACAGATCTCCTGAGG + Intronic
1118243454 14:64084154-64084176 CGAGGTGGGCAGATCAGCTGAGG - Intronic
1119708224 14:76800736-76800758 TGAGGTGGGCAGATCTCCTGAGG + Intronic
1120960928 14:90124157-90124179 GGAGACGCACAGTTCTGCTGCGG - Intronic
1121529105 14:94640215-94640237 CGAGGTGGGCAGATCTCCTGAGG + Intergenic
1121918459 14:97857807-97857829 GGAGATGCCCAGCTCTGCAGGGG + Intergenic
1121966731 14:98313953-98313975 TGAGGTGGGCAGTTCACCTGTGG - Intergenic
1122564139 14:102639763-102639785 TGAGGTGGGCAGATCTTCTGAGG - Intronic
1122714151 14:103683710-103683732 GCAGGTCGCCAGCTCTGCTGGGG + Intronic
1122816807 14:104318109-104318131 AGCTGTGGCCAGTGCTGCTGGGG + Intergenic
1122894256 14:104748184-104748206 CAAGGTGGCTAGTGCTGCTGAGG - Intergenic
1202837005 14_GL000009v2_random:85819-85841 GGCGGTGGCCACTCATGCTGTGG - Intergenic
1124786464 15:32685792-32685814 GTAGGTGGCCAGTACGTCTGTGG + Intronic
1124936405 15:34176140-34176162 GGAGGTGGGCAGGTCACCTGAGG + Intronic
1125337799 15:38644624-38644646 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1128076992 15:64833374-64833396 CGAGGTGGCCAGATCACCTGAGG - Intergenic
1128327952 15:66737347-66737369 TGGGGTGGCCAGCTCTGCTGTGG - Intronic
1128641628 15:69342636-69342658 GGAGGTGGTGAGGACTGCTGGGG + Intronic
1128653446 15:69438563-69438585 TGAGGTGGCCAGATCATCTGAGG + Intronic
1129451213 15:75652300-75652322 GGAGGTGGCCAGGCCTGCTGGGG + Intronic
1129636101 15:77320101-77320123 GGAGGCAGCCAGTTCTGCCTAGG - Intronic
1129726978 15:77906335-77906357 GGAGGTGGTCATTTCTGGGGAGG + Intergenic
1130344016 15:83025119-83025141 GGAGGTGGGCAGATCACCTGAGG + Intronic
1130914674 15:88295577-88295599 GAAGGTGAACAGGTCTGCTGGGG - Intergenic
1131235797 15:90696071-90696093 GGAGGTGGGCAGGTCACCTGAGG - Intergenic
1131704364 15:94976612-94976634 CGAGGTGGGCAGTTCACCTGAGG - Intergenic
1132253818 15:100356332-100356354 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1132497888 16:272501-272523 GGAGGTTGCTGGATCTGCTGAGG + Intronic
1132780693 16:1623248-1623270 GGAGGTGGCCTGCTCCTCTGAGG + Intronic
1132883830 16:2173739-2173761 GCAGGTGGGCAGGGCTGCTGTGG - Intronic
1132974940 16:2706526-2706548 GGCGCTGGCCAATGCTGCTGAGG - Intronic
1133915481 16:10105672-10105694 TGAGGTGGGCAGATCTCCTGAGG + Intronic
1134232809 16:12442010-12442032 TGAGGTGGCCAGATCACCTGAGG - Intronic
1134458869 16:14414675-14414697 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1135108416 16:19671234-19671256 GGAGGTGGACAGATCACCTGAGG + Intronic
1135551898 16:23405014-23405036 GGAGGAGGACAGTTCTGCAAAGG + Intronic
1136250490 16:29001305-29001327 CGAGGTGGGCAGATCAGCTGAGG + Intergenic
1136579150 16:31141620-31141642 GGAGGTGGCCACCTCAGTTGGGG + Intronic
1136580646 16:31149124-31149146 GGAGGTGGCCACATCTGCGGGGG - Exonic
1137030938 16:35523556-35523578 GGAGCTGTCCAGTGCTACTGAGG - Intergenic
1137250776 16:46739071-46739093 TGAGGTGGGCAGATCAGCTGAGG - Intronic
1137763538 16:50960114-50960136 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1138516306 16:57536886-57536908 CGCGGTGGCCGTTTCTGCTGGGG - Intergenic
1138557470 16:57780905-57780927 CGAGGTGGGCAGATCTTCTGAGG - Intronic
1139515515 16:67450330-67450352 GGAGGTGGCTAGTTTGGCTGAGG - Intronic
1139644246 16:68316531-68316553 CGAGGTGGCCAGATCACCTGAGG + Intronic
1139719262 16:68839696-68839718 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1139742127 16:69044427-69044449 GAAGCAGGCCAGTTCTGATGGGG + Intronic
1140096324 16:71878695-71878717 CGAGGTGGCCAGATCACCTGAGG + Intronic
1140322903 16:73971035-73971057 GTTGGTGGCTAATTCTGCTGAGG - Intergenic
1140404766 16:74701393-74701415 GGAGGTGGCCAGATCACCTGAGG + Intergenic
1141379298 16:83561212-83561234 TGAGGTGGGCAGTTCACCTGAGG + Intronic
1141851540 16:86649636-86649658 GGAGGTGGCCAGACCAACTGAGG - Intergenic
1142234194 16:88913987-88914009 GGAAGTGGCCGGTGCAGCTGTGG - Intronic
1142254011 16:89005423-89005445 GGAGGAGGCCATTCCTGCTGAGG + Intergenic
