ID: 1035966636

View in Genome Browser
Species Human (GRCh38)
Location 8:4199282-4199304
Sequence ATTGATATGCAGGCAGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035966633_1035966636 22 Left 1035966633 8:4199237-4199259 CCTATAGTGTGAACACGCTAAAT 0: 1
1: 0
2: 0
3: 1
4: 81
Right 1035966636 8:4199282-4199304 ATTGATATGCAGGCAGTGTATGG No data
1035966632_1035966636 27 Left 1035966632 8:4199232-4199254 CCTAGCCTATAGTGTGAACACGC 0: 1
1: 0
2: 0
3: 3
4: 27
Right 1035966636 8:4199282-4199304 ATTGATATGCAGGCAGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035966636 Original CRISPR ATTGATATGCAGGCAGTGTA TGG Intronic
No off target data available for this crispr