ID: 1035975194

View in Genome Browser
Species Human (GRCh38)
Location 8:4302562-4302584
Sequence ATCGTATAGGGTTGAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 82}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035975194_1035975197 -9 Left 1035975194 8:4302562-4302584 CCTCTCTCTCAACCCTATACGAT 0: 1
1: 0
2: 0
3: 13
4: 82
Right 1035975197 8:4302576-4302598 CTATACGATAATGCACCGTAAGG No data
1035975194_1035975199 -7 Left 1035975194 8:4302562-4302584 CCTCTCTCTCAACCCTATACGAT 0: 1
1: 0
2: 0
3: 13
4: 82
Right 1035975199 8:4302578-4302600 ATACGATAATGCACCGTAAGGGG No data
1035975194_1035975198 -8 Left 1035975194 8:4302562-4302584 CCTCTCTCTCAACCCTATACGAT 0: 1
1: 0
2: 0
3: 13
4: 82
Right 1035975198 8:4302577-4302599 TATACGATAATGCACCGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035975194 Original CRISPR ATCGTATAGGGTTGAGAGAG AGG (reversed) Intronic
902965572 1:19998736-19998758 ATTGTATGGGGGTGAGAGAATGG - Intergenic
906655444 1:47545057-47545079 ATGGTTGAGGGGTGAGAGAGAGG + Intergenic
906873754 1:49513413-49513435 ATCCTAGAGGGTGGAGGGAGTGG - Intronic
907735110 1:57104700-57104722 ATGGCATTCGGTTGAGAGAGAGG + Intronic
907774062 1:57495681-57495703 ATGGTATAGGGTTCAAGGAGAGG + Intronic
907840055 1:58148270-58148292 ACCCTGTAGGGGTGAGAGAGTGG - Intronic
908598047 1:65709343-65709365 CTAAAATAGGGTTGAGAGAGTGG - Intergenic
910803920 1:91171747-91171769 ATAGTATAGTGCTGAGAGAGAGG + Intergenic
912337452 1:108876367-108876389 ATCGTACAGAGTTCAGATAGAGG - Intronic
915179833 1:154048612-154048634 ATTGTACAGGGGTGAGGGAGTGG - Intronic
917903561 1:179567603-179567625 GTCGAATAGGGTGGTGAGAGAGG + Intronic
922616145 1:226962276-226962298 ATGGCACAGGGATGAGAGAGAGG - Intronic
923212755 1:231820216-231820238 ATAATCTAGGGTTGAGAGTGTGG + Intronic
1064039285 10:11944691-11944713 AACGTAAAGGATGGAGAGAGGGG - Intronic
1065041953 10:21706193-21706215 ATTAAATAGGATTGAGAGAGGGG - Intronic
1067133439 10:43586960-43586982 ATTGTACAGGGGTGAGGGAGTGG - Intergenic
1069357940 10:67609191-67609213 ATCGTAGAGGAATGAGAGAAAGG + Intronic
1069491705 10:68866799-68866821 ATTGTATAGGGGTGAGGGAGTGG + Intronic
1076790521 10:132774787-132774809 ATCCTACAGGGAGGAGAGAGGGG + Intronic
1077746390 11:4911490-4911512 ATTGAAGATGGTTGAGAGAGAGG - Intronic
1078362131 11:10677181-10677203 AAAGTACAGGGTTGGGAGAGTGG - Intronic
1087013738 11:93537082-93537104 ATCCTATAGGGATGAGAGGGAGG - Intronic
1087211366 11:95448772-95448794 ACCCTTTAGGGTTGAGGGAGTGG - Intergenic
1096993138 12:55821247-55821269 ATCGCATAGAGTTCAGAGACTGG - Exonic
1103445980 12:120995520-120995542 ATGGTATAGAGTGGAGTGAGTGG - Intronic
1104559956 12:129834494-129834516 ATCTTTCAGGGCTGAGAGAGGGG - Intronic
1109352056 13:61195426-61195448 ATCGTGTATGGCTGAGACAGTGG + Intergenic
1109680335 13:65744003-65744025 ATTGTATAAAGCTGAGAGAGGGG - Intergenic
1111438040 13:88238401-88238423 ATCCTATAGGGTCTAGAAAGAGG + Intergenic
1113724319 13:112587454-112587476 ATCCTGTGGGGTGGAGAGAGCGG - Intronic
1115095098 14:29625482-29625504 ATCGTATAGGGGTGAGACAAGGG - Intronic
1117175202 14:53138899-53138921 ATAGTGCAGGGTTGGGAGAGGGG + Intronic
1120695420 14:87639159-87639181 ATAGTATAGGGTTTAGAGCATGG - Intergenic
1122498697 14:102178912-102178934 ATTATATAGAGATGAGAGAGGGG + Intronic
1122652938 14:103236008-103236030 ATTGTACAGGGTTGAGGGAATGG - Intergenic
1124389240 15:29239064-29239086 CTTGTATTGGCTTGAGAGAGTGG - Intronic
1128727976 15:70001796-70001818 ATAATATAAGGCTGAGAGAGAGG + Intergenic
1139837316 16:69849590-69849612 ATGGAATAGGATTGAGACAGTGG + Intronic
1141985221 16:87575481-87575503 TTCCCCTAGGGTTGAGAGAGCGG + Intergenic
1145802421 17:27696814-27696836 ATTGTACAGGGGTGAGGGAGTGG - Intergenic
1146133071 17:30294991-30295013 ATCGTAATGAGTTGAGAGGGAGG + Intergenic
1147853072 17:43457496-43457518 ATACTTTAGGGTTGAGAGTGTGG + Intergenic
