ID: 1035969362

View in Genome Browser
Species Human (GRCh38)
Location 8:4229735-4229757
Sequence TATGCTATGTAGAAGCAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035969362 Original CRISPR TATGCTATGTAGAAGCAGGA CGG (reversed) Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907482794 1:54756142-54756164 GATGCTATGTAGAGGCAGGCAGG + Intergenic
907580586 1:55568696-55568718 TATGCTTTGCAGATGAAGGAAGG + Intergenic
908755597 1:67466438-67466460 TGTGCTGTGTAGAAGGAAGATGG + Intergenic
911026388 1:93440005-93440027 TATTTTTTGTAGAGGCAGGAGGG + Intergenic
911704616 1:100997122-100997144 TATTGTATGGAGAGGCAGGAAGG - Intronic
912985208 1:114421102-114421124 TATGCTATGTATAATCAGCCAGG + Intronic
914355899 1:146884292-146884314 GATGGTATGTAGAAGAAAGAAGG - Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
915790977 1:158671028-158671050 TATGCTTTGTAGAACAAGAATGG + Intronic
916429558 1:164713868-164713890 AATGATATGTCGAAGCAGGAAGG + Intronic
922549724 1:226485141-226485163 TGTGCTGTGAAGATGCAGGAGGG + Intergenic
1063267323 10:4467969-4467991 TGTGCTATGGAGAAGGAGGTAGG - Intergenic
1064602214 10:17005522-17005544 TTTTCTAAGTAGAAGCAGCAAGG - Intronic
1064857556 10:19787127-19787149 TATGCTATATAGACGTAGAAAGG - Intronic
1064994447 10:21284000-21284022 TTTGCTATGTTGAACCAGGCTGG - Intergenic
1068390804 10:56394120-56394142 TATCCTATTTAGAAAAAGGAAGG - Intergenic
1068546984 10:58358699-58358721 TATGCTGGGTAAAAGCAGCAAGG - Intronic
1068856052 10:61798453-61798475 GATGCTTAGTAGAAGCAGGCGGG - Intergenic
1070902928 10:80046712-80046734 CATACAATGTAGAAGAAGGAAGG + Intergenic
1071400023 10:85259845-85259867 GATGTTATGTAGAAGAAGAATGG - Intergenic
1072482098 10:95818834-95818856 TAGGCTATGTAAACACAGGAAGG + Intronic
1073978162 10:109123769-109123791 TATATTAGCTAGAAGCAGGAAGG - Intergenic
1074243265 10:111661032-111661054 TGGGATATGTAGAACCAGGAAGG + Intergenic
1078492202 11:11779971-11779993 TATGCTAAGTAGAAGAAGCCAGG + Intergenic
1078696527 11:13637872-13637894 TATGCTAAGTAGAAGAAGACAGG - Intergenic
1082987304 11:59179980-59180002 TATTATATGTCTAAGCAGGATGG - Intronic
1084156040 11:67313039-67313061 TTTGCTTTGTAGCAGGAGGAAGG - Intergenic
1086490519 11:87354094-87354116 TCTGCTGTGTGGAAGCAGGGAGG + Intergenic
1086863247 11:91949766-91949788 GATGCTATGGGCAAGCAGGAGGG - Intergenic
1087267035 11:96071799-96071821 TATGTTAGGTATATGCAGGATGG - Intronic
1087889616 11:103522132-103522154 TATGTTCTGAAGCAGCAGGAAGG + Intergenic
1088558782 11:111091090-111091112 TATGTTATTTAGAGACAGGAAGG + Intergenic
1092353941 12:7778910-7778932 TATGGGATGTAGAAGCAGTTAGG - Intergenic
1093450333 12:19306502-19306524 TTTGATGTGTTGAAGCAGGAGGG + Intronic
1095287891 12:40437818-40437840 CATGCTATGAAGAAACAAGAGGG - Intronic
1099691070 12:85952454-85952476 TATGCCATCTACAAGCTGGAGGG + Intergenic
1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG + Intronic
