ID: 1035978556

View in Genome Browser
Species Human (GRCh38)
Location 8:4341243-4341265
Sequence AACTGCCTTCTGAAAAATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 246}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035978556_1035978557 -10 Left 1035978556 8:4341243-4341265 CCAGTATTTTTCAGAAGGCAGTT 0: 1
1: 0
2: 1
3: 18
4: 246
Right 1035978557 8:4341256-4341278 GAAGGCAGTTGTATGTCATATGG No data
1035978556_1035978558 -9 Left 1035978556 8:4341243-4341265 CCAGTATTTTTCAGAAGGCAGTT 0: 1
1: 0
2: 1
3: 18
4: 246
Right 1035978558 8:4341257-4341279 AAGGCAGTTGTATGTCATATGGG No data
1035978556_1035978559 2 Left 1035978556 8:4341243-4341265 CCAGTATTTTTCAGAAGGCAGTT 0: 1
1: 0
2: 1
3: 18
4: 246
Right 1035978559 8:4341268-4341290 ATGTCATATGGGCATATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035978556 Original CRISPR AACTGCCTTCTGAAAAATAC TGG (reversed) Intronic
901466321 1:9423737-9423759 AACTACATTTTGAGAAATACTGG - Intergenic
903802898 1:25982980-25983002 AACTGCAGTTTGAAAAATCCTGG - Intronic
906825336 1:48973362-48973384 AACTTCCTAATGAAACATACAGG + Intronic
909967669 1:81936273-81936295 AACTTCCTGCTGAGAAATTCAGG + Intronic
910009290 1:82440962-82440984 AACTGTGTTCTGAAAACCACAGG - Intergenic
910060036 1:83079685-83079707 AAATGCCTTCTGAAAGAAATGGG + Intergenic
910496381 1:87833453-87833475 ATTTGCTTTATGAAAAATACGGG + Intergenic
911591074 1:99748760-99748782 AACTGCCATCTCAAAAAGAAGGG + Exonic
911728887 1:101271089-101271111 AACTTCATTCTGAAGCATACAGG - Intergenic
912280204 1:108304859-108304881 CACTGCCAGCTGGAAAATACAGG + Intergenic
912288022 1:108389498-108389520 CACTGCCAGCTGGAAAATACAGG - Intronic
915125555 1:153661118-153661140 AACTAGGTGCTGAAAAATACCGG - Intronic
915234372 1:154469769-154469791 AACAGTCTTCTGACAAATAATGG - Intronic
915317382 1:155036780-155036802 AACTGCCCTCTGCAAGAAACCGG - Intronic
916675244 1:167059763-167059785 TACTGCCCTTTGAAAAAAACTGG - Intronic
916909725 1:169333765-169333787 AACTCCCTTCTGAGAGACACTGG + Intronic
917088827 1:171331419-171331441 AACTGCCTTGTTAAAAACATAGG - Intronic
918753903 1:188310876-188310898 AACTGAATTCTGAACAATCCAGG - Intergenic
919185932 1:194149386-194149408 AACTGCCATTTCAAAAGTACTGG + Intergenic
924570676 1:245234959-245234981 CTCTGCCTTCTGAAAGACACAGG - Intronic
1063372705 10:5532168-5532190 AACTGTCTTTTGACAAATTCTGG + Intergenic
1063413821 10:5857258-5857280 ACATGCCTTCTGAAAAAAAGGGG + Intergenic
1064416562 10:15155043-15155065 AACTTCATTCTGAAGCATACAGG - Intronic
1064577058 10:16757194-16757216 AACTGCGTTAAGAAAAATAAGGG - Intronic
1064751076 10:18529618-18529640 AACAGGCTTCTGAAAAACATAGG + Intronic
1069101474 10:64326619-64326641 AAGTGACTTCAGAAAAATCCAGG + Intergenic
1069674084 10:70234653-70234675 CACAGCCTTCTGAAAATTAATGG - Intergenic