1142257652 16:89022572-89022594 AGAGGTGGCCTGTGGTGCTGGGG - Intergenic
1142344410 16:89544931-89544953 GCCGGTGGGCAGGTCTGCTGGGG - Intronic
1142404033 16:89876556-89876578 GGAGGTGGGCAGATCACCTGAGG + Intronic
1143307777 17:5961208-5961230 AGAGGTGGCCAGCTCTGGTGGGG + Intronic
1143501558 17:7342357-7342379 GGTGGTGGCCAGGTCACCTGTGG + Intronic
1143509038 17:7385130-7385152 GGAGGTGGGCAGATCACCTGAGG + Intronic
1143514554 17:7413322-7413344 GGAGGTGGGCAGAGATGCTGGGG + Intronic
1143569342 17:7745225-7745247 CGAGGTGGCCAGATCACCTGAGG - Intronic
1145118710 17:20236152-20236174 GGAGGGGGGCTGTTCTCCTGAGG + Intronic
1145984945 17:29039517-29039539 GGAGCTGTCCAGTTGTGATGTGG + Intronic
1146265122 17:31447753-31447775 GGAGGTGGGCAGATCACCTGAGG - Intronic
1146693618 17:34893006-34893028 GGTGGTGGCCAGTTGCACTGAGG - Intergenic
1146944945 17:36867093-36867115 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1147016335 17:37494649-37494671 AGAGGTGGGCAGTTCACCTGAGG + Intronic
1147344310 17:39778568-39778590 GGAGGTGGGCAGATCACCTGAGG + Intronic
1147348247 17:39819473-39819495 GGATGTGGTCATTTGTGCTGAGG - Intronic
1147456478 17:40541476-40541498 GGAGGTGGCCTGAGATGCTGAGG + Intergenic
1147525013 17:41214160-41214182 CGAGGTGGGCAGATCTCCTGAGG - Intronic
1147561650 17:41513031-41513053 GGATGGGGCCAGCTCTGCAGGGG + Intergenic
1147721482 17:42542428-42542450 TGAGGTGGGCAGTTCACCTGAGG - Intronic
1148024737 17:44578910-44578932 TGAGGTGGCCAGATCACCTGAGG - Intergenic
1148029255 17:44608528-44608550 GGAGGGGGCCAGGAATGCTGGGG - Intergenic
1148351739 17:46946201-46946223 CGAGGTGGGCAGATCTCCTGAGG + Intronic
1148609707 17:48956543-48956565 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1149800425 17:59562505-59562527 TGAGGTGGCCAGATCACCTGAGG - Intergenic
1150055624 17:62012560-62012582 CGAGGTGGGCAGATCTCCTGAGG - Intronic
1150485577 17:65541108-65541130 GGAGGTGGGCAGATCACCTGAGG - Intronic
1151394321 17:73811647-73811669 GAAGGTTGCCAGGGCTGCTGAGG + Intergenic
1151786118 17:76275864-76275886 GCAGCTGGCCATTGCTGCTGAGG + Exonic
1152415364 17:80156959-80156981 TGAGGTGGGCAGATCTCCTGAGG - Intergenic
1152631151 17:81411222-81411244 GGGGGTGGCGAGTCCTCCTGGGG - Intronic
1152651822 17:81498323-81498345 GGAAGTGGGCAGATCAGCTGAGG + Intergenic
1152692805 17:81728057-81728079 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1152773772 17:82187513-82187535 GGAGGTGGCCGGGGCTGGTGGGG + Intronic
1152858042 17:82677449-82677471 GGAGGTGGCCCATCCTGCAGCGG + Intronic
1153559350 18:6355928-6355950 GGAGGTGACCAACCCTGCTGGGG - Intronic
1154105112 18:11515973-11515995 TGAGGTGGCCAGATCAGTTGAGG + Intergenic
1155767360 18:29652490-29652512 TGAGATGGACAGTTCTGCTCTGG - Intergenic
1156101809 18:33605598-33605620 GGAGCTGCCCAGGTGTGCTGAGG + Intronic
1157588983 18:48824872-48824894 CGAGGTGGCCAGATCACCTGAGG - Intronic
1157727131 18:49973335-49973357 GGAAGTGGCCACTTCTACAGGGG + Intronic
1159489679 18:69115364-69115386 GGAAGTCTCCAATTCTGCTGAGG - Intergenic
1160206955 18:76842517-76842539 CGAGGTGGGCAGCTCAGCTGAGG + Intronic
1160254956 18:77240385-77240407 CAAGGTGGGCAGTTCAGCTGAGG - Intergenic
1160448728 18:78947369-78947391 TGTGGTGGCCACTGCTGCTGTGG - Intergenic
1160670083 19:357906-357928 CGAGGTGGCCAGATCACCTGAGG + Intergenic
1160842722 19:1153768-1153790 GGAGGTGGGCAGATCACCTGAGG - Intronic
1160918532 19:1509010-1509032 TGAGGTGGGCAGATCTCCTGAGG + Intronic
1160982330 19:1822109-1822131 GGAGGAGGCCAGGCCTGCAGGGG + Intronic
1161207888 19:3051326-3051348 GGAGATGGCCATTTCTACTCTGG - Intergenic
1161367661 19:3890174-3890196 GGAGGTGGGCAGATCACCTGAGG - Intronic
1161488817 19:4550594-4550616 GGAGGTGGGCAGATCACCTGAGG - Intronic
1161544002 19:4868752-4868774 GGAGGTGAATATTTCTGCTGAGG + Intergenic
1161956464 19:7498625-7498647 CGAGGTGGGCAGATCTCCTGAGG - Intronic
1162148491 19:8628621-8628643 TGAGGTGGGCAGATCAGCTGAGG - Intergenic
1162326794 19:10004215-10004237 GGAGGTGGGCAGGACTGCTGGGG - Intronic
1162928131 19:13940648-13940670 CGAGGTGGGCAGATCAGCTGAGG + Intronic
