ID: 1035968875

View in Genome Browser
Species Human (GRCh38)
Location 8:4225341-4225363
Sequence TGTTAATTACATATTTTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 344}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035968875 Original CRISPR TGTTAATTACATATTTTAGG TGG (reversed) Intronic
901241156 1:7694421-7694443 ATTTAATTTCATATTTTAGGTGG - Intronic
901543362 1:9936646-9936668 TGTTAATTTCATATGGTATGTGG - Intronic
903872056 1:26442985-26443007 TGTTAGTTAGATATCTTGGGTGG + Intronic
905066114 1:35184644-35184666 TGTTAAGTAAATATTTTAGAAGG + Intronic
905784266 1:40740689-40740711 TGTTTTGTTCATATTTTAGGGGG + Intronic
906607143 1:47180560-47180582 TGAAACTTACATGTTTTAGGTGG + Intergenic
908068025 1:60428626-60428648 TGTTAATTATAGAATTTAAGTGG - Intergenic
908148360 1:61272092-61272114 TCATAATTGCATATTTTCGGTGG + Intronic
908709081 1:66994807-66994829 TTTTAATTAAGTATTTAAGGTGG + Intergenic
908944106 1:69473499-69473521 TGTTAATTGAATTTTTTGGGTGG - Intergenic
909497544 1:76295648-76295670 TATTTAATACAAATTTTAGGTGG + Intronic
909666532 1:78140501-78140523 TGCTAATTCCATATGTTAAGGGG + Intergenic
910271434 1:85399468-85399490 TGTTAAATACAAAATATAGGAGG + Intronic
910285999 1:85554943-85554965 TGTTATTTAAATATTTAAGAGGG + Intronic
911140423 1:94495422-94495444 TATTAAGTACATATTTTTGTGGG - Intronic
911277806 1:95883402-95883424 TGTTAATTATAGAATCTAGGTGG - Intergenic
911311940 1:96304139-96304161 TGTTAATAAAATATTTTTGTGGG + Intergenic
912010680 1:104957676-104957698 TTTTAATTTCTAATTTTAGGGGG + Intergenic
912046011 1:105458636-105458658 ATTTAATACCATATTTTAGGAGG + Intergenic
913486730 1:119338626-119338648 TGTTAATTACTTATTTATGTTGG + Intergenic
914929480 1:151918016-151918038 TGTTAAATAAAAATTATAGGAGG + Intergenic
915804851 1:158835595-158835617 TGTTTATTGCCTATTTTTGGTGG + Intronic
917829936 1:178871465-178871487 TATTTATTACATTATTTAGGTGG - Intronic
918188195 1:182146145-182146167 AGTTAATAACAGCTTTTAGGGGG + Intergenic
918671086 1:187217357-187217379 TGTTAAATATAGATTTTAGATGG - Intergenic
918795144 1:188884670-188884692 AATTAATTACATATTTTGGTAGG + Intergenic
920984129 1:210868637-210868659 TGTTAAGAAGATATTTTAGTGGG - Intronic
921350390 1:214228655-214228677 TGTTAAATACAATTTGTAGGAGG - Intergenic
921658803 1:217774627-217774649 TTTTAATTATATAGTTTAGTGGG + Intronic
923030045 1:230242172-230242194 TGTTATTTTCTTATTTTAAGGGG + Intronic
923106903 1:230861398-230861420 TGTTTATTACTTTTTTTGGGGGG - Intronic
923123643 1:231017013-231017035 GGTTATTTACATGTTTTAAGTGG + Intergenic
923132419 1:231088106-231088128 TTTTAATTATATATTTTAGAAGG + Intergenic
923220799 1:231891344-231891366 TGTTAATAGGATATTTGAGGTGG + Intronic
923317832 1:232798707-232798729 TGTTAAATAAAAATTATAGGAGG - Intergenic
923795137 1:237146464-237146486 TGTTATCTACATATTTGAAGTGG - Intronic
924052094 1:240089291-240089313 TGTTAATTATATAATTTACATGG - Intronic
1065453906 10:25886542-25886564 TGTTAGTTACATATTTATAGTGG + Intergenic
1067027414 10:42856535-42856557 TGATAATTACATGTTTAAGTGGG - Intergenic
1067036190 10:42919713-42919735 TGTGTATTACCTATTTTGGGGGG + Intergenic
1067486981 10:46659794-46659816 TGTTATTTAAATATTTTAACAGG - Intergenic
1067607823 10:47682179-47682201 TGTTATTTAAATATTTTAACAGG + Intergenic
1067767455 10:49097758-49097780 TGACAATTTCATATTTTAGGGGG - Intronic