1108565203 13:51689963-51689985 AATTGTATGCAGAAGCAGGATGG + Intronic
1110738733 13:78969243-78969265 TATTATTTGTAGAGGCAGGATGG - Intergenic
1111475601 13:88742427-88742449 TATTCTGTGTAGAAGCTGAAAGG + Intergenic
1113948675 13:114059245-114059267 TGTGCTGTGAAGATGCAGGAGGG - Intronic
1115680000 14:35727776-35727798 AAGGATATGTAGAAACAGGAAGG + Intronic
1115763580 14:36600076-36600098 TATAATAAGTAGAAGCTGGATGG + Intergenic
1118221741 14:63860811-63860833 TAAGCTGTCTAGAAGCAGAAAGG + Intronic
1119318716 14:73716918-73716940 TATACCCTGTAGAAGCAGGGGGG - Exonic
1120420194 14:84275269-84275291 TATGCTTTGTAGTATCTGGAAGG - Intergenic
1122615903 14:103017787-103017809 TCTGCTCTGTAGCAGAAGGAAGG - Intronic
1122837236 14:104436267-104436289 GATGTTATGGAGAAGCAGGACGG + Intergenic
1123823257 15:24054437-24054459 TTTGCTGTTTAGAAGCAGGGAGG - Intergenic
1123887589 15:24742168-24742190 TTTGGAATGTAGAAGCAAGAGGG - Intergenic
1124851343 15:33341602-33341624 TCTACCATCTAGAAGCAGGAGGG + Intronic
1125048075 15:35266307-35266329 TATGGTATATATAAACAGGAGGG + Intronic
1125377717 15:39050110-39050132 TACGTTATGTAAAATCAGGAGGG + Intergenic
1128494555 15:68187229-68187251 TATGCTCAGAAGCAGCAGGAGGG - Intronic
1128573859 15:68756146-68756168 TATGCTAAGGTGAAGGAGGAAGG + Intergenic
1129102332 15:73277594-73277616 TAAGCTAAGCAGGAGCAGGAAGG - Intronic
1130423731 15:83774745-83774767 CATGCTGTGTAGAAGAATGATGG + Intronic
1133989784 16:10695671-10695693 TAAGCTATGTGGAAGCAGCTAGG + Intergenic
1136926448 16:34379737-34379759 TTTGATAAGTAGAAGGAGGAGGG - Intergenic
1136978126 16:35032070-35032092 TTTGATAAGTAGAAGGAGGAGGG + Intergenic
1137008610 16:35301443-35301465 GATTCTATGTACAAGTAGGATGG - Intergenic
1138104542 16:54280820-54280842 GATGGTATGGAGAAGCAGGCGGG - Intergenic
1138301859 16:55937235-55937257 AATGCTATGTCTCAGCAGGAGGG - Intronic
1139802990 16:69539522-69539544 CATGTTATGAAGAAGCAAGAAGG - Intergenic
1139962795 16:70727677-70727699 AGTGCAATGGAGAAGCAGGAGGG + Intronic
1140919246 16:79521566-79521588 TTGACTATGTAGAAGAAGGAGGG - Intergenic
1142376304 16:89708732-89708754 GCTGCACTGTAGAAGCAGGAGGG - Intronic
1144532309 17:16051156-16051178 TATGCTATGTAAAGGCAAAATGG - Intronic
1145845375 17:28034014-28034036 GATGCTATGGAGTACCAGGAAGG - Intergenic
1149533339 17:57413285-57413307 TATGCTCAGAAGATGCAGGAAGG - Intronic
1149878133 17:60259158-60259180 TATGGTAAGTAGCAGGAGGAAGG + Intronic
1151458697 17:74241979-74242001 TGTTCTCTGGAGAAGCAGGAGGG + Intronic
1152047663 17:77948623-77948645 TATGCCATGGACAGGCAGGATGG - Intergenic
1153415011 18:4836726-4836748 TATCCTATCTATAAGCAGGCAGG - Intergenic
1153886659 18:9474186-9474208 GCTGCTATGTGGATGCAGGAGGG - Intergenic
1155933007 18:31726102-31726124 TATGCAAGGGAGCAGCAGGAGGG - Intergenic
1157887865 18:51385660-51385682 TCTACTATTTAGAAGCAGGTGGG + Intergenic
