ID: 1035975193

View in Genome Browser
Species Human (GRCh38)
Location 8:4302559-4302581
Sequence GTATAGGGTTGAGAGAGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 281}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035975193_1035975199 -4 Left 1035975193 8:4302559-4302581 CCGCCTCTCTCTCAACCCTATAC 0: 1
1: 0
2: 0
3: 23
4: 281
Right 1035975199 8:4302578-4302600 ATACGATAATGCACCGTAAGGGG No data
1035975193_1035975198 -5 Left 1035975193 8:4302559-4302581 CCGCCTCTCTCTCAACCCTATAC 0: 1
1: 0
2: 0
3: 23
4: 281
Right 1035975198 8:4302577-4302599 TATACGATAATGCACCGTAAGGG No data
1035975193_1035975197 -6 Left 1035975193 8:4302559-4302581 CCGCCTCTCTCTCAACCCTATAC 0: 1
1: 0
2: 0
3: 23
4: 281
Right 1035975197 8:4302576-4302598 CTATACGATAATGCACCGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035975193 Original CRISPR GTATAGGGTTGAGAGAGAGG CGG (reversed) Intronic
901292618 1:8135964-8135986 GTACAGGGTGGGGAGAGATGTGG - Intergenic
903264669 1:22150665-22150687 CAAGAGGCTTGAGAGAGAGGAGG - Intergenic
903788695 1:25877971-25877993 GTTTAGGGGTCAGAGACAGGAGG - Intergenic
903788865 1:25879028-25879050 GTTTAGGGGTCAGAGACAGGAGG + Intergenic
904273943 1:29368146-29368168 GAATAGGGTTGAGTGTGAGTGGG - Intergenic
905362352 1:37429745-37429767 GGAGAGGGGTGAGAGAGATGGGG - Intergenic
905961422 1:42045633-42045655 GTGGAGGGTGGAGAGAGGGGAGG + Intergenic
907741514 1:57170688-57170710 GCATAGGGTTGAGAGAGAAAAGG - Intronic
907808573 1:57845322-57845344 GGATAGGATAGAGAGACAGGAGG + Intronic
908941274 1:69437422-69437444 GTATAGGGCAGACAGAGAGTGGG - Intergenic
909271243 1:73626685-73626707 GTCTGGGGTTGAGGGAGGGGTGG - Intergenic
909727745 1:78855915-78855937 GAATAGGGATGAGAGAGTAGAGG - Intergenic
910030773 1:82719968-82719990 GTAGGGGGTTGGGAGGGAGGTGG - Intergenic
910491274 1:87774400-87774422 GTAAAGGGGTGTGAGAGAAGAGG + Intergenic
911176009 1:94819565-94819587 GTAGAGGCTTGATTGAGAGGAGG + Intergenic
911356483 1:96827266-96827288 GTATATGGGTGAGTGTGAGGTGG - Intergenic
911905556 1:103564337-103564359 GTAAAGAGTTGACAGAGAAGAGG - Intronic
912870608 1:113301452-113301474 GTTTAGGGGTGAGGTAGAGGAGG - Intergenic
912982314 1:114386777-114386799 TTCTAGGGTGGAGATAGAGGTGG - Intergenic
915266232 1:154719928-154719950 AAATTGGGTAGAGAGAGAGGAGG + Intronic
917133366 1:171764237-171764259 TTATAGGGTTGTGCTAGAGGGGG + Intergenic
917403416 1:174677665-174677687 CTATTGGGTTGACAGAGAGCTGG + Intronic
917687369 1:177431115-177431137 GTATAATGGAGAGAGAGAGGTGG - Intergenic
918110439 1:181450946-181450968 GAATAGGATTGAGGGAGAGGAGG + Intronic
921064059 1:211610158-211610180 ATATATGGTTGAGAGAAGGGAGG + Intergenic
921260567 1:213382270-213382292 GCAAAGGGTTGAGAGATAAGGGG + Intergenic
922000277 1:221470387-221470409 GTATATGGCTGAGTCAGAGGTGG - Intergenic
