ID: 1035975192

View in Genome Browser
Species Human (GRCh38)
Location 8:4302539-4302561
Sequence CGGAAACCTGACTTTCAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035975192_1035975199 16 Left 1035975192 8:4302539-4302561 CCGTCTTGAAAGTCAGGTTTCCG 0: 1
1: 0
2: 2
3: 13
4: 124
Right 1035975199 8:4302578-4302600 ATACGATAATGCACCGTAAGGGG No data
1035975192_1035975198 15 Left 1035975192 8:4302539-4302561 CCGTCTTGAAAGTCAGGTTTCCG 0: 1
1: 0
2: 2
3: 13
4: 124
Right 1035975198 8:4302577-4302599 TATACGATAATGCACCGTAAGGG No data
1035975192_1035975197 14 Left 1035975192 8:4302539-4302561 CCGTCTTGAAAGTCAGGTTTCCG 0: 1
1: 0
2: 2
3: 13
4: 124
Right 1035975197 8:4302576-4302598 CTATACGATAATGCACCGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035975192 Original CRISPR CGGAAACCTGACTTTCAAGA CGG (reversed) Intronic
901664962 1:10820710-10820732 GGGAGGCCTGACCTTCAAGAGGG + Intergenic
902120963 1:14165290-14165312 GGGAAACCTGGCTTTCCAGTGGG - Intergenic
903451974 1:23459894-23459916 AAGAAACCTGACTTTTCAGATGG + Intronic
904907553 1:33909324-33909346 CTGAGACCTGACTTTTGAGAAGG - Intronic
904968341 1:34398607-34398629 CAGAAACCTCAGTTTCAGGAAGG + Intergenic
905798149 1:40826966-40826988 CGGAAAACTGAGGTCCAAGAAGG - Intronic
906285677 1:44586311-44586333 TGGAAAGTTGACGTTCAAGAGGG + Intronic
909064731 1:70921581-70921603 CCTAAACCTGCTTTTCAAGATGG + Intronic
909852532 1:80486552-80486574 AGGAAACCTGGCTTTTAAGATGG - Intergenic
909916455 1:81325252-81325274 CAGAAACCTGCCTTAGAAGAGGG + Intronic
910316272 1:85887188-85887210 TTGAAAACTGACTTTAAAGAGGG - Intronic
910858086 1:91716316-91716338 CGGAAACATCACCTTCAACATGG - Exonic
911550704 1:99276149-99276171 TGGAAACTTAACTTTGAAGAAGG + Intronic
913146232 1:115993015-115993037 AGGAAGCCTTACTTTCAAGGGGG + Intronic
918820616 1:189249984-189250006 GTGAAACCCCACTTTCAAGAGGG + Intergenic
920301429 1:204991437-204991459 GGGAAGCCAGACTGTCAAGAGGG + Intronic
921115573 1:212087767-212087789 GGGGAACATGATTTTCAAGATGG - Intronic
923960959 1:239083485-239083507 CAGAAACCTGACAATCTAGAAGG - Intergenic
924730171 1:246703869-246703891 CAGAAATGTGAATTTCAAGAAGG - Intergenic
1066193378 10:33076456-33076478 CAGAAACCTGACTCTCCAGGTGG + Intergenic
1066402340 10:35088623-35088645 CGCAAAAATGACTTTAAAGAAGG + Intronic
1069606763 10:69743729-69743751 CAGAAACCTCACTTTCCAGAGGG + Intergenic
1079755637 11:24256915-24256937 GGGAAATCTAACTTTGAAGAAGG + Intergenic
1080210225 11:29777463-29777485 TGGAAAACTCACTTTCAAGCTGG - Intergenic
1084551217 11:69843306-69843328 AGGAAGGCTGACTTTGAAGAGGG + Intergenic
1087093492 11:94298935-94298957 AGAAGACATGACTTTCAAGAAGG + Intergenic
