ID: 1035980053

View in Genome Browser
Species Human (GRCh38)
Location 8:4360451-4360473
Sequence AAAAAAGAGGTTATGATAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 434}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035980053_1035980056 5 Left 1035980053 8:4360451-4360473 CCCGTTATCATAACCTCTTTTTT 0: 1
1: 1
2: 1
3: 32
4: 434
Right 1035980056 8:4360479-4360501 ACATACTTCCTGTTCCTCCCAGG No data
1035980053_1035980062 25 Left 1035980053 8:4360451-4360473 CCCGTTATCATAACCTCTTTTTT 0: 1
1: 1
2: 1
3: 32
4: 434
Right 1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG No data
1035980053_1035980058 18 Left 1035980053 8:4360451-4360473 CCCGTTATCATAACCTCTTTTTT 0: 1
1: 1
2: 1
3: 32
4: 434
Right 1035980058 8:4360492-4360514 TCCTCCCAGGTTCTTTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035980053 Original CRISPR AAAAAAGAGGTTATGATAAC GGG (reversed) Intronic
900030213 1:365939-365961 ATAAAATAGGCAATGATAACAGG - Intergenic
901654265 1:10760405-10760427 AATGAAGAGGTTAGCATAACTGG - Intronic
901784371 1:11614927-11614949 AAAAAAGAAGGTATGAAACCAGG - Intergenic
903514930 1:23903805-23903827 AAAACAGAGATGATGATAATAGG - Intronic
903713514 1:25345104-25345126 AAAAAAGAAGATGTGGTAACTGG - Intronic
905466195 1:38155576-38155598 AAAATAGATGTTCTGATAAGTGG + Intergenic
905688357 1:39925125-39925147 AAAAAAGAGGTTATGGGGTCTGG + Intergenic
908752154 1:67434467-67434489 AAAAAAGAAGTAGTGATAAATGG - Intergenic
909154819 1:72060550-72060572 AATAAAGAGGTTATTAAAATTGG - Intronic
909450084 1:75788290-75788312 AAAAAAGAAGTTTTTTTAACAGG - Intronic
909501781 1:76342457-76342479 AAAAAAAAGCTCATGATCACTGG - Intronic
909561938 1:77016915-77016937 AAAAAAGAGGTCTTAATAATGGG - Intronic
909704982 1:78570803-78570825 AAAGGAGAGGTTCTGATCACTGG - Intergenic
910056413 1:83038038-83038060 AAAAAAAAGTTTATCATCACTGG + Intergenic
910173705 1:84405103-84405125 AAAAAAAAAATTAAGATAACAGG - Intronic
910181442 1:84487665-84487687 AAAGAAGAACTTATGATCACAGG - Intronic
910476093 1:87609100-87609122 AAAAAAAAGATTATGTGAACAGG - Intergenic
910552196 1:88488091-88488113 ACCAAGGAGGTTATGATAACTGG - Intergenic
911204051 1:95075072-95075094 AAAAAAGAGGTTATCTTGTCGGG + Intergenic
911602375 1:99860203-99860225 ATAAAAGAGGATATACTAACAGG - Intronic
911871110 1:103100557-103100579 TAAAAAGAGGTTCTGGTAAAAGG - Intronic
912677630 1:111699814-111699836 TAAAAAGATGTTAGGATAAATGG - Intronic
913656414 1:120964669-120964691 AAAAAAGTCTTTATGATACCTGG + Intergenic
914646375 1:149656399-149656421 AAAAAAGTCTTTATGATACCTGG + Intergenic
915960854 1:160265515-160265537 ATAAAACAGGTTAAGATAACTGG + Intergenic
916987046 1:170202781-170202803 AACAGAGAGGTGATGATAAGTGG + Intergenic