922127627 1:222743995-222744017 GGATAGAGATGAGAGAGAGAGGG - Intronic
922478639 1:225923871-225923893 GTAGAGGGTTGAGGGGGAGAGGG - Intronic
922798630 1:228353709-228353731 GTAAGGGGTGGAGGGAGAGGTGG + Intronic
923790384 1:237106412-237106434 GATGAGGGTTGAGAGAGAGAAGG + Intronic
924745928 1:246833670-246833692 GTATAGGACTTAGATAGAGGAGG - Intergenic
924745944 1:246833770-246833792 GTATAGGAGTTAGATAGAGGAGG - Intergenic
1063251573 10:4280536-4280558 GAATGGGGCTGAGAGACAGGGGG + Intergenic
1065534968 10:26707672-26707694 ATATAAGGAAGAGAGAGAGGAGG - Intronic
1065846653 10:29749353-29749375 AAATACAGTTGAGAGAGAGGAGG + Intergenic
1067082277 10:43218475-43218497 AACAAGGGTTGAGAGAGAGGAGG - Intronic
1069330966 10:67292325-67292347 GAATGGGGCTGAGAGACAGGAGG + Intronic
1070420288 10:76229605-76229627 GTAGAGGGGTGAGAGAGGGTGGG + Intronic
1070464171 10:76703227-76703249 GCATGGGGTTGAGGGAGGGGTGG - Intergenic
1070560170 10:77560364-77560386 GTATTGGGTTGAGAAAGAAAAGG + Intronic
1070586112 10:77767527-77767549 GTACAGGGTTGAGAGAGGAATGG + Intergenic
1071574169 10:86713920-86713942 GCCTAGGGTTGGGGGAGAGGAGG - Intronic
1072492514 10:95921376-95921398 GCCTGGGGATGAGAGAGAGGTGG + Intronic
1072835845 10:98710949-98710971 GTGAAGGGTTGAGAGATGGGAGG + Intronic
1073426318 10:103457721-103457743 GTGCATGGGTGAGAGAGAGGAGG - Intronic
1074322168 10:112413385-112413407 GTAGAGGGTGGAGGTAGAGGTGG - Intronic
1076067252 10:127458627-127458649 GTACAGGGTGGAGAAAGAGCAGG + Intergenic
1077027012 11:444684-444706 GTGAAGGGTGGAGAGGGAGGGGG + Intergenic
1077874361 11:6291458-6291480 GTATAGAGTTGGGGGGGAGGAGG - Intergenic
1078362130 11:10677178-10677200 GTACAGGGTTGGGAGAGTGGAGG - Intronic
1079243011 11:18733818-18733840 GAGGAGGGTGGAGAGAGAGGGGG + Intronic
1079505319 11:21146634-21146656 GTATAGCTATGAGAGTGAGGTGG + Intronic
1083108964 11:60386393-60386415 TTACAGGGTTGAAAGAGAGGAGG - Intronic
1084457258 11:69275087-69275109 GAATATGGTTAAGAGAAAGGTGG + Intergenic
1084858312 11:72002755-72002777 GAAAAGGGATGAGAGAAAGGAGG + Intronic
1088835090 11:113571014-113571036 GTATTGTCTTGAGAGAGAAGAGG + Intergenic
1089601591 11:119618852-119618874 GAACAGGATTGAGAGAGAAGAGG + Intergenic
1090424911 11:126600949-126600971 GTGGAGGGGTGAGAGAGAGAAGG - Intronic
1092066212 12:5591586-5591608 GTAGAGGATTGAGAGAAGGGTGG + Intronic
1092686955 12:11059162-11059184 GTCCAGGGATGAGAGAGAGGAGG - Intronic
1093007218 12:14063663-14063685 GTAAAATGTTGACAGAGAGGGGG + Intergenic
1093025816 12:14244413-14244435 GCATGGGGGTCAGAGAGAGGAGG - Intergenic
1093652874 12:21663896-21663918 GACTGGGGATGAGAGAGAGGCGG - Intronic
1094340185 12:29402472-29402494 GCAGAGGGTTGAGAGAAAGAGGG + Intergenic
1095667325 12:44817834-44817856 GTCAAGGGTTGAGAGTGGGGAGG - Intronic
1096718241 12:53503653-53503675 GTATAGGGGGAAGAGAGGGGTGG - Intronic