1162981734 19:14244841-14244863 CGAGGTGGGCAGATCTCCTGAGG - Intergenic
1163737256 19:18989099-18989121 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1164007774 19:21167088-21167110 TGAGGTGGGCAGATCTCCTGAGG - Intronic
1164621854 19:29700836-29700858 GGAGGGAGGCACTTCTGCTGAGG - Intronic
1165062073 19:33209667-33209689 GCCGTTGGCCAGTTTTGCTGAGG + Intronic
1165223209 19:34334819-34334841 CGAGGCGGCCAGATCTCCTGAGG + Intronic
1165306083 19:35003767-35003789 TGAGGTGGCCAGTGGGGCTGAGG - Intronic
1165700439 19:37933208-37933230 GCAGGAGGCCAGTGCAGCTGGGG - Intronic
1165713644 19:38029829-38029851 CGAGGTGGGCAGTTCACCTGAGG - Intronic
1165744330 19:38221847-38221869 CGAGGTGGCCAGATCACCTGAGG + Intronic
1166365109 19:42274261-42274283 GGAGGTGGGCACTGCTGGTGAGG + Intronic
1166769769 19:45274396-45274418 TGAGGTGGGCAGTTCACCTGAGG + Intronic
1166948146 19:46409608-46409630 AGAGGTGGGCAGATCAGCTGAGG + Intergenic
1167345032 19:48940120-48940142 CGAGGTGGCCAGATCACCTGAGG + Intronic
1167413036 19:49356125-49356147 GGAGGTGGCCAGCCCTGGAGGGG + Intronic
1167475511 19:49698428-49698450 CGAGGTGGCCAGATCACCTGAGG + Intronic
1167757842 19:51424124-51424146 CGAGGTGGGCAGTTCACCTGAGG + Intergenic
1168230769 19:55029867-55029889 AGAGGAGGCCAGTGATGCTGTGG + Intronic
1168639203 19:58019650-58019672 GCAGGAGTCCAGTTCTGCTCAGG - Intergenic
1202635634 1_KI270706v1_random:41531-41553 GGCGGTGGCCACTCATGCTGTGG + Intergenic
925621174 2:5794269-5794291 GGAGGTGGGCAGTTTTCCTCTGG - Intergenic
925912118 2:8580923-8580945 GGAGGTGGGCAGAGCTGCTGAGG + Intergenic
926058719 2:9792081-9792103 GGAGGTGGTCAGTGCTGCCCAGG + Intergenic
926246162 2:11123615-11123637 GGAGCTGCCCTGTCCTGCTGAGG - Intergenic
926717710 2:15938427-15938449 TAAGGTGGCCAGATCTTCTGTGG - Intergenic
928169152 2:28992283-28992305 GGAGGTGGCCAAAGCTGCTATGG - Intronic
928922241 2:36538051-36538073 AGAGATGGGCAGTTCAGCTGAGG - Intronic
930041565 2:47129116-47129138 TGAGGTGCCCTATTCTGCTGTGG + Intronic
930201070 2:48552528-48552550 CGAGGTGGGCAGGTCTCCTGGGG + Intronic
931418584 2:62104399-62104421 GGAGGTGGGCAGATCACCTGAGG + Intronic
931538424 2:63303118-63303140 GGAGGTAGCCAGTTACTCTGAGG - Intronic
931900442 2:66782416-66782438 GGAGGAGGCCATTTCACCTGAGG - Intergenic
932084650 2:68747307-68747329 TGATGTGGCCAGTCCTGCTTGGG - Intronic
933862921 2:86487926-86487948 GCAGGCAGCCAGTCCTGCTGAGG + Intronic
933877980 2:86637950-86637972 TGAGGTGGGCAGATCAGCTGAGG - Intronic
934152648 2:89162850-89162872 GGAGGTGGGCAGATCACCTGAGG + Intergenic
934897676 2:98132722-98132744 GGAGCTGGACATTTCTGCTCTGG + Intronic
935172984 2:100625116-100625138 GGAGGTAGCCAGATCTTCTTGGG + Intergenic
935277168 2:101485038-101485060 GGATGTGGCCAGTTGTGAGGTGG - Intergenic
936121258 2:109747519-109747541 CGAGGTGGGCAGATCTCCTGAGG + Intergenic
936223438 2:110623952-110623974 CGAGGTGGGCAGATCTCCTGAGG - Intergenic
937216816 2:120318283-120318305 GGAGGTGACCACTTCCTCTGGGG + Intergenic
937416258 2:121717328-121717350 GGAGGTGGGCAGATCACCTGAGG + Intergenic
938644386 2:133316090-133316112 GGATGTTGCCAGTTCTCCTTGGG + Intronic
939583462 2:143978922-143978944 GGAGGTGGACTGGACTGCTGGGG - Intronic
939636558 2:144589935-144589957 CGAGGTGGGCAGATCTCCTGAGG - Intergenic
941577278 2:167248717-167248739 GGAGGTTGCCAGTTCAACTTTGG - Exonic
941662484 2:168209442-168209464 GGAGGTGGGCAGATCCCCTGAGG + Intronic
943556648 2:189414022-189414044 GGAGGTGGCCGGATCACCTGAGG - Intergenic
943670950 2:190659697-190659719 GGGGGAGCCCAGGTCTGCTGGGG - Exonic
943748847 2:191490312-191490334 GGAGGTGGGCAGATCACCTGAGG + Intergenic
945034241 2:205690501-205690523 GGAGGTGGGCAGATCACCTGAGG + Intronic
946642725 2:221801736-221801758 CGAGGTGGCCAGATCACCTGAGG + Intergenic
946785507 2:223239355-223239377 CGAGGTGGGCAGATCTCCTGAGG - Intergenic
947089736 2:226496584-226496606 GGAGCTGGCCAGGTTGGCTGTGG - Intergenic
947323640 2:228950685-228950707 TAAGGTGGCCAGTTCTGGTATGG + Intronic