917318532 1:173754800-173754822 CAAAAAGAAGTTAGGATATCAGG - Intronic
918363330 1:183781131-183781153 AGAAAAGAGATTTTGATAAGAGG - Intronic
919447349 1:197724941-197724963 AGAAAAGAGGTTAAGAAAAATGG + Intronic
920090438 1:203448936-203448958 AAAAAAGAAGTTACCAGAACAGG - Intergenic
921536334 1:216353108-216353130 AAAGAAGTGGTTATAATAACTGG + Intronic
921718318 1:218441964-218441986 AAAAAAGAGGTCATATTAATGGG + Exonic
921776578 1:219107558-219107580 CAAAAAAAGGTTATGGTCACTGG + Intergenic
922051509 1:221994957-221994979 AAATAAGAGATTGTTATAACTGG - Intergenic
922405747 1:225311195-225311217 AAAAAAAAGCTTATCATTACTGG - Intronic
1063638027 10:7803636-7803658 GAAAAAAAGGTTAAGATAATGGG + Intronic
1064041197 10:11966382-11966404 GATAAAGAGGTTATTTTAACAGG - Intronic
1065488916 10:26262835-26262857 AAAAAAAGGATTATGATAAAAGG - Intronic
1065614902 10:27510781-27510803 AATAAAGAGTTTCTGTTAACTGG + Intronic
1066184623 10:32997403-32997425 AAAGAAGAAGATATGAAAACTGG + Intronic
1066578902 10:36858484-36858506 TAAAAAGTGGTTGTGATAATTGG - Intergenic
1067326361 10:45271184-45271206 AAAAAAGTGCTTATCATCACTGG + Intergenic
1068070435 10:52187515-52187537 AAATAAGTGTTTATGAGAACTGG + Intronic
1068357363 10:55927159-55927181 AAGAATGAGCTTATGATAAATGG - Intergenic
1068427394 10:56884733-56884755 AAAGAAGAGATTATCATAAGAGG + Intergenic
1069522728 10:69137621-69137643 AAAAGGGAGGTTATCCTAACTGG - Intronic
1069765772 10:70857731-70857753 AAAAAGGAGGTCATGTAAACTGG - Intronic
1071203274 10:83245208-83245230 AAAAAAAAGCTTATCATCACTGG + Intergenic
1071253616 10:83845816-83845838 AAAAAAAAGCTTATCATCACTGG - Intergenic
1072328184 10:94319055-94319077 AAAAAAAAGTATATGACAACAGG + Intronic
1073189207 10:101638497-101638519 AAAAAAAAGAGTAGGATAACGGG + Intronic
1073529701 10:104219785-104219807 AATGAAAAGGTCATGATAACGGG - Intronic
1073752250 10:106542063-106542085 AGAGAACAGGTTATGAAAACAGG + Intergenic
1080085193 11:28271957-28271979 GAAAAAAAGGTTATCATCACTGG + Intronic
1080121856 11:28687019-28687041 AAAAAAAAAATTAAGATAACAGG - Intergenic
1080546029 11:33319503-33319525 AAAAAAAAAGTCATGATACCTGG + Intronic
1080767021 11:35306363-35306385 CAAAACAAGGTTATGAAAACTGG + Intronic
1080932651 11:36828830-36828852 AAAAAAAAGCTTATCATCACTGG - Intergenic
1081306309 11:41516157-41516179 AAAATAGAGGATAAGATAGCAGG - Intergenic
1084158653 11:67331677-67331699 AAAAAAAAGGTCAAGATAACAGG + Intronic
1087564091 11:99831601-99831623 AAAAAAAAAGTTATGGTCACTGG - Intronic
1088694649 11:112356249-112356271 ATAAGAGAGGTTATAAGAACAGG - Intergenic
1091137420 11:133204434-133204456 AAGAAGGATGTTATGATATCTGG + Intronic
1092082907 12:5732902-5732924 AAAAGAGAGGAAATGTTAACTGG + Intronic
1092092799 12:5817663-5817685 AAAAAAGTGGTCATATTAACAGG + Intronic