1161571730 19:5034566-5034588 AAGGCTATACAGAAGCAGGAAGG + Intronic
1162225523 19:9218534-9218556 TATGCTATGTTAAAACAGTAAGG + Intergenic
1163000564 19:14363994-14364016 TTTGCGATGGAGAGGCAGGAGGG - Intergenic
1165819564 19:38665944-38665966 TGTGTGATGTAGAAGCAGGAAGG + Intronic
1166256678 19:41611142-41611164 TATGAAATGGAGAAGCAGTATGG + Intronic
1166687182 19:44802385-44802407 TTTGCCATGATGAAGCAGGAGGG - Intergenic
1167769125 19:51502807-51502829 TATGCTATGTACTGGGAGGAAGG + Intergenic
1167994148 19:53389228-53389250 TATGCTTTTAAGAAGCAGGCTGG + Intronic
925833940 2:7924532-7924554 TATGCTACTTTGAAGCAAGAGGG - Intergenic
925886134 2:8394905-8394927 CATGCTATGTAGAGGTAGGCAGG - Intergenic
930743365 2:54856616-54856638 GATGCAGTGCAGAAGCAGGAAGG + Intronic
931673810 2:64673217-64673239 TGTGCTCTGAAGATGCAGGAAGG - Intronic
933184512 2:79263768-79263790 CATGTTATGAAGCAGCAGGAAGG + Intronic
933200791 2:79445991-79446013 TATGTCATTTAAAAGCAGGATGG + Intronic
934033844 2:88071896-88071918 CATGCTATGTAGAAGCTAGGAGG - Intronic
935208543 2:100919110-100919132 TATGCTGGGTAGAAGCAGCCAGG + Intronic
936489328 2:112956854-112956876 TGTGCTATGTTGTAGGAGGAAGG + Intergenic
936697479 2:114967328-114967350 TCTGCTCTGTGGAAGCAGGAAGG + Intronic
937454120 2:122026611-122026633 TATGCTATCTGCAAGCTGGAGGG + Intergenic
939266126 2:139875293-139875315 TATGCTTTATAAAAGCTGGAAGG - Intergenic
940984967 2:160043621-160043643 TATGCTTTGGAGTAGAAGGAAGG - Intronic
941254592 2:163212920-163212942 CATTCCATGTAGCAGCAGGATGG + Intergenic
941400355 2:165022735-165022757 TATGCTATGTAGGACCATGCAGG + Intergenic
943431272 2:187804485-187804507 GATGCTATGTAGAGCCAAGAGGG + Intergenic
943515549 2:188881572-188881594 TAAGCTAGGTAAAAGCTGGATGG + Intergenic
944177822 2:196853028-196853050 TCCCCTATGTAGAAGCAGCAAGG + Intronic
1170934892 20:20800905-20800927 TTTGCTGTGGATAAGCAGGATGG + Intergenic
1171781418 20:29422070-29422092 TGTTTTATGTAGAAGAAGGAGGG - Intergenic
1172014651 20:31865857-31865879 GATGCTTGGGAGAAGCAGGAAGG + Intronic
1173198098 20:40932602-40932624 CATGCTGTGTAGCAGCATGAAGG - Intergenic
1173957471 20:47045302-47045324 TATGCTATGAGGAAGCTGGTTGG - Intronic
1175786499 20:61715431-61715453 CATGGTATGAGGAAGCAGGAGGG - Intronic
1178505190 21:33156658-33156680 TTTGCTCTGAAGAAGCAGGTTGG - Intergenic
1178813694 21:35907750-35907772 TATGCTCTGAAGATGCAGGAAGG + Intronic
1181615621 22:24052220-24052242 AGGGCTAAGTAGAAGCAGGAGGG + Intronic
1182404018 22:30108634-30108656 ATTGCTATGAAGAAGCAGCATGG - Intronic
949175137 3:1052770-1052792 TAAACTATGGTGAAGCAGGAGGG - Intergenic
949370799 3:3332792-3332814 GCTGCTATGTAGAGGCAGGTAGG + Intergenic
949592592 3:5509739-5509761 TATCCTAAGTAGAAGAATGATGG - Intergenic
953137359 3:40192882-40192904 GTTACTATGTAGAAGCATGATGG - Intronic
953439688 3:42906753-42906775 TTTGCAATGCAGGAGCAGGAAGG + Intronic