1097666544 12:62483782-62483804 GTGTGTGGTGGAGAGAGAGGAGG + Intronic
1097870223 12:64595818-64595840 GAATGGGATTGAGAGAAAGGAGG - Intergenic
1098542264 12:71670057-71670079 GTATAGGGTTGAGGGGGATGGGG + Intronic
1099783297 12:87228590-87228612 GATTAAGGTTGAAAGAGAGGTGG - Intergenic
1099887052 12:88544530-88544552 GTATAGGGATGGGGGTGAGGGGG - Intronic
1100216871 12:92459689-92459711 GTAAAGCATTTAGAGAGAGGAGG - Intergenic
1100793879 12:98159429-98159451 ATCTAGGGTTCAGGGAGAGGAGG + Intergenic
1102057089 12:109904876-109904898 GTACCGGGTTGAAACAGAGGAGG + Intronic
1103342310 12:120227646-120227668 ATGAAGGGTGGAGAGAGAGGAGG - Intronic
1103389069 12:120557175-120557197 GGATAGAGATGAGAGAGATGCGG + Intronic
1104209718 12:126677063-126677085 GGATAGGGTTGAGAGACTTGAGG + Intergenic
1104308791 12:127635056-127635078 GAATAGGTTTGAGAGAGAATTGG + Intergenic
1106317340 13:28606307-28606329 GCATAGGGTTGAGGAAGAGATGG + Intergenic
1106836585 13:33641542-33641564 GAATGGGATTGAGAGACAGGAGG + Intergenic
1108492859 13:50998859-50998881 GTCCAGGGTGGGGAGAGAGGTGG - Intergenic
1108523530 13:51265483-51265505 GTATAGGGTTGGGTGTAAGGTGG - Intronic
1108625908 13:52228688-52228710 GGAAAGGGTTGCGAGAGAGTGGG - Intergenic
1108660158 13:52577792-52577814 GGAAAGGGTTGCGAGAGAGTGGG + Intergenic
1111452109 13:88432955-88432977 GTTTAGAGTGGAAAGAGAGGTGG - Intergenic
1114428454 14:22640167-22640189 GTATAGGGAAGGGGGAGAGGGGG + Intergenic
1114621851 14:24100897-24100919 GTGCAGGGCTGAGGGAGAGGTGG - Intronic
1114927973 14:27428578-27428600 TTAGAGGATTGAGATAGAGGGGG + Intergenic
1117119976 14:52556500-52556522 GCCTATAGTTGAGAGAGAGGGGG + Intronic
1117251126 14:53939819-53939841 GAGTAGGGGTGAGGGAGAGGGGG - Intergenic
1119287542 14:73467728-73467750 GTTGAGGATAGAGAGAGAGGAGG + Intergenic
1120482423 14:85068023-85068045 GGATAAAGTTGAGAGAGGGGAGG - Intergenic
1121126194 14:91408252-91408274 TTCAAGGGTTGAGGGAGAGGAGG - Intronic
1121407892 14:93729894-93729916 AAATGGGGTTGAGAGGGAGGGGG + Intronic
1121994163 14:98588984-98589006 CTAGAGCGTTGAGAGAGAGAAGG - Intergenic
1122456904 14:101860893-101860915 TTATTGGGTTCAGAGAGATGCGG + Intronic
1122961848 14:105097532-105097554 GTAGAGGGTTGGGAGGCAGGGGG - Intergenic
1125846500 15:42859592-42859614 GTAATGGGTGGAGAGAGGGGAGG - Intronic
1126114912 15:45199542-45199564 GTCTAGGGGTGAGGGTGAGGAGG - Intronic
1126424805 15:48515763-48515785 CTAGAGGTTTGAGAGTGAGGTGG - Intronic
1127147748 15:56042409-56042431 GTACTGGGTAGAGGGAGAGGTGG - Intergenic
1129007905 15:72389826-72389848 GAAAAGGGTTGAGAGAAGGGTGG - Intergenic
1129561636 15:76577070-76577092 GCCTGGGGTTGAGAGAGGGGTGG - Intronic
1129600140 15:76994022-76994044 GCCCAGGGTTTAGAGAGAGGGGG - Intronic
1130206229 15:81878297-81878319 GGAGAGGGGAGAGAGAGAGGGGG - Intergenic