947597523 2:231422795-231422817 GGAGCTGGCCAGAACTGCTCAGG + Intergenic
947918125 2:233847838-233847860 GGATGTGGCCAGTAAGGCTGAGG + Intronic
948084891 2:235239152-235239174 CGAGGTGGCCAGATCACCTGAGG - Intergenic
948223494 2:236291332-236291354 GGAGGTTGGCTTTTCTGCTGGGG + Intergenic
1169288971 20:4332559-4332581 GGAAGTGGGGAGTGCTGCTGTGG + Intergenic
1170484822 20:16805719-16805741 GGGAATGGCCAGTACTGCTGTGG + Intergenic
1170643973 20:18180099-18180121 GGAGGTGGGCAGATCACCTGAGG - Intronic
1170714013 20:18816866-18816888 TGAGGTGGGCAGATCAGCTGAGG - Intronic
1172469670 20:35182741-35182763 TGAGGTGGGCAGTTCACCTGAGG + Intergenic
1172537604 20:35686161-35686183 CGAGGTGACCAGTTCATCTGAGG - Intronic
1173000182 20:39099777-39099799 TGAGGTTGTCAGTTCTGCAGAGG + Intergenic
1173322151 20:41997928-41997950 GGATGTGGCCTCTTCTGTTGGGG + Intergenic
1173595563 20:44256945-44256967 GGAGGAGCGCAGTTCTGCTTGGG - Intronic
1174116170 20:48227860-48227882 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1174139403 20:48402512-48402534 CGAGGTGGGCAGATCAGCTGAGG - Intergenic
1174392659 20:50227357-50227379 TGAGGTGGCCAGATCACCTGAGG + Intergenic
1175379237 20:58551399-58551421 TGAGGTGGGCAGATCAGCTGAGG - Intergenic
1175635689 20:60580701-60580723 GGATGTGGCCACTTCTCCTGGGG + Intergenic
1175683587 20:61009617-61009639 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1175766042 20:61593872-61593894 GGAGGTGCTGGGTTCTGCTGGGG - Intronic
1176235551 20:64051925-64051947 GGGTGTGGCCAGCTGTGCTGAGG + Intronic
1176286618 21:5022246-5022268 GAAGGTGGCCAGGGGTGCTGCGG - Intergenic
1177112972 21:17050514-17050536 GTAAGTGTTCAGTTCTGCTGAGG - Intergenic
1177587546 21:23118077-23118099 GAATGTAGCCAGTTATGCTGTGG - Intergenic
1177631246 21:23731145-23731167 TGAGGTGGGCAGATCAGCTGAGG - Intergenic
1178200885 21:30404215-30404237 GGAGGTGGGCAGATCACCTGAGG - Intronic
1178242170 21:30915508-30915530 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1178285447 21:31321818-31321840 GGAGGTGGACAGATCACCTGAGG + Intronic
1178484283 21:33007513-33007535 GGAGGAGGCTGGCTCTGCTGTGG - Intergenic
1178633903 21:34285922-34285944 TGAGGAGGCCATTTCTGCTGGGG - Intergenic
1179211238 21:39326360-39326382 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1179249996 21:39664510-39664532 GGTGGTGGCCATTTCTGGTCAGG - Exonic
1179389903 21:40978305-40978327 GGAGGTGGACAGATCACCTGAGG + Intergenic
1179416743 21:41204271-41204293 CGAGGTGGCCAGATCACCTGAGG - Intronic
1179799676 21:43805043-43805065 CGAGGTGGCCAGATCACCTGAGG + Exonic
1179870563 21:44241229-44241251 GAAGGTGGCCAGGGGTGCTGCGG + Intergenic
1179887500 21:44320491-44320513 TGAGGTGGCCAGTTCACCTGAGG + Intronic
1180365080 22:11931695-11931717 GGCGGTGGCCACTCATGCTGTGG - Intergenic
1180668693 22:17536014-17536036 TGAGGTGGGCAGTTCACCTGAGG + Intronic
1180856492 22:19049230-19049252 GGAAGCTGCCAGTTCTGCTTGGG + Intronic
1182033574 22:27180058-27180080 GCAGGTGTGCACTTCTGCTGGGG - Intergenic
1182503253 22:30764071-30764093 GGAGGTGGCCAGCTCTGTATCGG - Intronic
1182770778 22:32794752-32794774 GGGGGTGGTCCATTCTGCTGGGG + Intronic
1182775688 22:32829530-32829552 GGAGGCGGGCAGCCCTGCTGCGG - Intronic
1183003755 22:34883120-34883142 GGAGGGGGCTGGTTGTGCTGTGG - Intergenic
1183157657 22:36087479-36087501 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1183716449 22:39535989-39536011 GGAGGTGAGCAGTTCTGGAGAGG + Intergenic
1184073587 22:42162207-42162229 CGAGGTGGGCAGATCAGCTGGGG - Intronic
1184370305 22:44077641-44077663 GGAGGTGGGAAGCTCTGCAGGGG + Intronic
1184373843 22:44099304-44099326 GGTGCTGGGCATTTCTGCTGTGG + Intronic
1185108876 22:48889825-48889847 GGACGTGGACAGATCTTCTGGGG - Intergenic
949553827 3:5135079-5135101 TGAGGTGGGCAGATCAGCTGAGG - Intronic
950648968 3:14395453-14395475 TGAGGTGGCCAGATCACCTGAGG + Intergenic
950677657 3:14564385-14564407 GGAGGTGGCCGGCACTGCCGTGG - Intergenic
951845485 3:27080130-27080152 GGAGGTGGCCAGGTCTTCCAAGG - Intergenic