1092476042 12:8819885-8819907 AAAAAAGTGTTTTTGGTAACTGG - Intergenic
1092767367 12:11864758-11864780 AAAAAAAAGCTTTTTATAACAGG + Intronic
1093564350 12:20584462-20584484 AAAAAGGAGGTTCTGATATTTGG - Intronic
1093686442 12:22060154-22060176 AAAAAGGAGGATATGATTAAGGG + Intronic
1095567424 12:43641864-43641886 AAAAAAAAGCTTATCATCACTGG - Intergenic
1095679938 12:44962230-44962252 AAAACAGATATTATGATAAAGGG + Intergenic
1096165237 12:49417078-49417100 AGAAAAGAGGTTTTTATTACTGG - Intronic
1096801267 12:54112255-54112277 AAAGGATAGGGTATGATAACAGG + Intergenic
1097469414 12:59969798-59969820 AAAAAAAAAGTTATGGTAAATGG + Intergenic
1097502114 12:60417317-60417339 AAAAATTAGGTCATGATAAATGG + Intergenic
1097601782 12:61702047-61702069 AAAAAAGAGGATTTGAAAATGGG + Intergenic
1099225831 12:79968049-79968071 AAAAAAAAGGTCATCATCACTGG + Intergenic
1099563015 12:84202941-84202963 TAAAATGAGGTGATGATAGCAGG - Intergenic
1099830670 12:87838623-87838645 AAAAAAAAGGTCATCATCACTGG + Intergenic
1101746407 12:107544795-107544817 AAAAGAGAGGTTAAGAGAGCAGG + Intronic
1102727277 12:115076791-115076813 AAAGAAGAGGTTATCATATGGGG - Intergenic
1102776399 12:115523371-115523393 AAAATAGATGTGATAATAACAGG - Intergenic
1106739186 13:32620670-32620692 AAAAAAGTGGTAGTGATAACGGG + Intronic
1106741153 13:32643496-32643518 AAAAAAGTGGTAGCGATAACAGG - Intronic
1108849617 13:54711635-54711657 AAAAAAAAGGTCAATATAACTGG - Intergenic
1109229094 13:59734313-59734335 AAAAAAGAAGATATGAAAAGTGG + Intronic
1110035287 13:70674549-70674571 AAAAAAGAGGATATTTTAAATGG - Intergenic
1110474697 13:75900395-75900417 AGCAAAGAGGTTAAGAAAACAGG - Intergenic
1110784608 13:79509381-79509403 TAGAAAGAAGTTATGATAAGAGG + Intronic
1111142971 13:84146042-84146064 ATAAAAGTCTTTATGATAACTGG - Intergenic
1112358114 13:98691741-98691763 AATACAGAGGTTATGATCACTGG - Intronic
1112740653 13:102469182-102469204 AAAAAAAAGGTCATCATCACTGG - Intergenic
1112832334 13:103468643-103468665 ACAAAAGTGGATATGATCACAGG + Intergenic
1112870537 13:103965183-103965205 AAAGACGAGGTTTTGATAAAAGG + Intergenic
1113725580 13:112598057-112598079 AAAAAAGAGGTTATCGTCAAAGG + Intergenic
1115011370 14:28550337-28550359 AAAAAAGAGGATTTTATAAATGG + Intergenic
1115256427 14:31407561-31407583 ATAAAATAAGTGATGATAACAGG - Intronic
1115378171 14:32702562-32702584 AAAAAAGATGTTAAGAGAATAGG + Intronic
1115728562 14:36243425-36243447 AAAAATGAGGTTACCATAATGGG + Intergenic
1115907187 14:38212457-38212479 AAAAAAGTGATGATGTTAACTGG - Exonic
1116583034 14:46666836-46666858 AAAAAAGAGGTGATGTGAAATGG - Intergenic
1116840269 14:49813634-49813656 AAAAAAGATGTAATGATAAAAGG - Intronic
1118395229 14:65330518-65330540 AAAAGTGAGGTTATCATAGCTGG - Intergenic