1068013396 10:51482877-51482899 TATTGATTACATATTTTATCTGG - Intronic
1068201036 10:53784455-53784477 TATTAAAAACATATTTTGGGTGG - Intergenic
1069190601 10:65483233-65483255 TGATTTTTACATATTTTTGGTGG - Intergenic
1069195456 10:65545691-65545713 GGTGAATTACATATCTTTGGGGG - Intergenic
1069212970 10:65784675-65784697 TGTGAAGTACATATATTAGGAGG - Intergenic
1071410711 10:85391020-85391042 TGTTATTTAAATATTTTTAGAGG + Intergenic
1071441226 10:85698114-85698136 TGTAAATTTGATATTTTCGGTGG - Intronic
1071623379 10:87143578-87143600 TGTTATTTAAATATTTTAACAGG + Intronic
1072046908 10:91666340-91666362 TGTTAATTGTAGAATTTAGGTGG + Intergenic
1073236850 10:102024091-102024113 TGTTGATTATTTACTTTAGGAGG - Intronic
1073706940 10:105994860-105994882 TGTTACTCAGTTATTTTAGGTGG - Intergenic
1073901012 10:108221146-108221168 TGTAAATTACATTTTTTAAAAGG + Intergenic
1075360152 10:121824449-121824471 TGTTAATTCCATTTTTTTGTAGG + Intronic
1075535599 10:123269463-123269485 TGTGTATTACATTTTTTGGGAGG + Intergenic
1075824235 10:125340795-125340817 TGTTAATTGAGTATTTTTGGTGG - Intergenic
1078561923 11:12379568-12379590 TATTAAAAACATTTTTTAGGGGG - Intronic
1079469632 11:20765961-20765983 TAATAACTCCATATTTTAGGAGG + Intronic
1080824486 11:35836476-35836498 TGATAATGACATAATTTATGTGG + Intergenic
1081786609 11:45752022-45752044 TGTTCATTAAAAATTTTAAGTGG + Intergenic
1082633613 11:55569515-55569537 TGTTAACTAAATATTTGATGAGG + Intergenic
1083440755 11:62674679-62674701 TTTTATTTACTTATTTGAGGTGG - Intergenic
1087628019 11:100619290-100619312 GGTTTCTTACATTTTTTAGGAGG - Intergenic
1088412307 11:109548047-109548069 TGCTAAGTTCATATTTTAGATGG + Intergenic
1089127488 11:116186955-116186977 TGTTATCTACATACTTTATGGGG + Intergenic
1089588599 11:119525605-119525627 TGTTAAATACAATTTATAGGAGG - Intergenic
1090528656 11:127565259-127565281 TGTTACTTACTAATTTTATGAGG - Intergenic
1092935608 12:13360826-13360848 TTTTAATTATATTTTTTTGGGGG + Intergenic
1092962787 12:13611918-13611940 TATTCATTTCATATTTTAGGGGG + Intronic
1093148264 12:15591872-15591894 TTTTAATTAATTATTTTATGGGG - Intronic
1093494457 12:19740213-19740235 TGGTAATTACAAATTTAAAGAGG + Intergenic
1096218884 12:49815152-49815174 TTGTAATTAAATATTTTTGGGGG + Intronic
1098325023 12:69292484-69292506 TGTTAATTACAAAGTGGAGGGGG + Intergenic
1098814988 12:75148144-75148166 TGATAATTACATATATTTGTGGG - Intronic
1099484906 12:83217136-83217158 TGTAAATTACTATTTTTAGGTGG - Intergenic
1099516556 12:83603676-83603698 TGTTAATTACAGAAGTTGGGTGG + Intergenic
1099784448 12:87242878-87242900 TTTTATTCAAATATTTTAGGTGG + Intergenic
1101260211 12:103021546-103021568 TCTTTGTTGCATATTTTAGGAGG + Intergenic
1102442837 12:112976771-112976793 TGCTATTTATACATTTTAGGAGG - Intergenic
1102808134 12:115799992-115800014 TTTTAATTACATGTATTAGCTGG + Intergenic
1103100682 12:118172091-118172113 TGTTACTTAAATGTTTTATGCGG + Intronic
1104073395 12:125368365-125368387 CTTTAATTACATAATTAAGGTGG + Intronic
1104139697 12:125975357-125975379 AGTGAATTAAAAATTTTAGGTGG - Intergenic
1105960499 13:25330877-25330899 TTTTAAATACATTTTTTAGAAGG - Intronic
1106059894 13:26279491-26279513 TTTAAATTAAATATTTTTGGTGG - Intronic
1106502703 13:30344724-30344746 TTTTCATTACATATATTATGAGG - Intergenic
1106837162 13:33647006-33647028 TTTTTATTTTATATTTTAGGGGG - Intergenic
1107116620 13:36754164-36754186 TGTTAATTACTTTTTTAAGATGG - Intergenic
