ID: 1035979025

View in Genome Browser
Species Human (GRCh38)
Location 8:4348063-4348085
Sequence GCCACTGGTTTGTTTTTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035979025_1035979028 -2 Left 1035979025 8:4348063-4348085 CCAGGCAAAAACAAACCAGTGGC No data
Right 1035979028 8:4348084-4348106 GCCCAGGAAAAGTGAATGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035979025 Original CRISPR GCCACTGGTTTGTTTTTGCC TGG (reversed) Intronic