1118502765 14:66378672-66378694 AAAAAAGAGTTTCTCTTAACAGG + Intergenic
1119505998 14:75173529-75173551 AAAAAAGCAGTGATGATAAATGG - Intronic
1119983151 14:79104768-79104790 AAAAATTAGGATGTGATAACTGG - Intronic
1120142927 14:80948515-80948537 AATAAAGAGGTTATGGAAAGGGG + Intronic
1120243441 14:81977218-81977240 AAGAGAGAGGTTTTGATAATGGG - Intergenic
1120851088 14:89171839-89171861 TGAATAGAAGTTATGATAACAGG - Intronic
1121081484 14:91112260-91112282 AAAAAAGAGTTTAACATAACAGG + Intronic
1121649171 14:95544533-95544555 AAAAAAGAAACTGTGATAACTGG + Exonic
1122017801 14:98811030-98811052 AAGAAAGAGGATGGGATAACAGG - Intergenic
1122591079 14:102851747-102851769 AAAAAAGAAATTATCATCACAGG + Intronic
1123859084 15:24445206-24445228 GAAAAAGTGGTTATGAACACAGG - Intergenic
1124100371 15:26687397-26687419 ACAAAAGAGGTGACGCTAACAGG + Intronic
1124814395 15:32974481-32974503 AAAAAAGGGGTAATCAAAACAGG - Intronic
1124911948 15:33929904-33929926 AATAAAAAGTCTATGATAACCGG + Intronic
1125703963 15:41714907-41714929 GAAAAAAAGTTTATGATAAATGG - Intronic
1125772497 15:42179233-42179255 AAAGAAGAGGTTCTGTTACCTGG - Intronic
1125843357 15:42826838-42826860 AAAATAGAGGTTGTGGTAAAGGG + Intronic
1126457732 15:48882455-48882477 AAAACAGAGGTGAGGATAACGGG - Intronic
1126817924 15:52472066-52472088 AAAAAAAATGTCAGGATAACAGG - Intronic
1127163682 15:56220045-56220067 AAAAAAAAGGTTATGCTTCCTGG - Intronic
1127921790 15:63500571-63500593 AAAAAAAAAGTTATAATAAAAGG + Intergenic
1128662142 15:69509498-69509520 AAAAAAAAGGTTATTTTACCAGG + Intergenic
1128864351 15:71102864-71102886 AAAAAAGAAGATATAAAAACAGG - Intronic
1128956657 15:71954188-71954210 AAAAAAGAGTTGATGATGGCCGG - Intronic
1129305930 15:74662482-74662504 TAAAAAGAGGTTATAAAAAAAGG + Intronic
1130225344 15:82053335-82053357 TAAAAAAATGTTATGACAACAGG - Intergenic
1130685717 15:86035646-86035668 AAAAAAGATGTTAACATAAAGGG - Intergenic
1130788714 15:87128702-87128724 AATAAAGAGGTTATGGCAAAAGG + Intergenic
1131219411 15:90569302-90569324 AAAAAAAAGGTTTTGTTTACAGG - Intronic
1131406036 15:92165575-92165597 GAAAAAGATGTTAGAATAACAGG + Exonic
1131482102 15:92791038-92791060 AAAAAAATGGTTAAGATAGCCGG + Intronic
1133793343 16:9026604-9026626 AAAAAAGAGATGATAATATCAGG - Intergenic
1134257467 16:12624070-12624092 AACCAAGAGGTTAACATAACAGG - Intergenic
1134888675 16:17818812-17818834 AAAAAATAAGCTATGATAATTGG + Intergenic
1135675216 16:24409277-24409299 AAGAAACAGGTAATGATGACTGG - Intergenic
1135930871 16:26735577-26735599 AAAAAATAAGGTATGATAAAAGG + Intergenic
1136611612 16:31369950-31369972 AAAAAAAAGGTAATAATAATGGG - Intronic
1137736494 16:50727879-50727901 AAAAAAAAGGTCATGGTCACTGG - Intronic
1138188354 16:54994497-54994519 AAAAAAGACATTATTATGACTGG + Intergenic