952534444 3:34295163-34295185 GGAGGTTGCCATTTCTGGAGAGG + Intergenic
953287614 3:41627852-41627874 GGAATTGGCCAGTTATGATGTGG + Intronic
953524483 3:43677314-43677336 TGAGGTGGGCAGATCTCCTGAGG + Intronic
954044761 3:47920201-47920223 GGAGGTGGGCAGATCACCTGAGG - Intronic
954062166 3:48077208-48077230 GGAGGTGGGCAGATCACCTGAGG + Intronic
954084978 3:48237172-48237194 GGAGGTGGGCAGATCACCTGAGG - Intergenic
954225835 3:49180489-49180511 TGAAGTGGCCAGATCTGGTGAGG + Intronic
954309006 3:49750174-49750196 GGAGGTGGTCATTGCAGCTGTGG + Intronic
954313919 3:49790931-49790953 GGAGGGAGGCAGTTCTTCTGGGG - Intronic
954547092 3:51446225-51446247 GGAGGTGGGCAGATCCCCTGAGG - Intronic
954644450 3:52122391-52122413 GGAGCTGGCCAGTGTGGCTGGGG + Exonic
954647930 3:52142890-52142912 GGACATGGCCAGGTCTGCTCTGG - Intronic
954710254 3:52501929-52501951 GGGGTTGGCCAGAGCTGCTGGGG + Intronic
954814916 3:53273014-53273036 GGAGGTGTCCAGTGGAGCTGAGG + Intergenic
956137924 3:66117300-66117322 GGAGGTGGGCAGATCACCTGAGG - Intergenic
956423630 3:69110608-69110630 CGAGGTGGGCGGTTCTCCTGAGG + Intronic
956821564 3:72958862-72958884 GGAGGTGGGCAGATCACCTGAGG - Intronic
958789499 3:98634886-98634908 CGAGGTGGCCAGATCACCTGAGG + Intergenic
961149565 3:124625846-124625868 TGAGGTGGCCAGATCACCTGAGG + Intronic
961576213 3:127838534-127838556 TGAGGTGGGCAGATCTCCTGAGG - Intergenic
962296062 3:134188392-134188414 CGAGGTGGCCAGATCACCTGAGG - Intronic
962430430 3:135313711-135313733 AGAAGTGGCCAGCTCTCCTGGGG - Intergenic
962730589 3:138280134-138280156 CGAGGTGGGCAGATCAGCTGAGG - Intronic
962990614 3:140574000-140574022 GGAGGTGGCCATATCAGCAGAGG - Exonic
963739460 3:149061601-149061623 GGAGGTGGGCAGATCACCTGAGG + Intronic
963989302 3:151634750-151634772 CGAGGTGGCCAGATCACCTGAGG - Intergenic
964557412 3:157954731-157954753 GGAGGTGGCCAGAACAGGTGGGG - Intergenic
965183974 3:165438954-165438976 GGAGGTGGGCAGATCACCTGAGG - Intergenic
965788048 3:172356925-172356947 TGAGATGGCCAGTCCTGATGAGG + Intronic
966322320 3:178714693-178714715 GTAGGTGGGCAGTTTTGCTCTGG + Intronic
966841835 3:184095789-184095811 CGAGGTGGGCAGATCAGCTGAGG + Intergenic
966848186 3:184146653-184146675 TGAGGTGGGCAGATCAGCTGAGG + Intronic
966943317 3:184760347-184760369 GGGGGTGGGGAGTCCTGCTGAGG + Intergenic
966966426 3:184999289-184999311 CGAGGTGGGCAGATCAGCTGAGG - Intronic
967875865 3:194268134-194268156 GGAGGAGGCCAGGCCTGGTGGGG - Intergenic
968731069 4:2269428-2269450 GGGGGTGGCCACTGCTCCTGAGG + Intergenic
968759946 4:2437469-2437491 CCAGGTGGCCAGTGCTGCTGGGG + Intronic
969302995 4:6308301-6308323 GGAGAGCGCCAGTCCTGCTGCGG - Intergenic
969489734 4:7492165-7492187 GGAGGTGGGCAGCCCTGCTCTGG - Intronic
971254825 4:25004684-25004706 AGAGGTGGCCAGCTATGCAGTGG + Intronic
971711557 4:30119608-30119630 GGAGGTGGGCAGATCACCTGAGG + Intergenic
972439664 4:39075097-39075119 TGAGGTGGGCAGATCTCCTGAGG + Intronic
972489138 4:39570389-39570411 TGAGGTGGCCAGATCAGTTGAGG - Intronic
975023465 4:69520331-69520353 GGAGTTGGGAAGTACTGCTGAGG + Intronic
977153815 4:93547942-93547964 CGAGGTGGCCAGATCACCTGAGG + Intronic
977667008 4:99653752-99653774 GGAGGTGGCCAGAGCCCCTGTGG + Exonic
979518622 4:121640703-121640725 CGAGGTGGCCAGATCACCTGAGG + Intergenic
981091724 4:140739221-140739243 GGAGGTGGGCAGATCACCTGAGG - Intronic
981329842 4:143495712-143495734 CGAGGTGGACAGATCTCCTGAGG + Intergenic
982726158 4:158908918-158908940 TGAGGTGGGCAGATCTCCTGAGG - Intronic
984776817 4:183488729-183488751 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1202762955 4_GL000008v2_random:127411-127433 GGCGGTGGCCACTCATGCTGTGG + Intergenic
985672361 5:1213292-1213314 GGAGGGGGCCAGGCCTGTTGGGG - Intronic
987517927 5:18938576-18938598 GGAGGTGGGCAGATCACCTGAGG + Intergenic
987557683 5:19476097-19476119 GGAGGTACCCAGTTTTGCAGAGG + Intronic
987848869 5:23323476-23323498 GGAGGTGGGCAGATCACCTGAGG - Intergenic
987905967 5:24077641-24077663 TGAGGTGGGCAGATCTCCTGAGG - Intronic