1107293561 13:38885595-38885617 TGTTAATTACATATTGAAAGTGG - Exonic
1107919774 13:45193405-45193427 TGGTAATAAAATATTTTAAGGGG - Exonic
1108786622 13:53910692-53910714 TGTTAATTAAATAGTTCAGAAGG - Intergenic
1109863152 13:68226182-68226204 TGTTAATTACATATTTGATATGG - Intergenic
1110293739 13:73838356-73838378 TGAAAATAACATATTTTTGGAGG + Intronic
1110433117 13:75448951-75448973 TGTCACTTTCACATTTTAGGAGG - Intronic
1110896416 13:80758270-80758292 ACTAAATTAGATATTTTAGGGGG + Intergenic
1111061966 13:83032679-83032701 AAATAATTTCATATTTTAGGAGG - Intergenic
1111734738 13:92123467-92123489 TGTTTATTACAAATTTTACAGGG + Intronic
1112078750 13:95942757-95942779 TTTTAATGACATATTTTAATGGG + Intronic
1112619382 13:101039036-101039058 TGCTAATTTAATATTTTAGATGG + Intergenic
1113140191 13:107138993-107139015 TGTTAATTATCTATTCTAGTGGG - Intergenic
1114897708 14:27012101-27012123 ATGTAATTACATATTTTAGGAGG + Intergenic
1115421502 14:33199994-33200016 TGTTAATCACTTATTTTGAGGGG + Intronic
1115467188 14:33728287-33728309 TATTATTTTCATATTTTAGGTGG + Intronic
1115500888 14:34048727-34048749 TCTTAATTACATATTTTGTTTGG + Intronic
1115563915 14:34607989-34608011 TTTTAATTCCATTTTCTAGGAGG - Intronic
1115588033 14:34834962-34834984 TGTAAATTACATATTTAATCTGG - Intronic
1115688009 14:35817047-35817069 GGTTAAATACAAATTATAGGAGG + Intergenic
1116246305 14:42417680-42417702 TGTTAGTCACATATTTTAAGTGG + Intergenic
1116510630 14:45742152-45742174 TGTTTATTTCATATGTTAGCGGG + Intergenic
1116595363 14:46836141-46836163 TTTTAATCACATATTTCATGGGG - Intergenic
1116779936 14:49225831-49225853 TTTTAATTACATATCTTTTGGGG - Intergenic
1119131808 14:72179671-72179693 TGTTAACTTCATATTTGAAGGGG + Intronic
1119583364 14:75808330-75808352 TGTTAATTATATTTTAAAGGGGG - Intronic
1119974250 14:79007840-79007862 TGTTGATTACAGAGTTAAGGGGG + Intronic
1120529815 14:85618588-85618610 TGTAAATTACATCTTCTGGGTGG - Intronic
1121627354 14:95395837-95395859 TGTTAAAAAAATTTTTTAGGTGG - Intergenic
1123427074 15:20181396-20181418 TGATAATTACATGTTTAAGTGGG - Intergenic
1123536303 15:21187905-21187927 TGATAATTACATGTTTAAGTGGG - Intergenic
1124070384 15:26387425-26387447 TGTTATTTAAGTATTTCAGGAGG + Intergenic
1124811685 15:32945400-32945422 TGTTATTTAGAGGTTTTAGGAGG - Intronic
1124834235 15:33180335-33180357 TGTTTCTTATATATATTAGGTGG + Intronic
1125251288 15:37707850-37707872 TGTTAATTACATTTCTTATGGGG + Intergenic
1125336316 15:38630033-38630055 GGTTAATGATATATTTTAAGAGG + Intergenic
1126790676 15:52218429-52218451 TGTTAATCATATGCTTTAGGTGG + Intronic
1126931532 15:53657623-53657645 GGTTAATGAAATATTGTAGGGGG + Intronic
1127407124 15:58662012-58662034 TGTTAATTACAGATGTTAACAGG - Intronic
1127760979 15:62138941-62138963 TGTTAAATAAAAATTATAGGAGG + Intergenic
1130207776 15:81893986-81894008 TGCTGATTACATATCTTATGAGG + Intergenic
1131695267 15:94869733-94869755 TGTAAATTACAGAATTTAAGAGG - Intergenic
1132134121 15:99316538-99316560 AGTTCATTCCATATTTTATGAGG + Intronic
1133654419 16:7846434-7846456 TGTTAATTGTAGAATTTAGGTGG + Intergenic
1133801481 16:9089379-9089401 TATGAGTTAAATATTTTAGGAGG - Intergenic
1136857225 16:33668440-33668462 TGATAATTACATGTTTAAGTGGG + Intergenic
1138499443 16:57430155-57430177 TGTTACTAAAATATTTGAGGTGG + Intronic
1138759509 16:59525266-59525288 TGTTAATAATGTATTTTAGTAGG + Intergenic