1130271278 15:82450188-82450210 GTTTTGTGTTGAGAGAGAGGTGG + Intergenic
1130412989 15:83662900-83662922 GCAGAGGGTTGAGGGAGAGCTGG - Intronic
1130463616 15:84177524-84177546 GCTTTGTGTTGAGAGAGAGGTGG + Intronic
1130489056 15:84417259-84417281 GTTTTGTGTTGAGAGAGAGGTGG - Intergenic
1130500649 15:84496018-84496040 GCTTTGTGTTGAGAGAGAGGTGG - Intergenic
1130730364 15:86485925-86485947 GTATTGGGTTTAAAAAGAGGAGG - Intronic
1131670457 15:94614395-94614417 GAATGGGGTTCAGAGAGAAGCGG + Intergenic
1136234196 16:28904351-28904373 TTACAAGGTTGAGAGGGAGGCGG - Exonic
1137361387 16:47819336-47819358 GTAAAGGGAGGAGAGAGTGGGGG - Intergenic
1137463962 16:48691317-48691339 GTATTGGCTGGAGAGAGAGAGGG - Intergenic
1138658819 16:58506214-58506236 GTGAAGGGTTCAGTGAGAGGAGG + Intronic
1140134191 16:72190663-72190685 TTGCAGGGGTGAGAGAGAGGTGG + Intergenic
1140219965 16:73036601-73036623 GTAGAGGGTAGAGGAAGAGGAGG + Intronic
1141272604 16:82554861-82554883 TTAAAGGGTTGAGAGAGAAAAGG - Intergenic
1141531875 16:84651926-84651948 CTATAGAGTTGAGAAAAAGGGGG + Intronic
1141874501 16:86813351-86813373 GAATCGGGTTGGGAGAGAGTGGG + Intergenic
1142274106 16:89106877-89106899 GGATGGGGTTGGGGGAGAGGAGG + Intronic
1142497530 17:314301-314323 CTGTGGGGTTGAGAGACAGGAGG + Intronic
1145091737 17:19991794-19991816 TTAAAGGGTTCTGAGAGAGGAGG + Intergenic
1149296022 17:55263770-55263792 GGAGAGGGTTGTAAGAGAGGAGG - Intergenic
1150985321 17:70189731-70189753 GTATAGGGCTGAGAGGCAGGAGG - Intergenic
1154115678 18:11611104-11611126 GTAGAGGGGCAAGAGAGAGGTGG + Intergenic
1154120125 18:11645323-11645345 GTAGAGGGGCAAGAGAGAGGTGG + Intergenic
1155865908 18:30964485-30964507 GTATAGTGTGGAGTGTGAGGTGG - Intergenic
1156324585 18:36062772-36062794 GCCTAGGGTTGGGAGAGATGGGG + Intronic
1156772209 18:40742267-40742289 GTAAAGGTTTGTGCGAGAGGAGG - Intergenic
1157990407 18:52489050-52489072 ATAAAGGGTTGACAGAGAGTAGG - Intronic
1159571946 18:70124624-70124646 GCATATGTTAGAGAGAGAGGAGG + Intronic
1161152233 19:2715940-2715962 GTGTAGGGTATACAGAGAGGTGG - Exonic
1161498019 19:4598029-4598051 GGACGGGGTTGAGAGAGGGGAGG + Intergenic
1161642867 19:5435345-5435367 GTATTGGGTTGTGGGGGAGGTGG - Intergenic
1162503689 19:11069530-11069552 GTCAAGGGTGGAGAGAGAGGTGG - Intergenic
1162557355 19:11395602-11395624 GTCTAGGGTCGAGTGAGAGAAGG - Intronic
1164772097 19:30817067-30817089 GTATGAGGTGGAGGGAGAGGCGG - Intergenic
1165379486 19:35468237-35468259 GTATACGGTGGGGAGAGAGGTGG + Intergenic
1168330226 19:55563839-55563861 GTAGAGGGGGGAGAGAGAAGGGG - Intergenic
925595655 2:5553142-5553164 GAAGAGGGTGGAGAGAGTGGAGG - Intergenic
925745248 2:7038586-7038608 GAAAAGGGTGGAGAGAGAGAAGG + Intronic
925799884 2:7588184-7588206 GTATATGGTTTAGAGATGGGGGG - Intergenic
925895209 2:8466141-8466163 GTATGAGGCTTAGAGAGAGGAGG - Intergenic