988140007 5:27225315-27225337 CGAGGTGGGCAGATCTGTTGAGG - Intergenic
988903402 5:35758771-35758793 CGAGGTGGACAGATCTCCTGAGG + Intronic
989182469 5:38592423-38592445 TGAGGTGGGCAGATCAGCTGAGG + Intronic
989747231 5:44844437-44844459 GGAGGTGGGCAGATCATCTGAGG + Intergenic
989772950 5:45166627-45166649 CGAGGTGGCCAGATCGCCTGAGG + Intergenic
990338259 5:54796187-54796209 GTAGGAGGCCAGATCTTCTGGGG - Intergenic
990475272 5:56156493-56156515 GGGGGTTGCTAGTTCTACTGAGG + Intronic
990982587 5:61615367-61615389 GGAGGTAGGAAGTTATGCTGTGG + Intergenic
993523014 5:88928187-88928209 CAAGGTGGGCAGATCTGCTGAGG - Intergenic
993683421 5:90908081-90908103 GGAGGTGGGCAGATCACCTGAGG - Intronic
993874387 5:93289429-93289451 TGAGGTGGCCAGATCAACTGAGG - Intergenic
995204793 5:109467312-109467334 GGGAGTGGTCAATTCTGCTGAGG - Intergenic
995678456 5:114690234-114690256 TGAAGTGGCAAGTTCTGTTGTGG - Intergenic
995988430 5:118208148-118208170 GCTGGTGGCCAGCACTGCTGGGG + Intergenic
995990995 5:118239701-118239723 AGATGGGGCCAGTTCTGCAGAGG + Intergenic
996191008 5:120541376-120541398 TGAGGTGGGCAGATCAGCTGAGG - Intronic
996336742 5:122391916-122391938 AGAGTTAGCCAGTTTTGCTGGGG - Intronic
996727063 5:126681718-126681740 TGAGGTGGCCAGATCACCTGAGG - Intergenic
996787860 5:127259922-127259944 TGAGGTGGGCAGATCAGCTGAGG + Intergenic
997197418 5:131989227-131989249 TGGGGTGGCCAGTGCTGATGAGG + Intronic
997486174 5:134232686-134232708 GGAGGTGGCCAGCTAAGCTGAGG - Intergenic
997530443 5:134578488-134578510 TGAGGTGGACAGGCCTGCTGAGG - Exonic
997533735 5:134599473-134599495 CGAGGTGGGCAGATCAGCTGAGG - Intergenic
997982543 5:138477908-138477930 GGAGGTGGGCAGATCACCTGAGG + Intergenic
999146398 5:149398672-149398694 GGAGGTGGGCAGATCATCTGAGG + Intronic
999176434 5:149635109-149635131 GGAGCTGGCCTGAGCTGCTGGGG + Intergenic
999333210 5:150692293-150692315 ACAGGTAGCCAGTTCTCCTGTGG - Intronic
999625205 5:153513280-153513302 GGATTTTGACAGTTCTGCTGAGG + Intronic
999896788 5:156042867-156042889 AGAAGAGCCCAGTTCTGCTGAGG - Intronic
1000043733 5:157504481-157504503 TGAGGTGGGCAGTTCACCTGAGG - Intronic
1001133855 5:169086036-169086058 GAGGGTTGCCATTTCTGCTGAGG - Intronic
1001486247 5:172121572-172121594 GGAGGTGGGCAGATCACCTGAGG + Intronic
1001534616 5:172489868-172489890 GGAGCGGGCCAGCTCAGCTGGGG + Intergenic
1001783052 5:174387058-174387080 GGAGGTGTCAAGCTCTCCTGAGG - Intergenic
1002381278 5:178831692-178831714 GGAGGTGGCCGGTACAGCAGTGG - Intergenic
1003513603 6:6801440-6801462 TGAGGTGGGCAGATCGGCTGAGG - Intergenic
1003590614 6:7433570-7433592 GGGAGTGGCCAGTGCTGCTCTGG + Intergenic
1004319198 6:14619399-14619421 AGAGGTGGCCAGGGCTGTTGGGG - Intergenic
1004669953 6:17786364-17786386 CGAGGTGGGCAGATCTCCTGAGG + Intronic
1004964992 6:20838738-20838760 TGAGGTGGGCAGATCAGCTGAGG + Intronic
1006497727 6:34435930-34435952 CGAGGTGGGCAGCTCAGCTGAGG - Intergenic
1006543976 6:34764109-34764131 GGAGGTGGGCAGATCCTCTGAGG + Intronic
1008935444 6:56987210-56987232 GGAGGTGGGCAGATCAGTTGAGG - Intronic
1010966291 6:82213259-82213281 TGAGGTGGGCAGATCTCCTGAGG - Intronic
1012099390 6:95011722-95011744 CGAGGTGGGCAGATCTCCTGAGG - Intergenic
1012494506 6:99819486-99819508 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1012982388 6:105843970-105843992 GGAGGTGGACATTTCTACTGAGG + Intergenic
1015649667 6:135441977-135441999 GGAGCTGGCTACTTCTGCAGAGG + Intronic
1016171059 6:141017504-141017526 CGAGGTGGGCAGTTCACCTGAGG - Intergenic
1017112737 6:150948237-150948259 GGAGGTGGGCAGATCACCTGAGG - Intronic
1018258942 6:161950310-161950332 CGAGGTGGGCAGATCTCCTGAGG + Intronic
1018862892 6:167723979-167724001 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1019283187 7:210802-210824 GGAGGTGGAAAGTGCAGCTGTGG + Intronic
1019783765 7:2960235-2960257 CGAGGTGGGCAGATCAGCTGAGG + Intronic
1020119973 7:5497611-5497633 GGAAGTGGCCGGGTCTGCTCGGG - Intronic
1020146974 7:5652042-5652064 GGAGGTGGGCAATTCTACTTAGG + Intronic