1203118798 16_KI270728v1_random:1516931-1516953 TGATAATTACATGTTTAAGTGGG + Intergenic
1147701765 17:42400619-42400641 TCTTAATTCCACATTTCAGGTGG + Intergenic
1148817628 17:50341645-50341667 TGTTAAATAAAAATTATAGGAGG - Intergenic
1149524744 17:57346332-57346354 TGTAAATAACACATTTTGGGGGG + Intronic
1149680288 17:58502099-58502121 TTTTAAGTACATAGTTTAGTAGG - Intronic
1149719822 17:58831844-58831866 TTTTAATTTCACATTTCAGGAGG + Intronic
1152072232 17:78139568-78139590 AATTAATTACTTATTTTTGGTGG - Intronic
1153186478 18:2491702-2491724 TGTTCATTCCAGATTTTATGTGG + Intergenic
1153487820 18:5618366-5618388 TGTTTATCTCATATTTTGGGAGG - Intronic
1154289367 18:13093720-13093742 TGGTAATTACATAACTTATGTGG + Intronic
1155023435 18:21917865-21917887 AGTTAATTATGTATTTTTGGTGG + Intergenic
1155436896 18:25822134-25822156 TGTTCATTACATTTTCTAAGGGG - Intergenic
1156128324 18:33935862-33935884 TCTTACATACATATGTTAGGGGG - Intronic
1156845604 18:41662463-41662485 TTTTAAATTCATATCTTAGGTGG - Intergenic
1157750772 18:50176115-50176137 TTTCAATGACATATTTTAAGGGG - Intronic
1158380189 18:56921191-56921213 TGTTATTTACATGTTTTATTTGG + Intronic
1158418823 18:57274504-57274526 TATTAATTAAATATTTAGGGAGG - Intergenic
1160075817 18:75675465-75675487 TGTCACTGACATGTTTTAGGAGG - Intergenic
1163332563 19:16650217-16650239 TGTTAATTGCAGAATGTAGGTGG - Intronic
1164972622 19:32545524-32545546 TTTTAATTACATTTTTTTTGCGG - Intergenic
1165406661 19:35634871-35634893 TGTTAATTGCAGAATCTAGGTGG - Intronic
1167773690 19:51541056-51541078 TGTTTATTATATTTTTTAGAAGG - Intergenic
1167984795 19:53305587-53305609 TTTTAACTACATATTTAAGTAGG + Intergenic
925849988 2:8071099-8071121 AGTCATTTTCATATTTTAGGAGG - Intergenic
926459971 2:13116929-13116951 TCTTAATTACATAATAAAGGAGG + Intergenic
928071949 2:28225863-28225885 TGCTAATAACCTATTCTAGGGGG + Intronic
929191402 2:39143691-39143713 TGTTAAATACAACTTATAGGAGG - Intergenic
929630479 2:43455402-43455424 TGTTGATTATAAATTTTAGGTGG + Intronic
929847326 2:45543270-45543292 TGATACTTACACATATTAGGGGG - Intronic
930574461 2:53128910-53128932 TTTTAATTAGATATTTCTGGTGG - Intergenic
931153152 2:59597610-59597632 TGTTTAATACATATTTTATATGG - Intergenic
931171676 2:59809987-59810009 TGTTTTTTACATTTTTTAAGAGG + Intergenic
932522030 2:72424211-72424233 TGTTAATTACATCTTCTGGATGG - Intronic
932900614 2:75695519-75695541 TCTTTATAACATATTTTACGTGG - Intronic
933414189 2:81964627-81964649 TGTTAAATTGAAATTTTAGGGGG + Intergenic
933468388 2:82686651-82686673 TTTTAATTCGATATTTTATGAGG + Intergenic
934510830 2:94941028-94941050 TGTGTATTAAATATTTTAGAAGG - Intergenic
935504011 2:103876498-103876520 TGGAAATTACACATTTTAGAGGG - Intergenic
938732741 2:134159017-134159039 TGTTGATTACATGTTTTACATGG + Intronic
938749526 2:134315274-134315296 TGGTAATCAGACATTTTAGGGGG - Intronic
939874244 2:147558387-147558409 GGTGTATTACATATTTTAAGTGG - Intergenic
941262448 2:163314773-163314795 TCCTAATTACCTATTTGAGGGGG + Intergenic
942288158 2:174442537-174442559 TGTTAATTATATAATTTGTGAGG - Intronic
942445335 2:176073752-176073774 TGTTACTTTCATATATTATGTGG - Intergenic
942989084 2:182177766-182177788 TGTCAAAGACATATTTCAGGAGG - Intronic
943986219 2:194622561-194622583 TGTCAATTAGATATTTTGGCTGG + Intergenic
944934029 2:204548714-204548736 TCTTAATTATATATTTTATGAGG + Intronic