927425523 2:22977220-22977242 ATATGGGGGTGAGGGAGAGGAGG - Intergenic
929399530 2:41563922-41563944 ATACAGGGTTGTGAGTGAGGAGG - Intergenic
929630688 2:43458560-43458582 GAATAGAATTGAGAGATAGGCGG - Intronic
930055724 2:47250668-47250690 GTATAGGATGGAGAGCCAGGAGG + Intergenic
930633755 2:53782677-53782699 GTACAGGGTGGAAGGAGAGGAGG + Intronic
931941222 2:67254111-67254133 GTATAGAGTTTAGGGAGATGTGG - Intergenic
935049916 2:99516619-99516641 GAAAAGGGGTGGGAGAGAGGTGG - Intergenic
938086690 2:128406514-128406536 GTATAGGGTGGAGAAAGGGAGGG + Intergenic
939297510 2:140288092-140288114 GTATAAAGATGAGAGAAAGGAGG - Intronic
939457059 2:142450914-142450936 GGATAGGGATGAGGGAGATGAGG + Intergenic
940830657 2:158461653-158461675 ATATAGGGTAGGGAGGGAGGGGG + Intronic
943472085 2:188306626-188306648 GAATAGGGTAGAAAGAGAAGAGG + Intronic
944376032 2:199043111-199043133 ATCTAGGGTTGAGATGGAGGTGG - Intergenic
945442662 2:209898745-209898767 GTAGGGGGTTGAGGGAGAGGTGG - Intronic
946208657 2:218129551-218129573 GGAGAGGGTTGTGAGGGAGGAGG - Intronic
946459937 2:219859921-219859943 GTTTAAGGTGGAGAGAGAGATGG - Intergenic
946541688 2:220690981-220691003 GTCTAGAGTTGAAAGAAAGGAGG - Intergenic
947416083 2:229897817-229897839 ACATAGGGGGGAGAGAGAGGAGG - Intronic
948173878 2:235928311-235928333 GTGTGGGATTGAGAGAGAGAAGG + Intronic
1169766687 20:9154709-9154731 GGAGAGGGTTGTGGGAGAGGTGG - Intronic
1170781441 20:19429257-19429279 GTATTGGGTTGACCCAGAGGAGG + Intronic
1173777491 20:45722795-45722817 GTATTGGGATGAGAGAGAAAGGG + Intronic
1173861492 20:46286675-46286697 TAATAGGGCTGAGTGAGAGGGGG + Intronic
1174961625 20:55163977-55163999 CTAGAGGGGTGAGAAAGAGGAGG - Intergenic
1177767612 21:25476057-25476079 GTAGAAGGAAGAGAGAGAGGTGG - Intergenic
1179281940 21:39941226-39941248 GTATGGTGATGAGAGAGATGTGG + Intergenic
1182275353 22:29185073-29185095 GACTGGGGTTGAGAGAGATGGGG + Intergenic
1184274527 22:43402664-43402686 GTATAGGGATGGGAGTCAGGAGG + Intergenic
949181036 3:1131645-1131667 GGATAGAGCTGAGACAGAGGTGG + Intronic
950405120 3:12799430-12799452 GTGTAGGGATGGGAGAGAGAAGG - Intronic
951942168 3:28091553-28091575 GTATAGTCCAGAGAGAGAGGAGG + Intergenic
952149547 3:30573375-30573397 GTAGGGGGTTGAGGGAGAAGTGG + Intergenic
955508289 3:59653884-59653906 GAATAGGGTGGTGAGAGAGCAGG - Intergenic
955772804 3:62403232-62403254 TTATAGGGCAGAGAGAGAGCAGG + Intronic
957803135 3:85111617-85111639 GTATAGGGTTGTGGAGGAGGTGG + Intronic
957969698 3:87366872-87366894 GGAGAGGGTTGAGAGAGATAAGG + Intergenic
958176934 3:90007873-90007895 GTATAGGAGAGAGAGAGAGCTGG + Intergenic
959040875 3:101422248-101422270 GGATGGGGTTGAGAGTGGGGTGG - Intronic
959474284 3:106790525-106790547 GTCTGGGGTTGGGAGAGGGGTGG - Intergenic
960480736 3:118186003-118186025 GTCTAAGAGTGAGAGAGAGGTGG - Intergenic