1021331330 7:19342288-19342310 GGAGGTGGCCAGATCACCTGAGG - Intergenic
1021481317 7:21120934-21120956 GGAGGTGGCAAGTTCTCCCGGGG - Intergenic
1021576741 7:22112110-22112132 GAAGGTGGCCACTCATGCTGGGG - Intergenic
1022485384 7:30773581-30773603 GGAGATGGCAGGGTCTGCTGAGG + Intronic
1022666951 7:32419990-32420012 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1023926601 7:44674275-44674297 CGAGGTGGGCAGATCAGCTGAGG - Intronic
1024802981 7:53102475-53102497 TGAGGTGGGCAGATCAGCTGAGG + Intergenic
1024978289 7:55133704-55133726 GGGAGAGGCCAGCTCTGCTGGGG + Intronic
1025142953 7:56480587-56480609 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1025258593 7:57401557-57401579 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1025798495 7:64761953-64761975 CGAGGTGGGCAGATCAGCTGAGG + Intergenic
1026352828 7:69532538-69532560 CGAGGTGGGCAGTTCAACTGAGG + Intergenic
1026776901 7:73236012-73236034 GGAGGTTGTGAGTTCTGCTGGGG + Intergenic
1026905844 7:74062241-74062263 GGAGGAGGCCAGGGCTGCTGGGG - Intronic
1026941171 7:74289005-74289027 GGAGGGGGACAGTGCAGCTGGGG - Intergenic
1027017750 7:74789382-74789404 GGAGGTTGTGAGTTCTGCTGGGG + Intergenic
1027070272 7:75156550-75156572 GGAGGTTGTGAGTTCTGCTGGGG - Intergenic
1027156287 7:75770611-75770633 TGAGGTGGGCAGATCTCCTGAGG - Intronic
1027370398 7:77503568-77503590 TGAGGTGGGCAGTTCACCTGAGG + Intergenic
1029166719 7:98596679-98596701 TGAGGTGGCCAGATCACCTGAGG - Intergenic
1029372443 7:100158266-100158288 GGCGGTTGCCAGTTCTGCCCAGG + Exonic
1029501802 7:100935646-100935668 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1029573039 7:101383900-101383922 CGAGGTGGGCAGATCAGCTGAGG - Intronic
1029747673 7:102525471-102525493 GGATGGGGCCAGTGCAGCTGCGG + Intergenic
1029765624 7:102624561-102624583 GGATGGGGCCAGTGCAGCTGCGG + Intronic
1031121699 7:117729600-117729622 GCAAGTGGTCAGTTCTGGTGCGG + Intronic
1032173297 7:129603553-129603575 GGAGGTGGGCAGATCTCTTGAGG + Intergenic
1032310600 7:130782655-130782677 GGAGGTGGACAGATCACCTGAGG - Intergenic
1033103147 7:138494212-138494234 GGAGGTGGACAGATCACCTGAGG - Intronic
1033258545 7:139822501-139822523 GGAGATGGCCAGATCTGTAGAGG - Intronic
1033587668 7:142786530-142786552 GGAGGTGACCAGCTCTCCAGAGG + Intergenic
1034333410 7:150303755-150303777 GGAGATGTCCAGTTATTCTGGGG + Intronic
1034556268 7:151852260-151852282 GGAGGTGGGCAGATCACCTGAGG + Intronic
1034614549 7:152404400-152404422 CGAGGTGGGCAGATCTTCTGAGG + Intronic
1034695561 7:153050102-153050124 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1035215399 7:157362604-157362626 GGAGGTGGGCAGATCACCTGAGG - Intronic
1035413604 7:158666221-158666243 GGAGGTGGACAGTTGTTCTCTGG - Intronic
1035677380 8:1465039-1465061 GCAGGTGACCAGCTCTGCAGGGG + Intergenic
1035966123 8:4193871-4193893 GGAGGTGGCCAGTTCTGCTGAGG - Intronic
1036206806 8:6811600-6811622 GGATGTGGCCACTTCTGCAGTGG + Exonic
1036413838 8:8528484-8528506 CGAGGTGGGCAGATCAGCTGAGG - Intergenic
1036946640 8:13100527-13100549 GGAGGCTGCCAGTGCTGCTGAGG + Exonic
1037866557 8:22448609-22448631 GGAGGTGGGCAGATCACCTGAGG - Intronic
1039568743 8:38569735-38569757 TGAGGTGGGCAGTTCACCTGAGG + Intergenic
1040558042 8:48498536-48498558 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1040807642 8:51411191-51411213 GGTGGTGGTCAGTTTTTCTGTGG + Intronic
1043051643 8:75393010-75393032 TGAGGTGGGCAGATCAGCTGAGG + Intergenic
1044389321 8:91630341-91630363 AGAGGTGGCCAGCACAGCTGGGG - Intergenic
1044570563 8:93713263-93713285 GGAGGTGGGCAGATCACCTGAGG - Intronic
1045063886 8:98428702-98428724 GCTGGTGGCCAGGTTTGCTGTGG + Exonic
1045323712 8:101101351-101101373 GGAGGGGGCCAGGTCAGGTGGGG - Intergenic
1045443453 8:102238286-102238308 GTAGGAGGCCAGTTTTGCTCAGG - Intronic
1045500988 8:102744219-102744241 CGAGGTGGGCAGATCAGCTGAGG - Intergenic
1045690130 8:104751807-104751829 TGAGGTGGGCAGATCTCCTGAGG - Intronic
1046221803 8:111226591-111226613 CGAGGTGGCCAGATCACCTGAGG - Intergenic