945847035 2:214957996-214958018 TGTTAAATTCATATCTTAGGAGG - Intronic
946095181 2:217268601-217268623 TGTAAAATACAGATTTTATGAGG - Intergenic
946947427 2:224835747-224835769 AGTTGATTACATTTATTAGGAGG + Intronic
947110931 2:226718869-226718891 TTTTAATTACATTTTCTAGTTGG + Intergenic
1169295362 20:4392465-4392487 TTTTAATTACATTCTTTTGGTGG + Intergenic
1169526454 20:6431773-6431795 TGTTACCTACATAATTTGGGTGG + Intergenic
1170002086 20:11626014-11626036 TTTTAATTTCTTATTTTAGCAGG - Intergenic
1170223490 20:13965549-13965571 TTATAATTAAATATATTAGGAGG - Intronic
1174701017 20:52609447-52609469 TTTTCATTTTATATTTTAGGTGG + Intergenic
1174909300 20:54589378-54589400 TTTTAATTACAGATTTTAGATGG - Intronic
1175933681 20:62505358-62505380 TGTTACTTGCCTACTTTAGGGGG - Intergenic
1177664516 21:24136740-24136762 ATTTGAATACATATTTTAGGGGG + Intergenic
1178220724 21:30656083-30656105 TGTTATTTATATATTATTGGTGG - Intergenic
1181132936 22:20744502-20744524 TGGAATTAACATATTTTAGGAGG - Intronic
951080807 3:18447639-18447661 TGTTAATAAAATATTGTAGTTGG + Intergenic
952249153 3:31632403-31632425 TGTTAATAATATATGTTATGGGG + Intronic
952298092 3:32079137-32079159 TGTTAAATAAAAATTTTAGGAGG - Intergenic
953451178 3:43007732-43007754 TGTTATTTTCATATTTCAGGAGG + Intronic
955259746 3:57375244-57375266 TGTTAATTGCAGAATCTAGGAGG + Intronic
955298830 3:57757540-57757562 TGTTAATTTAAAATTTTGGGTGG + Exonic
955520298 3:59769145-59769167 TGTCAATTTCATAATTTCGGAGG + Intronic
955569030 3:60283435-60283457 ATTGAATTACATATTTTAGAAGG - Intronic
956382456 3:68679235-68679257 GCCTAATTACATATTTTAGAAGG - Intergenic
957192277 3:77024834-77024856 AGTTAATTCCATATTGGAGGGGG + Intronic
957863294 3:85988385-85988407 TGTTATGTACATATTTCAGAAGG - Intronic
959134445 3:102399581-102399603 TGGTAAATACATATTTTCAGAGG + Intronic
959187468 3:103064174-103064196 TTTTAAAAACATATTTTAAGAGG + Intergenic
959249195 3:103919131-103919153 TGTTTCTCACATATATTAGGAGG + Intergenic
959946356 3:112129663-112129685 TGAGAATTACATATTTTCAGGGG - Intronic
960071245 3:113433731-113433753 TGCTAATGAAATATGTTAGGGGG - Intronic
960600255 3:119450071-119450093 TCTAATTTAGATATTTTAGGAGG + Intronic
964068793 3:152607288-152607310 TGTTAAATAAAAATTATAGGAGG + Intergenic
964121412 3:153188108-153188130 TTTTAATTAAATACTTTGGGTGG + Intergenic
964637694 3:158875497-158875519 TGTGACTTACATATTATAGGTGG + Intergenic
965011321 3:163095885-163095907 CTTCAATTACATGTTTTAGGGGG - Intergenic
966171233 3:177083650-177083672 TGTTAATTTTAAATTGTAGGTGG - Intronic
966665742 3:182469153-182469175 TGTTAATTATAAAATCTAGGTGG - Intergenic
966814575 3:183879657-183879679 TGTTTATTACATATTATATAAGG + Intronic
967061378 3:185875993-185876015 TTTTAAATACATATTTTGGCTGG + Intergenic
967710601 3:192702888-192702910 TGTTATTTAAATAATTAAGGTGG - Intronic
970231845 4:13919129-13919151 AATTATTTATATATTTTAGGCGG + Intergenic
970376808 4:15466922-15466944 TGCTCCTTATATATTTTAGGAGG - Intergenic
970591684 4:17565517-17565539 TGTTAATGACAAGTTTAAGGAGG - Intergenic
971582069 4:28354394-28354416 TGTTAATTTAATATTTAAGAAGG + Intergenic
971925062 4:32998003-32998025 TGTTTATTACATTTTTAAGATGG - Intergenic
972003917 4:34074142-34074164 TGTTAATTACAGAGTTTCAGGGG + Intergenic
972414711 4:38827116-38827138 TGTTAATTTCATATTAAAAGCGG + Exonic
972925477 4:44000807-44000829 TTTTAATGACATATTTTAATTGG + Intergenic