1088155281 11:106795628-106795650 GGGTAACATGACTTTCAAGTTGG - Intronic
1094300179 12:28955621-28955643 CTGCAAGCTGACTTTCAAGTAGG - Intergenic
1094412485 12:30181745-30181767 AGGAAACCAGACATTAAAGAGGG - Intergenic
1097485039 12:60185971-60185993 AAGAAACCTGACTTTTAAAAAGG - Intergenic
1097824662 12:64162682-64162704 TGGAAACCTGACTTGCATTAAGG - Intergenic
1099151289 12:79117072-79117094 CAGTAACAGGACTTTCAAGAAGG - Intronic
1099536411 12:83850739-83850761 CAGAAACATTAATTTCAAGATGG - Intergenic
1099914832 12:88879605-88879627 AGTAAACCTGATTTTTAAGATGG - Intergenic
1107096407 13:36541997-36542019 CAGAAACCTGAGTTTCTAGCAGG + Intergenic
1110943998 13:81390106-81390128 CTTAAACCTGAAATTCAAGAAGG - Intergenic
1112949955 13:104981730-104981752 CGGTATCCGCACTTTCAAGAAGG - Intergenic
1118169320 14:63371017-63371039 AGGAAACTTCACTTTCAACATGG - Intergenic
1124964303 15:34421861-34421883 GGGACACCTGACTTTCCTGAGGG - Intronic
1124980920 15:34568089-34568111 GGGACACCTGACTTTCCTGAGGG - Intronic
1125147617 15:36490540-36490562 GGGAAAATTGACTTTCAAGCTGG + Intergenic
1127462134 15:59208955-59208977 GGGAATACTGACTTTCAAGATGG - Intronic
1128024380 15:64422459-64422481 AGGAAACCTGACCTTCAAGAGGG - Intronic
1128806756 15:70536771-70536793 AGGAAACCTGAGCTTCAGGAGGG + Intergenic
1129023331 15:72544738-72544760 CAAAAACCTGACTTTCTATAGGG - Intronic
1129810998 15:78509885-78509907 AGGAAACATGATTGTCAAGAAGG + Intronic
1134027721 16:10967166-10967188 CGGAGAACTGACTTCCAAGGAGG + Intronic
1134307499 16:13046359-13046381 CGGAAAGCTGAATTTTTAGATGG + Intronic
1136607283 16:31344864-31344886 CGGAAATGTGAGGTTCAAGAGGG - Intergenic
1143234359 17:5385849-5385871 CAGAAACATGACTCTGAAGAGGG - Intronic
1143601962 17:7952882-7952904 GTGAAACCTGAGCTTCAAGAAGG - Intergenic
1145824912 17:27869654-27869676 GGGAAACCCAACCTTCAAGAAGG + Intronic
1146666140 17:34705224-34705246 CGGTAACCTGAAGTTCAAGTGGG - Intergenic
1148993032 17:51682806-51682828 GGGAAACCTGACGTTGATGAAGG + Intronic
1152251266 17:79213826-79213848 AGGAAACCTGACTTTCCAGCCGG + Intronic
1152823439 17:82449110-82449132 CGGAAGCCTGACTTTCAAAAAGG - Intronic
1156674660 18:39513327-39513349 TGGAAACCAGGCTTTCATGAAGG - Intergenic
1156834314 18:41534161-41534183 AAGAAAACTGGCTTTCAAGAGGG - Intergenic
1158302681 18:56069199-56069221 AGGAAACCTGAATTTCAAGTTGG + Intergenic
1160095692 18:75870445-75870467 CTGAACCCTGGCTTTCCAGAAGG + Intergenic
1160949916 19:1661195-1661217 CGGGAACCTGACTTGCTGGACGG - Intergenic
1166164285 19:40976293-40976315 CGAAAACCTGTGTTTCAACAAGG - Intergenic
1166337598 19:42117654-42117676 AGGAAAACTGACTCTCAGGAGGG - Intronic
930191026 2:48460159-48460181 TGGAAACTTGAATTCCAAGAGGG + Intronic