1070155156 10:73829122-73829144 AAATGCCTTCTAAAGAATGCTGG - Intronic
1070167289 10:73908476-73908498 AACTGCCTTATGATATAGACTGG - Intergenic
1071815367 10:89226942-89226964 AACTTCATTCTGAATAAAACTGG - Exonic
1072293833 10:93991385-93991407 ACCTCCTTTCTGAAAATTACAGG + Intergenic
1074337514 10:112593125-112593147 AACTGCATTCTGAAAAGTTTAGG + Intronic
1074354859 10:112773633-112773655 AACTGTCTTCTGCCAGATACTGG - Intronic
1075186790 10:120268606-120268628 AACTGACATCTGAATAATATTGG - Intergenic
1075369478 10:121923168-121923190 GACTGCCTTCTAAAAAGTTCTGG + Intronic
1080119259 11:28657472-28657494 GACTGTCTTCTGAAAATTACTGG - Intergenic
1086076590 11:82860636-82860658 AACTGTATTTTGAAAAATAATGG - Intronic
1087061236 11:93979881-93979903 AACTGCCACGTGAAAAATAGAGG + Intergenic
1089264589 11:117250208-117250230 AACTGAGTCCTGAAAAATAAGGG + Intronic
1090829782 11:130413183-130413205 ATCTGACTTCTTAAAAATAGAGG + Intronic
1092532825 12:9359771-9359793 AACTGGCTTTTGGAAAAGACAGG - Intergenic
1092769827 12:11886395-11886417 ACCTGCATTTTGACAAATACTGG - Intronic
1093529033 12:20138882-20138904 ACCTGCCTTCTGAAAATAAAAGG + Intergenic
1095074489 12:37900080-37900102 AAATATCTTCTGATAAATACTGG - Intergenic
1095428103 12:42100216-42100238 AACTGCACTATGAAGAATACTGG - Intronic
1095909973 12:47416226-47416248 AACTTCCTTCTGTAACACACAGG + Intergenic
1096586709 12:52627543-52627565 AACTGCCTTCTGAGCAAAGCAGG + Intergenic
1097541286 12:60946699-60946721 AACTGGCATCTGAAAAATGGAGG + Intergenic
1097979084 12:65718490-65718512 AATTTCTTTCTGAAAAATAGTGG - Intergenic
1098615950 12:72522672-72522694 ACATCTCTTCTGAAAAATACTGG + Intronic
1100105430 12:91165531-91165553 AACTGCCTTTTGTATAATTCTGG - Intronic
1100175901 12:92030665-92030687 AAGTGCCTTCTCAAAGAAACCGG + Intronic
1100724994 12:97398913-97398935 AATTACCTTCTGAAAAAAAGTGG - Intergenic
1100878666 12:98992279-98992301 ATCTGACTTCTGAATAATAAAGG - Intronic
1101802362 12:108033515-108033537 CACTGCCCTTTGAGAAATACTGG + Intergenic
1102977874 12:117219620-117219642 AACTCTCTTCTGCAAAATCCTGG + Intronic
1104944986 12:132411791-132411813 AGCTGCCTTTTGAAAAATGCTGG - Intergenic
1106973620 13:35177529-35177551 ATCTGCATTTTAAAAAATACAGG + Intronic
1107206635 13:37798322-37798344 AGCTGCCTTCTTAAAAATTGAGG + Intronic
1107255084 13:38416489-38416511 TACTGACTTCTGAGAAATAGTGG + Intergenic
1107546175 13:41435534-41435556 AACTGTCAACTGAAAAATAGTGG - Intergenic
1110240460 13:73260837-73260859 AATTTCCTTCTGAAAAATGATGG + Intergenic
1111158212 13:84356493-84356515 AACTTCCTTCCTTAAAATACTGG + Intergenic
1112153301 13:96788493-96788515 AACTGCATACTAAAAATTACAGG - Intronic
1114599702 14:23944555-23944577 TACTCCCTTCTGAAAATTTCTGG - Intergenic
1115079374 14:29432067-29432089 AAAAGCATTCTGCAAAATACTGG + Intergenic