973933849 4:55821610-55821632 AGTTAATTACATAATTTGGAGGG - Intergenic
975430612 4:74286199-74286221 TTTTAATGACATAAGTTAGGAGG - Intronic
976307684 4:83577482-83577504 TGTTTACTACATATTCTAAGTGG + Intronic
976375121 4:84337729-84337751 GCTTAATTCCATATTTTTGGAGG + Intergenic
976497504 4:85747385-85747407 TTTTAATGCCATATTGTAGGCGG - Intronic
976515329 4:85957821-85957843 TATTAACTAAATATTTTATGTGG + Intronic
977141968 4:93384645-93384667 TCTTAATTATAAATTTTAAGTGG + Intronic
977302565 4:95284366-95284388 TTTTAAATACACATTTTAGGGGG + Intronic
977512266 4:97976292-97976314 TGTTATTTATATATCTTAAGTGG - Intronic
977596074 4:98882567-98882589 TTTTAATACCTTATTTTAGGGGG - Intronic
978630336 4:110736776-110736798 TGTTAAAAACATATCTTAGAAGG - Intergenic
979130879 4:117043479-117043501 TACCAATTACATATTTGAGGTGG + Intergenic
980513921 4:133828479-133828501 TTTTAATGACATATTTGTGGAGG + Intergenic
981498677 4:145422440-145422462 TGCTAAATACATATTTGAGAAGG - Intergenic
982415118 4:155121971-155121993 TCTTATTAACATATTTTAGTTGG + Intergenic
984099467 4:175467996-175468018 TGTTAAATACAATTTATAGGAGG - Intergenic
984958853 4:185074449-185074471 TTTTAATGACATATTTTATGTGG + Intergenic
987275429 5:16357020-16357042 AGTTAGTTACCTCTTTTAGGAGG - Intergenic
987807094 5:22782758-22782780 TTTTAATTACATATCGTATGTGG + Intronic
987884174 5:23791917-23791939 TTTTAATTATTTATTTTTGGAGG - Intergenic
987897558 5:23967500-23967522 TCTTAGTTACATATTATTGGGGG - Intronic
988860010 5:35267838-35267860 TTATAATTAAATAATTTAGGTGG - Intergenic
989239267 5:39185404-39185426 TTTTAATCACATATCTAAGGGGG - Intronic
990363514 5:55045859-55045881 TGTTAATAACATTTTTAAAGAGG - Intergenic
991059078 5:62352175-62352197 TTTTACACACATATTTTAGGAGG + Intronic
991724178 5:69519658-69519680 TTTTAATTAAATATTTTATTTGG + Intronic
992151120 5:73904203-73904225 TGTTTTTTATGTATTTTAGGTGG + Exonic
992369940 5:76132518-76132540 TGTTAACTACAGAATCTAGGTGG - Intronic
992764170 5:79980148-79980170 TGGTAAATGCATATTTTTGGAGG + Exonic
993574280 5:89582053-89582075 TGTTAATTACACCAGTTAGGAGG - Intergenic
993680307 5:90869737-90869759 TATTTATTACATATTACAGGAGG + Intronic
994862508 5:105216270-105216292 TGTTAATTAAATATATGAGTGGG - Intergenic
995291046 5:110454146-110454168 TGTTAATTACATAAAGTTGGTGG - Intronic
995469502 5:112485652-112485674 TGGCCACTACATATTTTAGGAGG + Intergenic
995845753 5:116492000-116492022 TGTTAAAAACATATTTTTAGGGG + Intronic
995916126 5:117247036-117247058 TTTCATTTACATCTTTTAGGAGG + Intergenic
996357504 5:122612831-122612853 TGTTCATTAAAAAATTTAGGGGG + Intergenic
996371812 5:122761213-122761235 TGTTAAATAGAAATTGTAGGAGG + Intergenic
996869223 5:128168217-128168239 TTATAATGACATAGTTTAGGAGG - Intronic
996919546 5:128751757-128751779 TGCTACTTACAGAATTTAGGTGG + Intronic
997058361 5:130471307-130471329 TGTAAATTATAGACTTTAGGTGG - Intergenic
998942555 5:147300384-147300406 TGTTCCTTACATATTTTTGCAGG - Intronic
999941167 5:156544853-156544875 TGTTAATAACATCATTTATGAGG + Intronic
1000453751 5:161422651-161422673 TCTTAATAACATTTTTTAGAGGG - Intronic
1001077331 5:168639819-168639841 TGTTAAGTATATATTCTAAGTGG + Intergenic
1001182521 5:169533787-169533809 TGTGAAATACATATTGTAAGTGG + Intergenic
1002812452 6:644682-644704 AGTTATTTACATATTTTAGTAGG + Intronic
1004242896 6:13943593-13943615 TGTGAATTACAAATTTTTTGAGG + Intronic