930883739 2:56300611-56300633 CTGCTGCCTGACTTTCAAGAAGG + Intronic
936386676 2:112036302-112036324 TTGAAGCCTGACTTTCAACAAGG + Intergenic
937994198 2:127680677-127680699 AGTAAATCAGACTTTCAAGAAGG - Intronic
940518495 2:154712888-154712910 CTGAGACCTGACTATCCAGAAGG + Intronic
944928463 2:204490866-204490888 TGAAAACCTGACTTTCAATAAGG + Intergenic
945692343 2:213053610-213053632 CTGAAAACTGAGTTACAAGATGG + Intronic
1168815919 20:736977-736999 CGGGACCTTGACCTTCAAGATGG - Intergenic
1170292498 20:14786272-14786294 CTGAAACCTTTCTTTTAAGATGG + Intronic
1172897845 20:38313059-38313081 GGTAAAACTGAGTTTCAAGAAGG - Intronic
1174031697 20:47633615-47633637 CAGAAACGTCACTATCAAGAAGG + Exonic
1176898563 21:14413503-14413525 AGGAAATATGACTTTCAAAAAGG - Intergenic
1178108917 21:29351229-29351251 GGGAAACCTGCATATCAAGATGG - Intronic
1181546363 22:23604711-23604733 CAGAAACCTCACTTTGCAGAAGG + Intergenic
1182830922 22:33304019-33304041 CTGAAACCTGAGTTTGCAGAAGG - Intronic
949272660 3:2237629-2237651 CTGAAATCTAACCTTCAAGAAGG - Intronic
949452207 3:4198377-4198399 CTAAAAGCTGCCTTTCAAGATGG + Intronic
949960894 3:9311215-9311237 AGGACACCTGAATTTCCAGATGG + Intronic
953933250 3:47017681-47017703 CGGAAACCTGACTGCAAAGTGGG - Exonic
961058953 3:123812360-123812382 GGGAAACCTGACTTTCAGTGGGG - Intronic
962175315 3:133147626-133147648 GGGAAACCTGAGGCTCAAGAGGG - Intronic
965531155 3:169772214-169772236 CGGAAACCCCACTTTGGAGAGGG - Intergenic
968038046 3:195565149-195565171 TGGACACCTGACTTACGAGAGGG + Intergenic
968309149 3:197668402-197668424 CTAAAACCTGACCTTCAAGAAGG + Intergenic
968354749 3:198096859-198096881 AGGACACCTGACATCCAAGAAGG + Intergenic
972058360 4:34832693-34832715 AGAAAACCTGACTGTCAAGAGGG + Intergenic
973560740 4:52132872-52132894 GGGAAACTGGAGTTTCAAGATGG - Intergenic
974009900 4:56597142-56597164 CTGAAACCTGACTGGTAAGAAGG + Intronic
975132453 4:70842614-70842636 CGTAAGCCTCCCTTTCAAGAAGG + Intergenic
976294127 4:83452688-83452710 CAGAAACAAGAATTTCAAGAAGG + Intronic
979634996 4:122946832-122946854 CAGAATCCTGACTTTCAAGTAGG + Intronic
981251817 4:142611977-142611999 CAGAAACCTGTCCTTAAAGAGGG - Intronic
982619343 4:157683887-157683909 AGGAAACCTGACTGTACAGAAGG + Intergenic
983048352 4:163013491-163013513 AGGAAAGCTGTCTTTCAAGTGGG - Intergenic
983493024 4:168411563-168411585 TCGAAACCTGACTTCCAGGATGG + Intronic
987240673 5:15995432-15995454 AGAAAACCTGATTTTGAAGATGG - Intergenic
989447370 5:41546086-41546108 GGGAAACCACAGTTTCAAGAGGG + Intergenic
990177015 5:53119120-53119142 GTGAAACCTGACCTTCAAGCTGG - Intergenic
997214132 5:132096436-132096458 CTGAGACCTGACTGACAAGAAGG + Intergenic