1115221884 14:31066161-31066183 AACTGTATTTGGAAAAATACTGG + Exonic
1115367225 14:32571767-32571789 AACTGCCTTCTGAGAACTAAGGG + Intronic
1115780085 14:36759339-36759361 AGTTTCCTTCTGAAAAAAACAGG + Intronic
1117769901 14:59123301-59123323 GACTGGATTATGAAAAATACAGG + Intergenic
1119017547 14:71074909-71074931 CATTTCCTTCTTAAAAATACTGG - Intronic
1119984225 14:79117728-79117750 AACTGGATTCTGACAAATGCTGG - Intronic
1120000475 14:79297344-79297366 AACTGACTTTTTAAAAGTACAGG + Intronic
1122014810 14:98786149-98786171 AACTGTCTTCTCATAAATAATGG - Intergenic
1125084045 15:35709278-35709300 AACTTCCTTCTGATTCATACTGG - Intergenic
1126322245 15:47437345-47437367 TACTGCCTACTGAAAATCACAGG - Intronic
1126902113 15:53325317-53325339 ACTTGCCATCTGAAAAATAGTGG + Intergenic
1127338028 15:58009533-58009555 GACTGCCTTCTGGAGAACACAGG + Intronic
1127599382 15:60520131-60520153 AAATGCCTGCTGAAAAGTTCTGG + Intronic
1128164179 15:65447976-65447998 ATTGGCCTTCTGGAAAATACTGG - Intronic
1128219706 15:65959805-65959827 AAATGCCATCTGTGAAATACAGG - Intronic
1128754792 15:70174351-70174373 ATCTGTCTTATGAAAGATACAGG + Intergenic
1129378795 15:75152702-75152724 AACTGACTTCTGGACAATTCTGG + Intergenic
1129440428 15:75577988-75578010 CACTTCCTTCTGAAAACTAAAGG + Intronic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1133528195 16:6627034-6627056 ATCTGCCTTCTGAAAGAACCAGG + Intronic
1133630391 16:7614886-7614908 AACTACCATGTGAAAAATTCTGG + Intronic
1135029308 16:19025296-19025318 AAATACTTTCTGAAAATTACTGG + Intronic
1137281867 16:46984059-46984081 TCCTGCTTTCTCAAAAATACTGG + Intergenic
1138819445 16:60241206-60241228 AACTACATTGTCAAAAATACAGG - Intergenic
1140556521 16:75927648-75927670 AGCTGCCCACTGAATAATACAGG - Intergenic
1140926227 16:79586724-79586746 AACTGCTGTCTGGAAAATATTGG - Intronic
1143654026 17:8282706-8282728 AACTGCCATCCAATAAATACAGG + Intergenic
1144070236 17:11664947-11664969 AAGTATCTTCTGGAAAATACTGG + Exonic
1150216236 17:63471856-63471878 AACTTCATTCTGAAGCATACAGG + Intergenic
1155055920 18:22183791-22183813 AATGCCCTTCTAAAAAATACTGG + Intronic
1156083460 18:33369563-33369585 AACTCCCTTCAGAATAATAAAGG + Intronic
1156419920 18:36940601-36940623 TTCAGTCTTCTGAAAAATACAGG - Intronic
1159341168 18:67135510-67135532 AACTGCCTCCTGAAATAATCTGG - Intergenic
1160223142 18:76991852-76991874 AACTGTCTTCTGAACAACAAGGG - Intronic
1165170901 19:33890850-33890872 AAAAGGCTTCTGAAAAAGACAGG + Intergenic
1165647646 19:37456471-37456493 AGCTTCCTTCTCAAACATACGGG - Intronic
925607792 2:5676202-5676224 ATCTGCTTTGTGGAAAATACTGG + Intergenic
928018902 2:27685298-27685320 AACTGCCCACTGAACAACACAGG - Intronic
929120631 2:38481217-38481239 AAGAGCCTTCTGAAAAATGGAGG + Intergenic
929136984 2:38634277-38634299 CACTGCTTTTTGAAAAATAGTGG - Intergenic
929675618 2:43924960-43924982 AACTGCCTTCTGACAATCCCTGG + Intronic