956010901 3:64830611-64830633 TTTGGTATGTGGCAGCAGGAGGG - Intergenic
959401228 3:105904584-105904606 TGTCCTATGTGGAAGAAGGAGGG - Intergenic
960404861 3:117247263-117247285 TGAGCTATGTAGAAGCATCAAGG + Intergenic
961832407 3:129630534-129630556 TCTACTATGGAGAAGTAGGATGG + Intergenic
962467274 3:135672625-135672647 TTTGCTCTGTGGAACCAGGATGG + Intergenic
963662232 3:148141567-148141589 TATGTTCTGAAGAAGCAGGTAGG + Intergenic
963674474 3:148291776-148291798 TATGCCATGTGGAAGCAGAAAGG + Intergenic
965440721 3:168710402-168710424 TAGGCTAAGAAGAAGAAGGAGGG - Intergenic
966443167 3:179969863-179969885 TATTTTCTGAAGAAGCAGGAAGG + Intronic
971279100 4:25226579-25226601 AATGCTATGTAGAGGAAGTATGG - Intronic
971507481 4:27381950-27381972 TGTGCAATGTTGAATCAGGAGGG + Intergenic
972177283 4:36423335-36423357 AATGCTAGGAAGAAGCAAGAAGG - Intergenic
972445616 4:39140622-39140644 TTTGCTGTGTGGAAGCTGGAAGG - Intergenic
972742138 4:41897372-41897394 TATGCAAAGTAGATGGAGGATGG - Intergenic
972826142 4:42761361-42761383 TAGGCAAAATAGAAGCAGGAAGG - Intergenic
974168686 4:58238107-58238129 TCTTCTATGCAGAAGCTGGAAGG - Intergenic
974228119 4:59075241-59075263 TATGCTAAGGAGAAGAAGGAAGG + Intergenic
978153267 4:105462508-105462530 TATGCTATTTAGAAAGATGAAGG - Intronic
979074008 4:116247837-116247859 TATGCTAATTAGAAGCGGCAGGG - Intergenic
979513924 4:121585359-121585381 TACCCTGTCTAGAAGCAGGAGGG - Intergenic
979560686 4:122098199-122098221 GAGGCTATGTAGAAGAAGCAGGG + Intergenic
981223547 4:142265013-142265035 TCTTCTGTGTATAAGCAGGAAGG - Intronic
981883013 4:149638618-149638640 TATGCTAATTAAAAGCAGCAAGG + Intergenic
983154224 4:164326232-164326254 AATGCAATGTAAAAGCAGCATGG + Intronic
984974589 4:185219208-185219230 TATGCTTTATAGAAGCTGGCAGG + Intronic
986817520 5:11429023-11429045 TATGCTATGTTTAAGGGGGAGGG - Intronic
990092514 5:52071150-52071172 TATAGTATATAGCAGCAGGAAGG + Intronic
990169362 5:53030535-53030557 TATGGAATTCAGAAGCAGGAAGG + Intronic
993227852 5:85191434-85191456 TTTGCTGTGGAGAAACAGGAGGG - Intergenic
993233790 5:85276081-85276103 CATGCTATGTTGCAGCAAGAAGG + Intergenic
994418721 5:99506327-99506349 GATGATATGGAAAAGCAGGAAGG - Intergenic
995601120 5:113797619-113797641 TATGCTAGGGTTAAGCAGGATGG + Intergenic
995682816 5:114739508-114739530 TATACTTTTTAGAACCAGGAGGG + Intergenic
996485547 5:124029595-124029617 TATGCTCTGCAGAATCAGGTGGG - Intergenic
997682032 5:135763527-135763549 TATTCTATGGAGGAGGAGGAGGG + Intergenic
998226658 5:140332220-140332242 TATGTTATATGGAAGCAAGATGG + Intergenic
1002478132 5:179481571-179481593 TATGCTATCAAGACACAGGATGG - Intergenic
1003908763 6:10725020-10725042 TTGGCTATGTAAAAGCAGGTAGG + Exonic
1005209030 6:23439559-23439581 TATGTAAAGTAGAATCAGGAAGG + Intergenic
1006418869 6:33921093-33921115 TGTGCCAGGTAGAAGCAGGAAGG + Intergenic
1006469178 6:34216902-34216924 TTTGCTATATAGCAACAGGATGG - Intergenic