1138929391 16:61633757-61633779 AATAAAGAGAGTTTGATAACTGG - Intergenic
1139944101 16:70626855-70626877 AGAAAAGAGCTCATGATAAATGG - Intronic
1143588264 17:7863061-7863083 AAAAAGGAGGTCCTGATTACAGG + Intronic
1144131612 17:12251958-12251980 AAAGAAGAGGCTATGAAATCTGG + Intergenic
1144819723 17:18063692-18063714 AAAAAAGAAGTTCTGATACATGG - Intronic
1147814715 17:43200671-43200693 AAAAAACAGGTTTTGAGATCAGG - Intronic
1148940577 17:51206768-51206790 AAAAAATATGTTATGATATAGGG - Intronic
1149526019 17:57356265-57356287 AAAAAAGAAGTTATGCAAAGAGG - Intronic
1149762210 17:59242747-59242769 AAAAAAGAAGTCCTGCTAACAGG + Intronic
1150588145 17:66536998-66537020 GAAATAGAGGTTCTAATAACTGG - Intronic
1152059703 17:78062741-78062763 ACAGAAGAGGTTATGAAACCAGG - Intronic
1152949545 17:83220618-83220640 ATAAAATAGGCAATGATAACAGG + Intergenic
1153039642 18:799915-799937 AAAAAAGAAGGTATGATTGCTGG + Intronic
1153259014 18:3203809-3203831 AACAAAGACGTTATAATAAAAGG + Intronic
1153620188 18:6969935-6969957 AAAATAGAGGATATGGTCACAGG + Intronic
1154156238 18:11946494-11946516 AAAAAAAATGTTAGGATTACAGG + Intergenic
1154281106 18:13004247-13004269 AGAAACGAGGTTATGACAGCTGG + Intronic
1154526310 18:15293742-15293764 AAAAAAGAGTTTATTCTATCAGG - Intergenic
1155544114 18:26897899-26897921 AAAAAAGTGTTTATGATGAATGG - Intergenic
1155871254 18:31031299-31031321 AAAAAACAGGTTAAGATATCTGG - Intronic
1156091836 18:33480819-33480841 ATAGTAGAGGTGATGATAACTGG - Intergenic
1157911553 18:51621809-51621831 AAAATAAAGGTTACGAAAACAGG - Intergenic
1158257372 18:55567206-55567228 AAAACAGAGTTTAAGATAAAAGG + Intronic
1159135419 18:64331736-64331758 AACAAATAGGTTATGAGAGCTGG - Intergenic
1160068284 18:75599085-75599107 AAAAATGAGGTTATTAAAATAGG - Intergenic
1162146572 19:8615957-8615979 AAAATAGAAGTAATGATAATCGG + Intergenic
1167419920 19:49396769-49396791 AAAAAAGTGGTCATGATTACAGG + Intronic
928485126 2:31723071-31723093 GAAAAAAAGTTTATCATAACTGG + Intergenic
928796281 2:35024623-35024645 AAATAACAAGTTATGATATCAGG - Intergenic
928806380 2:35161891-35161913 AAAAAAGACTTGATGATAAAAGG - Intergenic
928863414 2:35887692-35887714 ATAAGAGAGGATATGAAAACTGG + Intergenic
928969390 2:37011635-37011657 AAAATAATGGTTATGAAAACTGG - Intronic
930398274 2:50849568-50849590 AAAGAAGAGTTATTGATAACTGG - Intronic
930926268 2:56821940-56821962 AAAAAAAAGCTTATCATCACTGG + Intergenic
931332987 2:61307464-61307486 AAAAAAGAGTTTATGAGACTTGG + Intronic
931937644 2:67215813-67215835 AGAACATAGGTTATGTTAACAGG + Intergenic
931974560 2:67629066-67629088 CAAATAGAGGTTATTAAAACTGG + Intergenic
932348116 2:71008842-71008864 AATAAAGAGGGTATGATGAAGGG + Intergenic