1046629051 8:116605230-116605252 GGAGGTGAGCATGTCTGCTGGGG - Intergenic
1048001630 8:130383951-130383973 GCAGGTGGCCAGTTCTGGAAAGG - Intronic
1049170995 8:141160579-141160601 GGCCGTGGCCAGTGCTGCTGGGG + Intronic
1049511939 8:143032010-143032032 GCAGATGGTGAGTTCTGCTGGGG - Intergenic
1049849846 8:144825002-144825024 CGAGGTGGGCAGATCTCCTGAGG + Intergenic
1051048626 9:12905497-12905519 CGAGGTGGCCAGATCACCTGAGG + Intergenic
1051274214 9:15383489-15383511 GGAGGTGGCTAATTCTGCCTGGG + Intergenic
1051311588 9:15779590-15779612 TGAGGTGGGCAGATCAGCTGAGG - Intronic
1052938864 9:34116123-34116145 GGAGGTGGGCAGATCAACTGAGG + Intronic
1053144959 9:35706006-35706028 CGAGGCAGCCAGTGCTGCTGGGG - Exonic
1053204194 9:36172605-36172627 GGAGGTGGCCAGGGCAGCAGAGG - Intergenic
1055024387 9:71703774-71703796 GGAAAGGGCCAGTTCTCCTGGGG - Intronic
1055531050 9:77184384-77184406 TGAGGTGGCCAGATCAGTTGAGG + Intronic
1056468415 9:86881657-86881679 CGAGGTGGGCAGATCAGCTGAGG + Intergenic
1056558667 9:87710774-87710796 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1056755458 9:89379220-89379242 GGAGGTGGCCTGCACGGCTGGGG + Exonic
1057115213 9:92514505-92514527 TGAGGTGGCCAGATCACCTGAGG - Intronic
1057241873 9:93418340-93418362 TGAGGTGGGCAGATCTCCTGAGG + Intergenic
1057871275 9:98719994-98720016 TGAGGTGGGCAGATCAGCTGAGG + Intergenic
1058904118 9:109467576-109467598 AGAGGTGGGCAGTTGTTCTGTGG + Intronic
1059223037 9:112643943-112643965 GGAGGTGGGCAGATCACCTGGGG + Intronic
1059507065 9:114809175-114809197 CAAGGTGGCCAGGTCAGCTGGGG + Intergenic
1060397425 9:123326003-123326025 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1060583440 9:124771299-124771321 GGAGCTGGCCAGTGCTGAGGGGG - Intronic
1060824518 9:126680218-126680240 GGAGGTGGCCAGGGCAGATGAGG + Intronic
1061011932 9:127960990-127961012 GGAGGTGGCCGCTGCTGCTGTGG - Intronic
1061471252 9:130827660-130827682 TGAGGTGGACAGTTCACCTGCGG + Intronic
1061818494 9:133209616-133209638 GGAGATGGCCAGTTCCCCAGAGG - Intergenic
1062241957 9:135545746-135545768 GGAGATGGCCAGTTCCCCAGAGG + Intergenic
1062284906 9:135768550-135768572 GGAGGTGGGCAGTGCAGCCGGGG - Intronic
1062318164 9:135978262-135978284 GGGGGTGTCCAGGGCTGCTGAGG - Intergenic
1062318224 9:135978432-135978454 GGGGGTGTCCAGGGCTGCTGTGG - Intergenic
1062631677 9:137465860-137465882 GACGGTGGCCACGTCTGCTGGGG + Intronic
1203543718 Un_KI270743v1:112292-112314 GGCGGTGGCCACTCATGCTGTGG + Intergenic
1185591097 X:1277742-1277764 GGAGGTGGGCAGATCACCTGAGG + Intronic
1185734757 X:2488405-2488427 CGAGGTGGGCAGATCAGCTGAGG - Exonic
1186737499 X:12481192-12481214 GGAGCTTGCCAGCCCTGCTGTGG + Intronic
1187303898 X:18077705-18077727 GGAGGTGTCCAGTTAAACTGGGG + Intergenic
1187447236 X:19370627-19370649 CGAGGTGGGCAGATCAGCTGAGG - Intronic
1187806887 X:23130343-23130365 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1189299635 X:39943187-39943209 TGAGGTGGCCAGATCACCTGAGG - Intergenic
1189443007 X:41054329-41054351 CGAGGTGGGCAGATCTCCTGAGG + Intergenic
1190817429 X:53940373-53940395 GGAGGTGACAAGTTGTGGTGTGG + Exonic
1191786570 X:64922792-64922814 TGATGTGGCCAGTGCTACTGAGG + Intronic
1192714814 X:73628122-73628144 TCTGGTGGCCTGTTCTGCTGTGG + Intronic
1192920208 X:75698284-75698306 TGAGGTGGGCAGATCAGCTGAGG + Intergenic
1194474260 X:94338275-94338297 GGAGGTGGGCAGATCACCTGAGG - Intergenic
1195004134 X:100670002-100670024 GGAGGTGGGCAGATCACCTGAGG - Intronic
1195930865 X:110074108-110074130 TGAGGTGGGCAGTTCACCTGAGG - Intronic
1196058769 X:111385421-111385443 GGAGGTGGGCAGATCACCTGAGG + Intronic
1196317409 X:114244457-114244479 CGAGGTGGGCAGTTCACCTGAGG + Intergenic
1198823092 X:140669782-140669804 GGAGGTGGGCAGATCACCTGAGG + Intergenic
1199985999 X:152951186-152951208 TGAGGTGGGCAGTTCACCTGAGG - Intronic
1200062822 X:153491209-153491231 GGAGGTGGCCTCTTATGCAGGGG - Intronic
1200875900 Y:8154670-8154692 TGAGGTGGGCAGATCAGCTGAGG + Intergenic
1201573616 Y:15439126-15439148 GCAGGTGGCACTTTCTGCTGTGG - Intergenic