961207334 3:125095344-125095366 GTATAGGTGTGAGAGAAAGAAGG - Intronic
961624956 3:128255301-128255323 GTATGGGGTTGTCAGGGAGGAGG + Intronic
962803028 3:138906421-138906443 GAATATGCTTGAGAGAGAGAAGG + Intergenic
964686709 3:159403819-159403841 GCCTAGGGTTGAGAGAGGGGTGG - Intronic
965033695 3:163406606-163406628 ATAGAGGGTTAAGAGACAGGAGG + Intergenic
966440184 3:179936169-179936191 GGATAGGGTAGTGAGAGTGGTGG + Intronic
968084791 3:195869434-195869456 GGAGAGGAGTGAGAGAGAGGGGG + Intronic
968138834 3:196239324-196239346 CTTTAAGGTTGAGAGAGAGCTGG + Intronic
968863460 4:3191608-3191630 GTAGATGGTAGAGATAGAGGTGG + Intronic
969647958 4:8444284-8444306 GTGGAGGGTTGGGGGAGAGGTGG + Intronic
970471640 4:16385074-16385096 GTGTAGATTTGAGGGAGAGGTGG + Intergenic
972988958 4:44799654-44799676 GAGCAGGATTGAGAGAGAGGGGG - Intergenic
973758895 4:54099906-54099928 GTAAAGCGTGGAGAAAGAGGGGG + Intronic
973785400 4:54327997-54328019 GGATAGGGGAGAGAGAAAGGAGG + Intergenic
975509521 4:75178290-75178312 AAAAAGGGATGAGAGAGAGGAGG - Intergenic
975617229 4:76258410-76258432 GTTGAGAGTGGAGAGAGAGGTGG + Intronic
975647078 4:76555806-76555828 GGGTAGGGTAGGGAGAGAGGTGG - Intronic
976563229 4:86525366-86525388 CTAGAGGGATGAGAGTGAGGAGG + Intronic
977740025 4:100468241-100468263 GCATAGGGCTGAGAGAAATGTGG + Intronic
978606979 4:110491511-110491533 ATATAGACTAGAGAGAGAGGAGG + Intronic
982833499 4:160092650-160092672 GCAAAGGGGTGAGAGAGAGTCGG + Intergenic
984623536 4:181979714-181979736 TTATAGGGCTGAGTGAGATGAGG - Intergenic
984701581 4:182821985-182822007 GAATGGGGCTGAGAGAGAGGAGG + Intergenic
985048509 4:185966217-185966239 GAATGGGGCTGAGAGACAGGAGG + Intergenic
987542634 5:19275456-19275478 GTAGGGGGTAGAGAGAGAGCAGG - Intergenic
987866680 5:23549867-23549889 GAATAAGGGTGAGAGACAGGAGG - Intergenic
991237622 5:64417853-64417875 GCCTGGGGTTGGGAGAGAGGTGG - Intergenic
991625131 5:68593412-68593434 AGATAGGGCTGAGGGAGAGGGGG + Intergenic
991630261 5:68649605-68649627 TTTTAGGGATGGGAGAGAGGTGG - Intergenic
993539747 5:89134354-89134376 GGATTGGGTTGAGATAGTGGAGG - Intergenic
994699954 5:103120885-103120907 GTGTGGGGTTGACAGAGAGAGGG - Intronic
995997620 5:118320553-118320575 GGATAGGGATGAGGAAGAGGAGG + Intergenic
997104544 5:131004192-131004214 GGCTAGGGTTGGGGGAGAGGTGG - Intergenic
997668506 5:135651294-135651316 GGACATGGTTGAGAGGGAGGGGG - Intergenic
998790773 5:145764287-145764309 GTATAGGGTTAACAGATAGTGGG - Intronic
999084611 5:148876577-148876599 GTAAATGTTTGAGAGAGAGATGG + Intergenic
1000707892 5:164534307-164534329 GTATATTCTTAAGAGAGAGGTGG - Intergenic
1000734780 5:164885694-164885716 TTAGAGGGTGGAGAAAGAGGAGG + Intergenic
1001291525 5:170466170-170466192 GCATGGGGTAGAGAGAGAGAAGG + Intronic
1002929954 6:1626583-1626605 CTATAGGATTGAGAGAGGGGAGG - Intronic