932510296 2:72280337-72280359 AAAAAAAGGGTTATGAGCACAGG - Intronic
933109637 2:78381356-78381378 AAAAAAAAGCTTATCATCACTGG + Intergenic
934126891 2:88903322-88903344 AAAAAAGCAGTTATGACAATGGG + Intergenic
935205257 2:100891241-100891263 AAAAAAGAAGTGAGGATGACAGG + Intronic
935337537 2:102031105-102031127 AGGAAAGAGGAGATGATAACAGG - Intergenic
935475909 2:103523773-103523795 AAACAAGAGTTAATGAAAACAGG + Intergenic
935526953 2:104182213-104182235 AAAAAAGTGGCTATGATGTCAGG + Intergenic
937191743 2:120108546-120108568 AAATAAAAGGTTATGATAATAGG + Intronic
937578881 2:123459048-123459070 AATAAAGAGGTTAAGAAAAAAGG - Intergenic
937690998 2:124754954-124754976 AAAAAAGAACTTGTAATAACAGG + Intronic
938525414 2:132125107-132125129 AAAAAAGAGTTTATTCTATCAGG - Intergenic
939247819 2:139647601-139647623 AAAAAAAAGCTTATCATCACTGG - Intergenic
940143253 2:150519029-150519051 AAAAAAGCGTTTATATTAACTGG + Intronic
941077607 2:161023686-161023708 AGAAAAGATGTTATGTTAGCAGG - Intergenic
941230700 2:162908508-162908530 AAGAAAGAGATTTTAATAACAGG - Intergenic
941460202 2:165761624-165761646 AAAAAAGAGGCAAGGATAACTGG + Intronic
942585687 2:177474379-177474401 AAAAAAGGGGTTCTGCCAACAGG + Intronic
942892647 2:181010792-181010814 AAAGAGGAGGATATGACAACAGG - Intronic
943246307 2:185455775-185455797 AAAGAAGAGGTTCTGCTAACAGG - Intergenic
943273019 2:185831448-185831470 AAAAAAGATGTAATAATAAGGGG - Intronic
943285405 2:185992120-185992142 GAAAAACACATTATGATAACTGG - Intergenic
943844038 2:192618955-192618977 AAAAAAGATGTAATGGTCACAGG - Intergenic
944199650 2:197092169-197092191 AAATAAGATGTTATGAGAAGTGG - Intronic
944426550 2:199589355-199589377 AAAAAAGAGCAAATTATAACAGG - Intergenic
944550863 2:200843709-200843731 AAAAAAAAGGTCATGGTCACTGG - Intergenic
944634311 2:201659897-201659919 AAAAAAAAGGTTAAGAAAAAAGG - Intronic
944792954 2:203152281-203152303 TAAAAATAGGTTATAATAAAAGG - Intronic
944847534 2:203683811-203683833 AAGAAATAGGTTATGTCAACAGG - Intergenic
945616959 2:212083344-212083366 AAACAAGGGGTAATGATAAATGG + Intronic
945863255 2:215148067-215148089 AATAAAGAGGTTATGTAAACTGG + Intergenic
946142847 2:217706465-217706487 ATAGAAGAGGTTAAGATGACAGG + Intronic
946279332 2:218655392-218655414 AAATAAGAGGTGAGGATAATGGG + Intronic
946298369 2:218805151-218805173 AAAACAGAGGTTATTGTAAATGG + Intronic
946508478 2:220327364-220327386 AAAAAAGAGTTCTTGATAAATGG - Intergenic
1169368458 20:5010108-5010130 AAAAAAGAGGATATGAAAGAGGG + Intronic
1169374005 20:5051563-5051585 AAAAAAAAGATTATGAACACTGG + Intergenic
1171795415 20:29562209-29562231 AAAGGATAGGGTATGATAACAGG - Intergenic
1171853035 20:30322055-30322077 AAAGGATAGGGTATGATAACAGG + Intergenic
1171858773 20:30376106-30376128 AGAAAATACGTTATGATAGCGGG + Intergenic