1007117523 6:39354082-39354104 TAAGCTATGTTGCAACAGGAGGG - Intronic
1008037889 6:46765234-46765256 TAGGATTTGGAGAAGCAGGAGGG - Intergenic
1008680125 6:53863252-53863274 AATGCTATGTAAAGGGAGGAGGG - Intronic
1010982288 6:82381907-82381929 TATACTATCCAGAAGGAGGATGG - Intergenic
1014315067 6:119853778-119853800 TAAGATATGCGGAAGCAGGAGGG + Intergenic
1015944476 6:138486096-138486118 TGTTCTCTGAAGAAGCAGGAAGG - Intronic
1016312249 6:142746645-142746667 TGTCCTATGCAGAAGCAGTAGGG + Intergenic
1024054335 7:45649987-45650009 GATGCTGGGCAGAAGCAGGAAGG + Intronic
1024724275 7:52175091-52175113 TATGACAGCTAGAAGCAGGAAGG + Intergenic
1024910904 7:54445652-54445674 TGTACTATGCAGAAGCAGGAAGG - Intergenic
1025876744 7:65487816-65487838 TATGCTATGAATCAACAGGATGG - Intergenic
1027532341 7:79352521-79352543 TCTGCTAAGCAGAAGCATGAGGG + Intronic
1030535786 7:110765167-110765189 TCTACTATGTAAAAGCAGGTAGG + Intronic
1031346506 7:120673547-120673569 AATGATATGGAGAAGGAGGATGG - Intronic
1032335425 7:131020473-131020495 TAGGCTTTGAAGGAGCAGGAGGG + Intergenic
1035969362 8:4229735-4229757 TATGCTATGTAGAAGCAGGACGG - Intronic
1036234770 8:7029075-7029097 TATGCTATGTGGAAACACGCTGG - Intergenic
1037208206 8:16351456-16351478 TTTTCTATGTTGAATCAGGATGG + Intronic
1040071317 8:43191020-43191042 TATGCTAAGTGGAAGCAGCCAGG - Intronic
1042491124 8:69399088-69399110 AATGCTAATTAAAAGCAGGATGG + Intergenic
1043333547 8:79146346-79146368 CAAGGTATGTAGAAGCATGATGG - Intergenic
1045307759 8:100973344-100973366 CATGTGATTTAGAAGCAGGAAGG - Intergenic
1047026081 8:120826047-120826069 CATGCTATGAAGCAGAAGGAAGG - Intergenic
1048535075 8:135285698-135285720 TGTTGTATGTAGTAGCAGGAAGG - Intergenic
1049768348 8:144366423-144366445 CATGTTATGTGGCAGCAGGAAGG - Intergenic
1050470715 9:5986594-5986616 TGTGCTGTGGAGAAGTAGGAAGG - Intronic
1050620210 9:7444355-7444377 TATACTATGGAGAAACAGTAAGG - Intergenic
1052873647 9:33534417-33534439 TATATTTTGTTGAAGCAGGAGGG - Exonic
1053502444 9:38610341-38610363 TATATTTTGTTGAAGCAGGAGGG + Intergenic
1055532558 9:77199772-77199794 TAGACTATGTAGAAGAATGAAGG + Intronic
1056492379 9:87120307-87120329 TTCTCTATGAAGAAGCAGGAGGG + Intergenic
1058686574 9:107486657-107486679 TTTGCTATGCAAAAGCATGATGG - Intronic
1060524767 9:124314233-124314255 ACTGCCATGTACAAGCAGGAGGG - Intronic
1186807731 X:13156565-13156587 TATGCTTTGCAGATGGAGGAAGG + Intergenic
1187196748 X:17093594-17093616 TATGCTATTTAGAATTACGAAGG - Intronic
1187579698 X:20594565-20594587 TAGGATATGTAGAAGTAGAAGGG - Intergenic
1188115164 X:26233560-26233582 TATGCTCTGTACAAGCAGGACGG - Intergenic
1188942077 X:36252353-36252375 TATGCTATTAAAAAGCAGAAGGG + Intronic
1193998546 X:88397906-88397928 AATACTATGTAGAAGAAGGGAGG - Intergenic
1195609020 X:106842964-106842986 TATGCTAAGTAAAAGAAGGCAGG - Intronic
1199201361 X:145093791-145093813 AATGATTTGTAGAAACAGGATGG - Intergenic