997714758 5:136033934-136033956 AGGCAACCTGACCTTCTAGAAGG - Intronic
1002006124 5:176236646-176236668 CAGGAACCTTACTATCAAGACGG + Intergenic
1002220254 5:177673991-177674013 CAGGAACCTTACTATCAAGACGG - Intergenic
1005586365 6:27280062-27280084 CGGACACTTGGCTTTGAAGAGGG + Intergenic
1009874992 6:69494718-69494740 CGGAAACCATACAGTCAAGAAGG + Intergenic
1016118819 6:140322620-140322642 CGTATACCTCAATTTCAAGATGG - Intergenic
1019388645 7:773124-773146 CGGCACCGTGACTTGCAAGAGGG - Intronic
1019927615 7:4203694-4203716 GGAGAACCTGACTTTCAGGAAGG - Intronic
1022210477 7:28204199-28204221 CGGAAACCTCATTTTCATTATGG - Intergenic
1022571886 7:31461981-31462003 AGTAAACCTGATTTTCAAGATGG + Intergenic
1022789659 7:33674152-33674174 TGGATGCCTCACTTTCAAGATGG + Intergenic
1023885682 7:44352970-44352992 CAGAAACCTTACTTTCATTAAGG - Intergenic
1024036461 7:45511022-45511044 CGGACACCTGACCTTCAAAGGGG - Intergenic
1024494495 7:50029188-50029210 CGGTTAACTGACTTTCAACAAGG + Intronic
1024828456 7:53420231-53420253 TGGACACCTGAATGTCAAGAAGG - Intergenic
1026471901 7:70700884-70700906 AGGAGACCTGACTTTCAGGCAGG - Intronic
1027521519 7:79215320-79215342 CGCAAAACTGTCTTTCAAGGGGG + Intronic
1027953939 7:84856080-84856102 CTGAAACATGAAGTTCAAGAGGG + Intergenic
1033564480 7:142565268-142565290 AGGGATCCTGACTTTTAAGATGG + Intergenic
1034429114 7:151032053-151032075 CTGAAGCCTGACCTACAAGAAGG - Intronic
1035960221 8:4128212-4128234 CAGAAACATGCCTTTCAAGGAGG - Intronic
1035975192 8:4302539-4302561 CGGAAACCTGACTTTCAAGACGG - Intronic
1039518223 8:38150613-38150635 GGGAAAACTGAGATTCAAGAAGG + Intronic
1042057830 8:64785886-64785908 AGGAAAACTGACTATCATGATGG + Intronic
1042936140 8:74060406-74060428 CGGAACCCTGACTTTCAGTCGGG + Intergenic
1043735026 8:83730971-83730993 GTGAAACCCCACTTTCAAGATGG - Intergenic
1047298295 8:123590257-123590279 CACAAGCCTGACTTTCAAGAGGG + Intergenic
1051984682 9:23069631-23069653 CAGAAAACTGATTTTCAACAAGG + Intergenic
1052243809 9:26308846-26308868 CAGAAAAATGACTTTTAAGAGGG - Intergenic
1057221109 9:93258397-93258419 TTGAAACCTGACTTTTCAGAGGG - Intronic
1188691405 X:33133402-33133424 AGGAAACATGATTTTCAAGATGG - Intronic
1192757625 X:74063211-74063233 TGGAAAGCTGATTTTCAAAAAGG - Intergenic
1194416121 X:93614378-93614400 GGAAAACAAGACTTTCAAGAAGG + Intergenic
1194488743 X:94520084-94520106 CAGGAAACTGACTTTCAAGAAGG + Intergenic
1194681590 X:96860678-96860700 CAGAAACCTTAATTCCAAGAGGG + Intronic
1197493178 X:127143949-127143971 CGGAAATTTGATTTTCAAAATGG + Intergenic
1197632016 X:128872204-128872226 TGGTAAACTGACTTTCCAGAGGG + Intergenic
1198232970 X:134710447-134710469 CAGAAATCTTACTTTCTAGAAGG + Intronic