1171960054 20:31486824-31486846 AAAAAAGAAGATATGCTAGCGGG - Intergenic
1173541456 20:43854976-43854998 AAAAAAGATGTTGAGATAAATGG - Intergenic
1173975331 20:47182637-47182659 AAAAAAAAGGTTAAGATGGCTGG + Intronic
1174226615 20:49005887-49005909 ATAAAAGAGGTCAGGATACCGGG + Intronic
1175448173 20:59040937-59040959 AAAAAAGAAATTAAGATCACAGG + Intronic
1176969321 21:15247891-15247913 AAAAAAGATGTTAGGGGAACAGG - Intergenic
1176982889 21:15403738-15403760 AAGAAAGAGGTTAAGAAAACTGG - Intergenic
1177473586 21:21590428-21590450 AAAAATGATGCTATGATGACTGG + Intergenic
1178536844 21:33417079-33417101 AAAAAAGAAGTTATCTGAACCGG - Intronic
1180668376 22:17533331-17533353 AAAAAAAAAATTATGATAGCTGG + Intronic
1181153925 22:20905363-20905385 CAAATAGAGATGATGATAACAGG + Intergenic
1181836805 22:25616797-25616819 AAAGGAGAGGTTTTGATAAGAGG + Intronic
1184377117 22:44120653-44120675 AAAAAAGTGGTTTTTTTAACAGG - Intronic
1184542503 22:45136937-45136959 AAATAAGAGGCTATAATAAAAGG + Intergenic
1184996327 22:48210008-48210030 GAAATAGAGATTATTATAACGGG + Intergenic
950822911 3:15780837-15780859 ATAAAAGATGTTAGGAAAACTGG + Intronic
951111702 3:18811665-18811687 ACAACAGAGGTTAAGATAAAGGG - Intergenic
952061956 3:29522150-29522172 AATCCAGAGGTTAGGATAACAGG + Intronic
952590181 3:34943110-34943132 AAAAAAGAAGTTATAAGAAAGGG - Intergenic
954817421 3:53293887-53293909 AAAAAAGAGGCCAGGACAACTGG + Intronic
955382721 3:58453038-58453060 AAAAAGGAAGTCAAGATAACAGG - Intergenic
955959041 3:64320221-64320243 AAATAGGAGGTTATAATAAGAGG - Intronic
956065747 3:65395652-65395674 AAAAAAGAGGGTGTGCTAAGTGG + Intronic
957004645 3:74930705-74930727 ATAAAAGATGTTATGCTAAGAGG - Intergenic
958666159 3:97140090-97140112 ACAAAAGAGGTTTTCAGAACTGG + Intronic
959746413 3:109780526-109780548 AAAATAGAGGTTTTGGTACCAGG - Intergenic
960631578 3:119737332-119737354 AAAAAAGAGATTATATTAATTGG + Intronic
960850990 3:122053726-122053748 ACTAAAAAGTTTATGATAACAGG + Intergenic
961228203 3:125273846-125273868 AAAAAATAAATTATGAAAACTGG + Intronic
962291774 3:134143456-134143478 AAAAAAGAGGTTATGAGATATGG + Intronic
962639586 3:137371267-137371289 AAAAAAAAGGTCATCATCACTGG - Intergenic
962681424 3:137804068-137804090 AGAAAAGAGATTATGATATTTGG + Intergenic
962684930 3:137838154-137838176 AAAAAAAAGATTATGTGAACTGG - Intergenic
963804017 3:149704978-149705000 TAAAAAGATGTTATAAGAACAGG + Intronic
964154673 3:153570539-153570561 AAAAAAAAGCTTATCATCACTGG + Intergenic
964593121 3:158389044-158389066 AAAAAACAGATTATTCTAACTGG + Intronic
964807329 3:160625605-160625627 AAAATAAAAATTATGATAACAGG - Intergenic
965217138 3:165877697-165877719 AGCAGAGAGGTTATGAAAACAGG + Intergenic
965329059 3:167347080-167347102 ATAAAGGTGGTTATTATAACAGG + Intronic