930139814 2:47939946-47939968 AACTTCCTCCTGAAACATACAGG - Intergenic
931192999 2:60023689-60023711 AATTGCCTTGTGGAAAATTCTGG - Intergenic
931308160 2:61052938-61052960 AAATGCTTTTTAAAAAATACAGG + Intergenic
932074400 2:68649736-68649758 AACTGGCTTCTGAATGACACAGG + Intronic
933018220 2:77158906-77158928 ACCTGTCTTCTGCAAAATATAGG + Intronic
933143600 2:78823775-78823797 AACTGGCTTCTGAAAAAACAAGG + Intergenic
935091346 2:99897978-99898000 GATTACCTTCTGAAAAATACTGG + Intronic
935482822 2:103614449-103614471 AGCTACTTTCTGCAAAATACTGG - Intergenic
935500492 2:103832183-103832205 AACTCCCTTCTCAAAAGTAGGGG - Intergenic
935628743 2:105194320-105194342 AACTGTCATCTGACAAATCCTGG - Intergenic
936653399 2:114456014-114456036 TACTTCCTTCTAAAATATACAGG + Intronic
937957060 2:127427403-127427425 AACCCCCTACTGCAAAATACTGG - Intronic
939300023 2:140324066-140324088 AACTGCCTTTTTAAAATTCCAGG - Exonic
943296701 2:186149407-186149429 AACTGCCCCTTGAAAAATTCAGG - Intergenic
943591688 2:189805693-189805715 CACTGCCATCTAAAACATACTGG - Exonic
945535593 2:211013944-211013966 AATTGCCTCCTAAAAAATCCAGG + Intergenic
946567920 2:220987956-220987978 AGCTGCCTTCTGCAAAAAAGAGG - Intergenic
947678403 2:232006577-232006599 AACATCCTGCTGAATAATACCGG - Intronic
1169001967 20:2174408-2174430 AACTGTCCTCTGAAAGACACAGG + Intronic
1170174653 20:13455098-13455120 AAATGCCTTCTTAAAAAAACAGG + Intronic
1170830243 20:19833472-19833494 AACTGGCTTTTAAAAAATATAGG - Intergenic
1174784681 20:53421433-53421455 AACTTCATTCTGAAACATGCAGG + Intronic
1175361942 20:58418953-58418975 ATCCACCTTTTGAAAAATACTGG + Intronic
1175428119 20:58883214-58883236 GTCTGCCTTCTGAAAGAAACTGG + Intronic
1175527527 20:59645896-59645918 AACAGCCTTATTAAAAATACAGG - Intronic
1176305779 21:5122400-5122422 AACTGCCCTCTGACACATACCGG - Intronic
1176949422 21:15027145-15027167 TACTGCCTTTTAAATAATACTGG - Intronic
1176958652 21:15134859-15134881 AAATAACTTCTGAAAAATACAGG + Intergenic
1178056342 21:28803145-28803167 AACTGGCTTCTCAAAAACCCAGG + Intergenic
1178127522 21:29531023-29531045 AACTTCCTTCTGAGAATTAGAGG - Intronic
1179268589 21:39828962-39828984 AACTGCCTACTAAAAAGTCCAGG - Intergenic
1179851278 21:44139631-44139653 AACTGCCCTCTGACACATACCGG + Intronic
1181959993 22:26616140-26616162 AACTGCCTCCTGGGAACTACAGG - Exonic
1184392079 22:44208737-44208759 AACTGACATCTTAAAAATATTGG + Intronic
953260653 3:41335980-41336002 CAAGGCTTTCTGAAAAATACAGG + Intronic
953745660 3:45572072-45572094 AACTGCCTTCTGAACACTTCAGG + Intronic
954893063 3:53949411-53949433 AACTGGCATCTTAATAATACTGG - Intergenic
955538997 3:59954192-59954214 AAATAACTTCTGAAAAATGCTGG - Intronic
957977225 3:87461580-87461602 GAATGCCTTCTCAAAAAGACAGG + Intergenic
958974563 3:100652810-100652832 TACTGCCTTCTGAAAATTGCTGG + Intronic