1003985581 6:11431498-11431520 GGCTAGGGGTGAGGGAGAGGAGG - Intergenic
1004118448 6:12794823-12794845 GCATAGGGATTAGAGAGAGTGGG + Intronic
1005481756 6:26261573-26261595 GGAAAGGATTGAGAGACAGGAGG - Intergenic
1006175180 6:32117186-32117208 GTGGAGGGTTGAGTGGGAGGTGG - Intronic
1007100746 6:39244701-39244723 GTATAGGGTGGAGTGAGGAGGGG + Intergenic
1008648168 6:53537213-53537235 GTGTATGCTAGAGAGAGAGGGGG - Intronic
1009763273 6:68036375-68036397 GTAGAGGGAAGAAAGAGAGGGGG + Intergenic
1009840980 6:69073816-69073838 GTAGAGGGGTGAGGGAGGGGAGG - Intronic
1010579341 6:77574907-77574929 ATAGAGGATTGAGAGACAGGAGG - Intergenic
1013017743 6:106176427-106176449 GTATAGAGTAGAAAGAGAAGAGG - Intergenic
1013535700 6:111061357-111061379 GTTTAGGAATGAAAGAGAGGAGG - Intergenic
1015205185 6:130629710-130629732 GGATATGGGGGAGAGAGAGGGGG + Intergenic
1016911600 6:149204726-149204748 GTGTAGGATGGAGAGAAAGGTGG + Intergenic
1017274401 6:152549178-152549200 GTATGGATGTGAGAGAGAGGAGG - Intronic
1020786549 7:12580585-12580607 GTACAGGGTTGGGACAGAGATGG - Intronic
1021601187 7:22365365-22365387 TTATAGGATTGAAAGAGAAGGGG + Intergenic
1022760793 7:33348152-33348174 GCTTAGGGATGAGAGAGATGGGG - Intronic
1022781308 7:33587190-33587212 GTATAGGGATGACAGGGTGGTGG - Intronic
1022825618 7:34009627-34009649 GTATAAATGTGAGAGAGAGGTGG + Intronic
1022974256 7:35543302-35543324 TGATAGGGGTGAGAGTGAGGTGG - Intergenic
1023641635 7:42264851-42264873 GTCTAGGGTGGAGAGAGAGAGGG + Intergenic
1024606265 7:51024978-51025000 GGAGTGGGTTGAGAGAGAGCCGG - Intronic
1024613457 7:51086590-51086612 GTATATGGGAGAGAGAAAGGGGG + Intronic
1024890669 7:54198132-54198154 GTAGAGGGGTGAGAGAGGGAGGG - Intergenic
1024928830 7:54647594-54647616 GGTTAGGGTTGGGTGAGAGGGGG + Intergenic
1026011562 7:66640154-66640176 GAACAGGGTTTAAAGAGAGGGGG - Exonic
1026534706 7:71230064-71230086 GTATAGGGGTGAGAGGATGGAGG + Intronic
1027226727 7:76248304-76248326 GTGTGGGGATGAGGGAGAGGGGG + Intronic
1028595488 7:92543955-92543977 GTAGAGGGGTGGGAGTGAGGTGG + Intergenic
1031373708 7:120998543-120998565 CTATAGGGTCCACAGAGAGGAGG - Intronic
1031420382 7:121544459-121544481 TTATAGGGTTCAAACAGAGGAGG - Intergenic
1033026702 7:137781484-137781506 AAATTGGGTTGAGAGAGAGGAGG - Intronic
1033202814 7:139388452-139388474 GTATAGGGTGAAGAGAAATGGGG - Intronic
1033591914 7:142815990-142816012 GGAAAGGGATGAGAGAGAGGTGG + Intergenic
1034647856 7:152664540-152664562 GTGTAGGGTTGGGGGACAGGCGG - Intronic
1035483711 7:159206236-159206258 GTAAAGGAGAGAGAGAGAGGGGG + Intergenic
1035975193 8:4302559-4302581 GTATAGGGTTGAGAGAGAGGCGG - Intronic
1037040879 8:14231193-14231215 GTGTAGTGGGGAGAGAGAGGGGG + Intronic
1038111732 8:24507278-24507300 CTATGGGATTGAGGGAGAGGAGG - Intronic
1039905622 8:41784248-41784270 GAATGGGGTAGAGAGAGTGGGGG - Intronic