1005925969 6:30446044-30446066 TGTTCAGTACCTATTTTGGGGGG - Intergenic
1006970296 6:38036912-38036934 TCTTAAATACATATTTTAAAAGG + Intronic
1007906750 6:45469209-45469231 TGTTATTTACATGTTATAAGAGG + Intronic
1008033338 6:46720759-46720781 ATTTTATTACATATTTTTGGTGG + Intronic
1008339061 6:50342875-50342897 TGGAAATTACATATTTTATAGGG + Intergenic
1009457367 6:63872777-63872799 AGTACATTAAATATTTTAGGTGG - Intronic
1009568115 6:65340525-65340547 TGTAAATAACTTATTTTAGTTGG - Intronic
1010612941 6:77977702-77977724 TGTTATTTACATTCTTTGGGGGG - Intergenic
1011013690 6:82731031-82731053 TGTTAATTGTACAATTTAGGTGG - Intergenic
1011285721 6:85720227-85720249 TGTTAAATAAATGTTATAGGAGG - Intergenic
1011476416 6:87753186-87753208 TGTTAATTACCTAATTTTGGTGG - Intergenic
1012030437 6:94053366-94053388 TGAATATTACATACTTTAGGAGG + Intergenic
1012323537 6:97883821-97883843 TGTTGTTTATATATTTTTGGTGG + Intergenic
1012731902 6:102893800-102893822 AGTTATTTACATATTTCATGAGG + Intergenic
1013547448 6:111172255-111172277 AGTTTATTATATATTTTAGAAGG + Intronic
1013783095 6:113750019-113750041 TGTTAATTTCACATTATGGGTGG + Intergenic
1013894943 6:115076286-115076308 TTTTAATTACATTTTTTAAATGG + Intergenic
1014641261 6:123913611-123913633 TGTTAATTACATATTTTGTTAGG + Intronic
1015032823 6:128616270-128616292 TCTTAATTTCTTATTTTAGAAGG + Intergenic
1015074693 6:129141680-129141702 TGTTAATTACATTTTTTGACAGG - Intronic
1015963769 6:138677226-138677248 TCCTAGTTACATTTTTTAGGAGG + Intronic
1016465623 6:144322266-144322288 TGTTAAATAAATATTTTAGTTGG + Intronic
1016536798 6:145116005-145116027 TCTTACCTACATAATTTAGGAGG + Intergenic
1017184313 6:151585741-151585763 TATCAATTACATATTTTAAATGG + Intronic
1018944013 6:168333062-168333084 TGTGAATTATGTATTTTAGAAGG + Intergenic
1020158789 7:5751339-5751361 TGTTAAATAAAAATTATAGGAGG + Intronic
1022756213 7:33293240-33293262 ACATAATTACATATTTTATGTGG - Intronic
1024322658 7:48086310-48086332 TGTTAAACACAAATTATAGGAGG + Intergenic
1024433959 7:49326972-49326994 TGTCAATTAGATATTTTGGCTGG - Intergenic
1025949376 7:66131623-66131645 TTATAATTACATATTTTGGAAGG - Intronic
1026812116 7:73476688-73476710 TGATAATTTCATATTTCAGCTGG - Intronic
1026900692 7:74035533-74035555 TGTTAATTGCATTTTTAAGTGGG - Intronic
1028067308 7:86402923-86402945 TCTTAATTATATATTTTTGGAGG - Intergenic
1028410039 7:90520802-90520824 TGTTAATTTCATAGTTTACTCGG + Intronic
1030465805 7:109901832-109901854 TGTTATTTTCATCTTATAGGTGG + Intergenic
1031433669 7:121705973-121705995 TGTTAATTAAAAATTTTAAAAGG + Intergenic
1031439912 7:121781290-121781312 TGTTCATTATATATATTATGTGG - Intergenic
1032302812 7:130704764-130704786 TGTTTATTACATCTTCTACGTGG + Intergenic
1032341159 7:131074431-131074453 AGTTCATTACATACTTTTGGAGG - Intergenic
1034138443 7:148794149-148794171 TGTAAATTACATATTTGATAAGG - Intronic
1035338013 7:158142420-158142442 TGTTACTTACAGATTTTGAGAGG - Intronic
1035715701 8:1753131-1753153 TGATAATTACATAAGTTGGGAGG + Intergenic
1035940713 8:3898039-3898061 TTGTAAGTACATAATTTAGGTGG - Intronic
1035968875 8:4225341-4225363 TGTTAATTACATATTTTAGGTGG - Intronic
1036465544 8:8993649-8993671 TCTTAATTACTGATTTTGGGGGG - Intergenic
1038823316 8:30973514-30973536 TGTTAAGTAGAAATTATAGGAGG + Intergenic
1039654594 8:39388241-39388263 TGGAAATTTCATTTTTTAGGAGG + Intergenic
1040891384 8:52320449-52320471 TGTGAATTACATGTTTTACATGG - Intronic