959202522 3:103266600-103266622 AACTGGCTTGTGATGAATACAGG - Intergenic
960008789 3:112810803-112810825 AACAGCCTTTTGTAAGATACGGG + Intronic
960435741 3:117624481-117624503 AACTGCCTCATGAATAATAGGGG - Intergenic
964414451 3:156432788-156432810 AACTGCTCTCTGAAGAATAGAGG + Intronic
965657405 3:171002642-171002664 ACCAGCCGTCTGAAAAATGCTGG + Exonic
967492348 3:190108116-190108138 ACCTGCCATTTAAAAAATACTGG - Intronic
967553136 3:190823261-190823283 AACTGCCTATTGAAAAACATAGG + Intergenic
970506588 4:16736397-16736419 AACAGCCTTTTTAAAAATACAGG - Intronic
972577966 4:40369474-40369496 AACAGCATTTTGACAAATACTGG + Intergenic
972942639 4:44215750-44215772 AAATGCCTTCTGGAAACTAGGGG + Intronic
974067700 4:57095117-57095139 ATATGCCTTATGGAAAATACGGG + Intronic
974357201 4:60827987-60828009 AACTGCCTACTAAAAAGTAAAGG - Intergenic
975176963 4:71300132-71300154 AACTGCCTTGTGAGAAAAGCTGG - Intronic
975315446 4:72946771-72946793 GACTGCCTTCTGAAAGATGGAGG + Intergenic
975353941 4:73377491-73377513 AAATGACTTTTTAAAAATACAGG + Intergenic
979027889 4:115599843-115599865 AAATGCTTTCTGAAAAATAAAGG + Intergenic
979203241 4:118004444-118004466 ACCTGTCTTCTGGAAAAAACTGG - Intergenic
979393681 4:120159696-120159718 AACTACATTCTAAAAAATAAAGG - Intergenic
981721612 4:147807546-147807568 AATTGCCTTCTTCAAAATAATGG + Intronic
982316402 4:154036311-154036333 AAATACCATCTGAAACATACTGG - Intergenic
983959714 4:173737665-173737687 TACTGCCTCCTGAAAAATTTTGG - Intergenic
984800718 4:183714316-183714338 AAGTGCGGTTTGAAAAATACTGG + Intergenic
984809911 4:183786318-183786340 AACTGCTATCTGAAACATGCAGG - Intergenic
985281953 4:188296100-188296122 CACTGCCTTCTGATGCATACTGG - Intergenic
985302020 4:188500244-188500266 TTCTTTCTTCTGAAAAATACAGG - Intergenic
988334804 5:29893333-29893355 ACCTGCCTTCTGAAATTTTCAGG + Intergenic
988574930 5:32412676-32412698 AAATACCTTCTGAAGAATTCAGG + Intronic
989482278 5:41945775-41945797 TACTCCCTTCTGAAAATTTCTGG + Intergenic
989857097 5:46310982-46311004 AAATGTCTTCTGATAAAAACTGG - Intergenic
990097254 5:52132592-52132614 AACTCCCTTTTCAAAAATGCAGG - Intergenic
990205773 5:53427503-53427525 AACTGCCTACTTAAGAATATTGG - Intergenic
990549765 5:56862792-56862814 AACTGCTTTTTTAAAAATAATGG + Intronic
991924430 5:71690646-71690668 AAATGCCATCTATAAAATACCGG - Intergenic
994035522 5:95195507-95195529 AATTTCCTCTTGAAAAATACGGG - Intronic
994208352 5:97060780-97060802 ACCTGCCTTCTCAAACACACAGG - Intergenic
994265765 5:97714655-97714677 AATTGCCTTCTGACAAAAGCAGG - Intergenic
994371185 5:98969456-98969478 AACTGGCTTCTGAAAAAAAGCGG - Intergenic
995514642 5:112941889-112941911 AACTTACTTCTGAAAGAAACTGG + Intergenic
996719450 5:126615811-126615833 ACATTCCTTCTGAAAAATACAGG - Intronic
998671025 5:144354090-144354112 ATCTGCCTGCTTAGAAATACTGG + Intronic
