ID: 1035975198

View in Genome Browser
Species Human (GRCh38)
Location 8:4302577-4302599
Sequence TATACGATAATGCACCGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035975192_1035975198 15 Left 1035975192 8:4302539-4302561 CCGTCTTGAAAGTCAGGTTTCCG 0: 1
1: 0
2: 2
3: 13
4: 124
Right 1035975198 8:4302577-4302599 TATACGATAATGCACCGTAAGGG No data
1035975194_1035975198 -8 Left 1035975194 8:4302562-4302584 CCTCTCTCTCAACCCTATACGAT 0: 1
1: 0
2: 0
3: 13
4: 82
Right 1035975198 8:4302577-4302599 TATACGATAATGCACCGTAAGGG No data
1035975193_1035975198 -5 Left 1035975193 8:4302559-4302581 CCGCCTCTCTCTCAACCCTATAC 0: 1
1: 0
2: 0
3: 23
4: 281
Right 1035975198 8:4302577-4302599 TATACGATAATGCACCGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035975198 Original CRISPR TATACGATAATGCACCGTAA GGG Intronic
No off target data available for this crispr