1041317163 8:56575824-56575846 TGTTAAATACAATTTATAGGAGG + Intergenic
1041400659 8:57440913-57440935 TTTTAATTACATACTTTTTGGGG - Intergenic
1041450326 8:57999456-57999478 TTTTAATTTTATTTTTTAGGAGG + Intronic
1041857834 8:62478440-62478462 TGTGAATTATATATTTTATGGGG - Intronic
1042395832 8:68291567-68291589 TTTTAATGAAATATTTTAGAAGG - Intergenic
1042639843 8:70921766-70921788 TGCTAATTATACATTTTAGGTGG + Intergenic
1042881349 8:73494336-73494358 TATTAATTATACAATTTAGGTGG + Intronic
1043672945 8:82911495-82911517 TGATAATTACACATTTTAAAAGG + Intergenic
1044226541 8:89725422-89725444 TGTTAATTGCATTTTTTTTGAGG - Intergenic
1044586230 8:93871554-93871576 TTTTAAATAAATATTTTAAGGGG - Intronic
1045018416 8:98019715-98019737 TGGTAATTCCCTATTTTGGGGGG + Intronic
1045516035 8:102862338-102862360 TGTTAATTACAGAATCTAGGTGG + Intronic
1045812263 8:106236305-106236327 TGATAATGAAATATTTTAGAGGG + Intergenic
1046465036 8:114590179-114590201 TGTTCATTAGATATTATAGTGGG - Intergenic
1047872500 8:129100185-129100207 TCCTAGTTTCATATTTTAGGTGG + Intergenic
1048731017 8:137441362-137441384 ACTTAATTATATAATTTAGGTGG + Intergenic
1048749173 8:137651314-137651336 TGTTAAATACATATTTTTAATGG - Intergenic
1050385703 9:5088263-5088285 TCTTAATTACACAGTTTAGAAGG - Intronic
1051360365 9:16276696-16276718 TCTTAATTCCATAATTTAGAAGG + Intergenic
1051643252 9:19243386-19243408 ACTGAATTACATATTTTAAGTGG - Intronic
1051762415 9:20482142-20482164 TGTTAAATAAAAATTATAGGAGG + Intronic
1051813205 9:21074342-21074364 TGTTATTTAGGCATTTTAGGTGG - Intergenic
1052182959 9:25553261-25553283 TGACAATTACATATGTTAGTTGG - Intergenic
1053499490 9:38573126-38573148 TATTATTTACTTATTTTAGATGG - Exonic
1055217128 9:73878311-73878333 TGGGAACTACATAGTTTAGGAGG + Intergenic
1055325699 9:75126311-75126333 TGTTGCTTTCATATTTCAGGTGG - Intronic
1055835598 9:80437311-80437333 TGTTAATTAAATGTTTTGGCTGG + Intergenic
1056707173 9:88961005-88961027 TGTTAATTCCATCTTTTATTCGG + Intergenic
1058345860 9:103961320-103961342 GGTTCATTACATTTTTTAAGAGG - Intergenic
1061690358 9:132322725-132322747 TGTTAATTCCTTTTTTCAGGTGG - Intronic
1187515151 X:19962688-19962710 TGTTAATTGTAGACTTTAGGTGG + Intronic
1187944534 X:24413306-24413328 GGTTAATTTCATACTTTGGGAGG - Intergenic
1188095000 X:26010625-26010647 TGTTAGTTACACATTTTTGTTGG + Intergenic
1188470704 X:30535689-30535711 CCTTAAATACTTATTTTAGGGGG + Intergenic
1190772813 X:53529080-53529102 TGTTAAATAAAAATTATAGGAGG - Intergenic
1192300254 X:69893592-69893614 TGTTTATTCCATATTTTATGTGG - Intronic
1192322911 X:70106515-70106537 TGTTAATTAAATATTTATTGAGG - Intergenic
1192572211 X:72215560-72215582 TGTTAATAACAGAATCTAGGTGG + Intronic
1194369652 X:93057032-93057054 TGTTTATTATACATTTTTGGGGG - Intergenic
1195426478 X:104738347-104738369 TGCTAATGGCAGATTTTAGGTGG + Intronic
1195961287 X:110389529-110389551 TTTTATTTACTTATTTTGGGTGG - Intronic
1198187706 X:134270246-134270268 TGTTAATCATATATTTTACCTGG - Intergenic
1198334429 X:135652892-135652914 TGTTATCTACATACTGTAGGTGG - Intergenic
1198615588 X:138455315-138455337 TATTAATTTCATATTATAGTTGG + Intergenic
1199522697 X:148754204-148754226 TGTTTATTGCATATTGTATGTGG - Intronic
1200299056 X:154954044-154954066 TGTTAATTACATATATTGAAAGG + Intronic
1201279411 Y:12328224-12328246 TGTCAAGTACATATTTTACATGG + Intergenic