1000281857 5:159789154-159789176 CACTGCCTCCTGAAAAAGAAAGG + Intergenic
1002024920 5:176390250-176390272 TAATGCCATTTGAAAAATACTGG + Intronic
1005229874 6:23687344-23687366 AACAGCCTTTTAAAAAATGCTGG + Intergenic
1005550478 6:26908363-26908385 AACTGACTTCTGATAAAAAGGGG + Intergenic
1009290341 6:61872250-61872272 AACTGCTTCCTGAATAACACAGG - Intronic
1009614697 6:65990044-65990066 AACTGCCTTCTGATCACCACTGG + Intergenic
1010357867 6:74956175-74956197 AACTGCTGTCTGTAAAATGCTGG - Intergenic
1010382416 6:75240200-75240222 AACTGCCTGCATTAAAATACTGG + Intronic
1012131952 6:95506382-95506404 AACAGGCTTCTGAAAAAAATAGG + Intergenic
1012339132 6:98097176-98097198 AAGTGCCTTCTCAAAAAAAGTGG - Intergenic
1013726474 6:113103158-113103180 AACTGCATTTTGGAAAATATAGG - Intergenic
1014470862 6:121813080-121813102 TTCTGCCTTTTCAAAAATACAGG - Intergenic
1014898036 6:126927863-126927885 AACTGACTTCTAGAAAACACTGG - Intergenic
1015609184 6:134997052-134997074 AACTGTCATTTGATAAATACTGG - Intronic
1016130810 6:140467249-140467271 AACATCATTCTGAAAAAAACAGG - Intergenic
1016545310 6:145215856-145215878 AAAATACTTCTGAAAAATACAGG - Intergenic
1016571145 6:145514383-145514405 AACTGCATTGGGAAAAATATGGG + Intronic
1018604028 6:165578097-165578119 AACTGACTTCAGGTAAATACAGG + Intronic
1020712978 7:11631747-11631769 ATCTGCCTTCTGAGAAATCAGGG - Intronic
1021155922 7:17209596-17209618 AATTTCCTACTGAAAAAAACAGG + Intergenic
1023162403 7:37309937-37309959 AACTGAATTCTGCAAAATAGTGG + Intronic
1024848677 7:53682475-53682497 AAAAACCCTCTGAAAAATACAGG - Intergenic
1027491498 7:78833033-78833055 TACTGCCTTCTGAGAATTTCTGG + Intronic
1028010538 7:85637491-85637513 CACTACCTTCTGAGAAACACAGG + Intergenic
1028701076 7:93780617-93780639 AACTGACATCTTAACAATACTGG - Intronic
1029167923 7:98608106-98608128 AATTTCCTTCTGAAAATTGCAGG - Intergenic
1030435035 7:109506865-109506887 AACTGTCTTCTGAGAAATGTTGG + Intergenic
1030823035 7:114118893-114118915 AACTGCCTGTTGAACAATTCAGG - Intronic
1031192026 7:118564958-118564980 AACTGCCATCTTAATAATATTGG - Intergenic
1031774711 7:125893301-125893323 AACTGGCTTCTGAAAAACATAGG - Intergenic
1033045581 7:137959306-137959328 AGCTGCCATCTGAACAAGACAGG + Intronic
1033289633 7:140072335-140072357 ACCTGCGTTATGAAAAACACAGG - Intergenic
1033853448 7:145526756-145526778 CACTGACTTCTGAAGAAGACAGG - Intergenic
1035017080 7:155775957-155775979 AACAGCCTTCAGAAAAACAGAGG - Exonic
1035448963 7:158962805-158962827 AACAGGCTTCAGAAAAAAACAGG - Intergenic
1035919296 8:3659741-3659763 AACACCCCTATGAAAAATACTGG + Intronic
1035978556 8:4341243-4341265 AACTGCCTTCTGAAAAATACTGG - Intronic
1036072139 8:5452924-5452946 AAGTGTAGTCTGAAAAATACTGG - Intergenic
1038101686 8:24384650-24384672 AAGTGCCTTTTGAAAAAAAATGG + Intronic
