ID: 1035975538

View in Genome Browser
Species Human (GRCh38)
Location 8:4306736-4306758
Sequence AACACTACCCTGCTGCGGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035975538 Original CRISPR AACACTACCCTGCTGCGGTC GGG (reversed) Intronic
907745679 1:57211272-57211294 AGTACTAAACTGCTGCGGTCTGG + Intronic
913958527 1:143322852-143322874 CACCCTGCCCTGCTGCGCTCTGG - Intergenic
914052844 1:144148232-144148254 CACCCTGCCCTGCTGCGCTCTGG - Intergenic
914126353 1:144818309-144818331 CACCCTGCCCTGCTGCGCTCTGG + Intergenic
915141247 1:153769964-153769986 TACTCCACCCTGGTGCGGTCTGG + Intronic
917482749 1:175426073-175426095 AACAGGAGCCTGCTGAGGTCAGG + Intronic
918223315 1:182455916-182455938 AAAACTACTCTGCAGAGGTCTGG + Intronic
919055906 1:192569646-192569668 AAGACTGCCCTGCTGGGTTCTGG - Intergenic
919253939 1:195096949-195096971 AATACTACCCTGCTGAGACCTGG + Intergenic
1068463009 10:57351407-57351429 AAAACTACCCTGCAGAGATCAGG + Intergenic
1072298082 10:94031584-94031606 AATACTGCCCTTCTGCTGTCAGG - Exonic
1072449121 10:95525323-95525345 CACTGTACCCTGCTGTGGTCAGG + Intronic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1081712927 11:45229077-45229099 ATCACTCCCCTGTTGGGGTCTGG - Intronic
1084498386 11:69519282-69519304 AAAACCACCATGCTGGGGTCAGG + Intergenic
1085786538 11:79456591-79456613 AGCACAACCCTGCTGAGGGCTGG - Intergenic
1088945059 11:114503840-114503862 AAGACTACCCTGCAGAGATCAGG - Intergenic
1091168453 11:133500728-133500750 AACTCCAGCCTGCTGGGGTCAGG - Intronic
1091698561 12:2644356-2644378 CACAATACTCTCCTGCGGTCAGG - Intronic
1092491563 12:8949941-8949963 AACCCTACCCGGGAGCGGTCAGG - Exonic
1101915633 12:108893580-108893602 AAGACTAACCTGCTCTGGTCAGG + Intronic
1109071087 13:57769975-57769997 AACACAACTCTGCTGTGGACTGG - Intergenic
1112747293 13:102541140-102541162 AAAATTACCCTGCTGTGGCCGGG + Intergenic
1113330282 13:109319799-109319821 AAGTCTACCCTGCTCCGGGCTGG - Intergenic
1120723943 14:87916866-87916888 AACACTGCCCTGCAGAGTTCAGG + Intronic
1123775018 15:23570638-23570660 ACCACTCCCCTGCTGCAGTCAGG + Intronic
1124931755 15:34126765-34126787 AACATTCTCCTGCTGCAGTCAGG - Intergenic
1126271060 15:46817440-46817462 GACATTTCCCTGCTGAGGTCAGG + Intergenic
1134238449 16:12486213-12486235 AACTCTTCCCTGCTGTGATCGGG - Intronic
1136017665 16:27414105-27414127 AACACTTCCTTACTGAGGTCAGG - Intronic
1141786293 16:86203017-86203039 ACCACTGCCCTGCAGAGGTCAGG - Intergenic
1151046347 17:70923948-70923970 AACACTGTCCTGCTATGGTCTGG + Intergenic
1152848487 17:82617194-82617216 CACACCACCCTGCTGGGGTGGGG + Intronic
1163273207 19:16266585-16266607 ATCAGGACCCGGCTGCGGTCAGG - Intergenic
1164018360 19:21273440-21273462 AAAACTAACCTGGTGCTGTCGGG - Intronic
1166572273 19:43804752-43804774 AGCACAACCCTGCCCCGGTCTGG - Intronic
