ID: 1035968603

View in Genome Browser
Species Human (GRCh38)
Location 8:4222736-4222758
Sequence CACTCTTTCTGCCCAGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035968599_1035968603 20 Left 1035968599 8:4222693-4222715 CCTCTATCTGGTTCGCTTCTGTA 0: 1
1: 0
2: 0
3: 2
4: 89
Right 1035968603 8:4222736-4222758 CACTCTTTCTGCCCAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035968603 Original CRISPR CACTCTTTCTGCCCAGATGG AGG Intronic
No off target data available for this crispr