1038756884 8:30350070-30350092 AACTTCATTCTGAAGCATACGGG - Intergenic
1039312014 8:36327124-36327146 AATTGCCTTAAGAAAAAGACAGG + Intergenic
1041109434 8:54470714-54470736 AAGTTCCTTCTGAGAAAGACAGG - Intergenic
1042616855 8:70659088-70659110 AACTTTCTACTGCAAAATACTGG + Intronic
1043037500 8:75216652-75216674 TTCTCTCTTCTGAAAAATACAGG - Intergenic
1044078428 8:87853898-87853920 ATCTGCTTTCTGAAAGACACTGG + Intergenic
1044579304 8:93807536-93807558 ACATGCCTTATAAAAAATACTGG + Intronic
1047067676 8:121304041-121304063 AACTGCCCTCTGGACAATGCAGG + Intergenic
1047641997 8:126830552-126830574 ATCTCCCTTCTGAAAATTACAGG - Intergenic
1048556498 8:135482931-135482953 AACAGCCTTATGAAAAAGAAAGG - Intronic
1050125954 9:2356474-2356496 AACAGCCTTCTAAGAAATCCTGG - Intergenic
1050177819 9:2886763-2886785 AACTTCCTCCTGAAAAACTCTGG + Intergenic
1050867995 9:10528723-10528745 AACTGCCTTCAGAAGAAGTCAGG - Intronic
1052251637 9:26405407-26405429 AACTGCCATATGAAAAAGAAGGG - Intergenic
1053154268 9:35764364-35764386 ATTAGCCTTCTGAAACATACCGG - Intergenic
1055464344 9:76549496-76549518 AACTTCATTCTGAAGCATACAGG - Intergenic
1057541739 9:95979774-95979796 ATGTGCCATCTGAAAAAGACAGG + Intronic
1058568862 9:106318954-106318976 AACAGTCTTATGAACAATACAGG - Intergenic
1059036845 9:110763437-110763459 ACCCTCCTTCTGAAAAAAACAGG + Intronic
1061609108 9:131734372-131734394 AAATGCATTCTGAAAACCACAGG + Intronic
1186291331 X:8103051-8103073 AGCTGCCCTCTGAAAAACAGAGG - Intergenic
1187363589 X:18649414-18649436 TACTGGCTTTTGAAAAATTCTGG - Intronic
1188845293 X:35065015-35065037 CACTGCCTGATGAAAATTACTGG + Intergenic
1189577198 X:42366859-42366881 CACTAAGTTCTGAAAAATACTGG + Intergenic
1190338335 X:49276845-49276867 ATCTGCTTTCTGAAAAGAACAGG - Intronic
1193996424 X:88370622-88370644 AACTGCCATTTAAAAAATAATGG + Intergenic
1194155768 X:90386854-90386876 AACTGTCTTTTGAAAAATGAGGG + Intergenic
1194263149 X:91722500-91722522 ATCTGCCTGCTCCAAAATACTGG - Intergenic
1194273132 X:91845327-91845349 AAATGCCTCCTGAAACACACAGG - Intronic
1194523695 X:94949613-94949635 AACTGCCACCTGAAAAGAACAGG + Intergenic
1194639662 X:96388339-96388361 AAGGGCCTTCTGAAAAATACTGG + Intergenic
1194798693 X:98243685-98243707 AAATGACTTCTGAAAAATGATGG - Intergenic
1195506729 X:105666672-105666694 TACTGCCTTCTGAGAATTTCTGG - Intronic
1196601755 X:117609183-117609205 AACTGCATTAAGAAAAATATAGG + Intergenic
1198777264 X:140193379-140193401 CACTGTCTTCTGAGAAATATGGG - Intergenic
1200590374 Y:5066725-5066747 AAATGCCTCCTGAAACACACAGG - Intronic
1201332677 Y:12843452-12843474 CATTGCTTTTTGAAAAATACTGG + Intronic
1201559182 Y:15298037-15298059 CACTGCATTTTTAAAAATACTGG - Intergenic
1201765602 Y:17571179-17571201 AACTGCCGTCTGTAAAACCCAGG + Intergenic
1201835950 Y:18334810-18334832 AACTGCCGTCTGTAAAACCCAGG - Intergenic