925343870 2:3155961-3155983 AACATCACCCTGCTGCCTTCTGG + Intergenic
926808050 2:16730377-16730399 AACACTACTTTGCTGCTGTAAGG + Intergenic
928315278 2:30239861-30239883 TACACTACCCTGCAGAGGGCTGG + Intronic
933954158 2:87353316-87353338 CACCCTGCCCTGCTGCGCTCTGG + Intergenic
934238353 2:90249536-90249558 CACCCTGCCCTGCTGCGCTCTGG + Intergenic
934274836 2:91567174-91567196 CACCCTGCCCTGCTGCGCTCTGG - Intergenic
939162676 2:138608257-138608279 AACACAGCCCTGGTGCAGTCTGG - Intergenic
947197577 2:227584058-227584080 AGCACTACCATTCTGGGGTCTGG - Intergenic
1169273326 20:4217037-4217059 GACACAGCCCTGCTGCCGTCTGG - Intergenic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1182494756 22:30698119-30698141 AAACCCACCCTGCTGCTGTCAGG - Intronic
1184268659 22:43364770-43364792 ACCACTACCCTGCTGCCGGATGG + Intergenic
954927642 3:54250882-54250904 CTCACTACCCAGCTGCTGTCTGG - Intronic
955017888 3:55089602-55089624 AACACTGCTCTGCTGCTGACTGG - Intergenic
959585752 3:108023633-108023655 AACACTACCCTACTACTGTGGGG + Intergenic
960353535 3:116622680-116622702 CACACTACCCTGCTGGCCTCTGG + Intronic
961472652 3:127125867-127125889 AAGACAACCATGCTGAGGTCTGG + Intergenic
962335668 3:134527855-134527877 AAGACTACCCTGCAGAGTTCGGG + Intronic
972312498 4:37893793-37893815 AACACTACTCTGCTGCTGAATGG - Intronic
973988471 4:56379180-56379202 AAGATTACACTGCTGTGGTCAGG - Intronic
980901612 4:138910666-138910688 ACCACCACTCTGCTGCAGTCTGG + Intergenic
982918138 4:161240419-161240441 GATACTACCCTACTGTGGTCTGG - Intergenic
985588024 5:750970-750992 AACACTGGGCTGCTGCCGTCGGG + Intronic
985602693 5:843437-843459 AACACTGGGCTGCTGCCGTCGGG + Intronic
985785345 5:1890311-1890333 AACACTGCCCTTCTGCTGTCAGG - Intergenic
991770684 5:70038067-70038089 AACACTTCCTTGCAGCAGTCTGG + Intronic
991849978 5:70913485-70913507 AACACTTCCTTGCAGCAGTCTGG + Intronic
994212778 5:97104770-97104792 AACAATACCCTACTTGGGTCTGG - Intronic
997253944 5:132412214-132412236 AACACCATCCTGCTGAGGTAGGG - Intronic
998559713 5:143159900-143159922 AACACTACCCTCTTGTGGTATGG + Intronic
1021351213 7:19596025-19596047 AAGACTACCCTGCAGAGATCAGG + Intergenic
1023241348 7:38151189-38151211 AAGACCACCCTGCAGAGGTCAGG - Intergenic
1035169884 7:157011219-157011241 AACCCTCCCCTGCTGCGCCCTGG - Intergenic
1035975538 8:4306736-4306758 AACACTACCCTGCTGCGGTCGGG - Intronic
1036293774 8:7518333-7518355 GACACTGCCCTGCTGCCCTCAGG + Intergenic
1036328787 8:7802662-7802684 GACACTGCCCTGCTGCCCTCAGG - Intergenic
1041758157 8:61336406-61336428 AACACTGCCAGGCTGCAGTCTGG - Intronic
1044433138 8:92132317-92132339 ATGACTACCCTGCTGCGTTTTGG - Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1187009651 X:15266619-15266641 AATACAACCCTGGTGGGGTCAGG - Intronic
1193029078 X:76878830-76878852 GACTCTACCATTCTGCGGTCTGG + Intergenic