1149215562 17:54349877-54349899 AGGGTATGGGGTTGAGAAAGGGG - Intergenic
1150983722 17:70171416-70171438 AACGTACTGGGCTGAGAGAGAGG - Intronic
1153716463 18:7854667-7854689 AAATTAAAGGGTTGAGAGAGTGG + Intronic
1159115413 18:64107752-64107774 ATCTTATAGGGTAGAGTCAGAGG + Intergenic
1165417469 19:35703584-35703606 ATGGTAAAGGGTTGAGAGAAAGG + Intergenic
1167515029 19:49918406-49918428 AACATATAGGGGTGGGAGAGGGG - Intronic
1167863574 19:52305749-52305771 ATTGTATGGGGGTGAGGGAGTGG + Intronic
1168307084 19:55441608-55441630 AGCGGAAAGTGTTGAGAGAGAGG - Intronic
933160360 2:79016981-79017003 ATTGTTTATGGTAGAGAGAGGGG + Intergenic
934939807 2:98492565-98492587 ATCTCAAAGGGGTGAGAGAGCGG + Intronic
936563096 2:113559008-113559030 ATTGTATAGTGGTGAGAGACTGG - Intergenic
943336954 2:186627116-186627138 ATCTCATGGGGTTGAGAGTGGGG + Intronic
945281607 2:208040694-208040716 TTGGTCTAGGGTTGGGAGAGGGG - Intergenic
1169427668 20:5509393-5509415 GTTGTACTGGGTTGAGAGAGAGG - Intergenic
1174961763 20:55165854-55165876 ATTCTTTATGGTTGAGAGAGGGG + Intergenic
950978186 3:17272990-17273012 ATTGTAGAGGGTTGAGAAAAAGG - Intronic
956209930 3:66792106-66792128 AAGGTATAGGGTTGTTAGAGAGG + Intergenic
961741633 3:129036611-129036633 ATGGGACAGGGTTGAGACAGTGG - Intronic
968048341 3:195636225-195636247 ATGTTATAGGGTTGATAGAGAGG + Intergenic
968099063 3:195953395-195953417 ATGTTATAGGGTTGATAGAGAGG - Intergenic
968306269 3:197653696-197653718 ATGTTATAGGGTTGATAGAGAGG - Intergenic
969880807 4:10172426-10172448 ATTGTACAGGGGTGAGAGAGTGG + Intergenic
973926233 4:55740963-55740985 GTGGTATAGTGTTGAGAGAGTGG + Intergenic
976557081 4:86462050-86462072 ATTGTATAGGGGTGAGGGAGTGG - Intronic
977652888 4:99490280-99490302 ATTGTATAGGGGTGAGGGAATGG + Intergenic
979378553 4:119979552-119979574 ATCATATAGGGGTGAGAGTCAGG - Intergenic
980596314 4:134959866-134959888 ATAATGTAGGGTAGAGAGAGTGG - Intergenic
983389707 4:167113882-167113904 TTCTTATTGGGTTTAGAGAGTGG - Intronic
983836022 4:172386390-172386412 ATGGTAGAGGGCAGAGAGAGAGG + Intronic
1202755762 4_GL000008v2_random:60762-60784 AACGTATGGGGGTGAGAGAATGG - Intergenic
985500864 5:244146-244168 ATTGTACAGGGGTGAGGGAGTGG - Intronic
991411950 5:66354476-66354498 ATCCTATGGGGTGGAGGGAGTGG - Intergenic
996291717 5:121859611-121859633 ATTGTATAGGGGTGAGGGAATGG + Intergenic
998809572 5:145952778-145952800 ATCATATAGGGAAGAGAGGGCGG + Intronic
1007068792 6:39019574-39019596 CTCGTATAGACGTGAGAGAGGGG + Intronic
1012610726 6:101216195-101216217 AAAGTATAGTGATGAGAGAGAGG + Intergenic
1029675882 7:102068432-102068454 ATCTTATCGGGTTGAGGGGGTGG + Intronic
1032425565 7:131819891-131819913 AAGGCATAGGGTTGGGAGAGGGG - Intergenic
1033026703 7:137781487-137781509 ATTAAATTGGGTTGAGAGAGAGG - Intronic
1034942754 7:155242173-155242195 ATTGTACAGGGTTGAGAGAATGG + Intergenic
1035975194 8:4302562-4302584 ATCGTATAGGGTTGAGAGAGAGG - Intronic
1037183764 8:16036946-16036968 TATGCATAGGGTTGAGAGAGAGG - Intergenic
1037264632 8:17045111-17045133 AGCCTATAGTGTTGAGAAAGAGG + Intronic
1041035786 8:53788685-53788707 ATTGTTTAGTGTTGGGAGAGTGG - Intronic
1041726766 8:61025197-61025219 ATGGTATAAGGTAGAGAGAGAGG - Intergenic
1045517049 8:102868923-102868945 GTTGTAAAGGGTTGAGTGAGGGG + Intronic
1045771376 8:105744190-105744212 ATGATAAAGAGTTGAGAGAGAGG - Intronic
1047024328 8:120810749-120810771 CTCATAAAGGGGTGAGAGAGAGG - Intronic
1049889636 9:56679-56701 ATTGTATAGTGGTGAGAGACTGG + Intergenic
1053126326 9:35583557-35583579 ATTGTATAGGGGTGAGGGAATGG - Intergenic
1057914354 9:99044224-99044246 ATCCTGGAGGGTTGAGAGTGAGG + Intronic
1189445055 X:41073309-41073331 ATGTTATAGGGGTGTGAGAGAGG - Intergenic
1193048722 X:77079178-77079200 ATCGTACAGGGGTGAGGGAATGG - Intergenic
1195995305 X:110725607-110725629 ATTTTATAGGGTGGGGAGAGTGG - Intronic