1041750786 8:61258910-61258932 GTATAGAGTAAACAGAGAGGAGG + Intronic
1042060496 8:64811689-64811711 GTTGTGGGTTGAGAAAGAGGAGG + Intergenic
1042157094 8:65856040-65856062 GTATGGGGCAGAGAGAGATGGGG - Intergenic
1044365795 8:91343608-91343630 GGATAGAGATGAGAGAGAGAAGG - Intronic
1046018421 8:108634416-108634438 GTACAGTGTTGGGAGAGAGGAGG - Intronic
1046157970 8:110318973-110318995 CTCTGGGGTTGAGAGGGAGGTGG + Intergenic
1046507283 8:115152280-115152302 GTAGTGGGTTGAAACAGAGGAGG + Intergenic
1047024327 8:120810746-120810768 ATAAAGGGGTGAGAGAGAGGTGG - Intronic
1047547139 8:125829273-125829295 ATATAGGACTGAGAGAGAGGGGG - Intergenic
1048000776 8:130377827-130377849 CTGAAGGGGTGAGAGAGAGGAGG - Intronic
1048416351 8:134231622-134231644 TTTTGGAGTTGAGAGAGAGGGGG - Intergenic
1049280952 8:141744209-141744231 CAATAGGGTTGAGGGAGAGATGG + Intergenic
1049354355 8:142180191-142180213 GTTCAGGGGTGAGAGGGAGGAGG + Intergenic
1050362028 9:4839269-4839291 GTATTGGGATGGGTGAGAGGAGG + Intronic
1052713730 9:32089617-32089639 TTATGGGGCTGAGAGGGAGGCGG + Intergenic
1057337259 9:94166001-94166023 GTGGAGGGCTGAGAGAGTGGCGG - Intergenic
1059842047 9:118228581-118228603 TTTTATGGTTGAGAGAGATGGGG + Intergenic
1059885259 9:118738308-118738330 GTTTGGGGTGGAGAGAGAGAGGG - Intergenic
1060304422 9:122398074-122398096 GCCTAGGGTTGGGAGAGGGGTGG - Intergenic
1061392738 9:130326944-130326966 GGAGAAGGTAGAGAGAGAGGAGG + Intronic
1186262819 X:7798557-7798579 CTAGATGGTTGAGAGACAGGTGG - Intergenic
1188034048 X:25296863-25296885 GGGTAGGGTAGAGAGTGAGGAGG + Intergenic
1188121136 X:26309541-26309563 GCATAGGTCTGAAAGAGAGGAGG - Intergenic
1189420066 X:40849035-40849057 GAATGGGGGTGAGAGGGAGGTGG - Intergenic
1189422179 X:40866096-40866118 ATATAGGGGTGACAGGGAGGTGG - Intergenic
1190332581 X:49244993-49245015 GGAGAGGGGTGACAGAGAGGTGG - Intronic
1190620903 X:52285621-52285643 GTCTGTGGTGGAGAGAGAGGAGG + Intergenic
1190714920 X:53094964-53094986 CTTTAGGGTTGAGAAAGAGACGG - Intergenic
1190885642 X:54529381-54529403 GTTTAGGCTTGAGGAAGAGGAGG + Intergenic
1191700601 X:64038064-64038086 GCCTGGGATTGAGAGAGAGGTGG - Intergenic
1191996620 X:67102581-67102603 GTATAGGATAAAGAGTGAGGGGG - Intergenic
1192337626 X:70235329-70235351 GTATAGGGGTGAGGGAGAGTGGG + Intronic
1194173356 X:90617230-90617252 GCCTAGGGTTGTGATAGAGGTGG + Intergenic
1195679235 X:107531368-107531390 GCAAGGGGGTGAGAGAGAGGAGG - Intronic
1195811475 X:108836341-108836363 TCATAGGGTGGAGAGAGAGGAGG + Intergenic
1196131305 X:112159878-112159900 ATATAGGCATGAGAAAGAGGAGG - Intergenic
1196257527 X:113539126-113539148 GAATAAGATTGAGAGACAGGAGG + Intergenic
1197132855 X:123024955-123024977 GTATAAGGTGAAGAGAGATGAGG - Intergenic
1199664110 X:150082966-150082988 CTATAAGGTGGAGAGAGTGGGGG - Intergenic