ID: 1035966128

View in Genome Browser
Species Human (GRCh38)
Location 8:4193889-4193911
Sequence CCTCCACGAAGGAAAGCGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035966119_1035966128 21 Left 1035966119 8:4193845-4193867 CCCATTCATTCTTCAGCACCGAG 0: 1
1: 1
2: 1
3: 19
4: 207
Right 1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG No data
1035966121_1035966128 3 Left 1035966121 8:4193863-4193885 CCGAGAAGCCTCAGCAGAACTGG 0: 1
1: 0
2: 2
3: 26
4: 253
Right 1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG No data
1035966118_1035966128 29 Left 1035966118 8:4193837-4193859 CCGTGTTTCCCATTCATTCTTCA 0: 1
1: 0
2: 5
3: 71
4: 578
Right 1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG No data
1035966123_1035966128 -5 Left 1035966123 8:4193871-4193893 CCTCAGCAGAACTGGCCACCTCC 0: 1
1: 0
2: 2
3: 32
4: 620
Right 1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG No data
1035966120_1035966128 20 Left 1035966120 8:4193846-4193868 CCATTCATTCTTCAGCACCGAGA 0: 1
1: 0
2: 1
3: 10
4: 132
Right 1035966128 8:4193889-4193911 CCTCCACGAAGGAAAGCGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035966128 Original CRISPR CCTCCACGAAGGAAAGCGGC AGG Intronic
No off target data available for this crispr