965462062 3:168978134-168978156 AAAAAAAATGACATGATAACTGG - Intergenic
965575372 3:170212745-170212767 AATAAAAAGGTTAACATAACAGG + Intergenic
965645325 3:170874107-170874129 AAAAAACAGGTTAAGAGACCAGG + Intergenic
965695735 3:171406588-171406610 AAATAAGAGATAATAATAACTGG - Intronic
966059449 3:175736577-175736599 AACACAGAGGTTATAATCACTGG + Intronic
966559746 3:181307133-181307155 AAAAAAAAGCATATCATAACTGG + Intergenic
967198619 3:187051207-187051229 AGAAAAGAGGTGATGAGCACTGG - Intronic
967929543 3:194680864-194680886 AAAAAAGACAATATTATAACAGG + Intergenic
970865250 4:20750764-20750786 ACAAAAAAGGTTAAGATAAAAGG - Intronic
971043605 4:22780993-22781015 GAAAAAGAGGTTTTGCTTACTGG - Intergenic
971194396 4:24458006-24458028 GAAAAAAAGGCTCTGATAACTGG + Intergenic
971291306 4:25343246-25343268 AAATAAAAGGTTTAGATAACTGG - Intronic
971385358 4:26136644-26136666 AAAAGAAAAGTTATCATAACAGG + Intergenic
971532970 4:27712389-27712411 AAAAGAGTGGTTATGAAAAGTGG + Intergenic
971723123 4:30272843-30272865 AAAAAAGAGCTCATGATCACTGG - Intergenic
971976493 4:33695453-33695475 AAAAAAGAGGTAATGTATACAGG - Intergenic
972255386 4:37349430-37349452 AAAAAACAGCTCATGATCACTGG - Intronic
972579429 4:40381458-40381480 AACAAAGAGGTTAACATAATTGG + Intergenic
973010078 4:45061980-45062002 AAAAAAAAGCTTATCATCACTGG + Intergenic
973313948 4:48740103-48740125 AAAAAACAGATTAAGATAGCTGG + Intronic
973877903 4:55240137-55240159 AAGAAAGAGGTAGTTATAACAGG - Intergenic
974337024 4:60561792-60561814 AATAAAGAGGAGATGATAATAGG - Intergenic
974725829 4:65796810-65796832 AAAAAAGAAATTATAACAACAGG + Intergenic
975312316 4:72916304-72916326 AATAAAGAGGATATGATACCGGG + Intergenic
975483454 4:74907632-74907654 AAAAAGGAGGTGCTGAAAACTGG + Intergenic
975625687 4:76344450-76344472 AAAAATGAGTTTATGAAGACTGG + Intronic
975767951 4:77688761-77688783 AAAACAGAGGTTAAGAGTACTGG - Intergenic
976252698 4:83069421-83069443 ACAAAAAAGATTATGCTAACTGG - Intronic
976310560 4:83607654-83607676 AAAAAAATGGTTAAGATAATGGG + Intergenic
977637298 4:99314198-99314220 CCAAAAGAGGTTTTGATAAACGG - Intronic
978367531 4:107997958-107997980 AAATAAGAGGTTACGTTATCAGG + Intronic
978563692 4:110059985-110060007 CAAAAAGAGGTCATGAAAAAGGG + Intronic
978834807 4:113136387-113136409 AAAGATGAGATTATGAAAACTGG + Intronic
979938566 4:126729790-126729812 AAATAACTGGTTATGATGACTGG - Intergenic
980177217 4:129361123-129361145 AAAAGAGAGGTTAAGAGCACAGG + Intergenic
981805319 4:148708570-148708592 AAAAAACTGGTTATGATAAAAGG + Intergenic
981995436 4:150969177-150969199 AAAATGGATGTTATGTTAACAGG - Intronic
982874577 4:160629829-160629851 AAAAAAGAGGTTATGATGGCCGG + Intergenic
982883827 4:160752621-160752643 AAAAATGGTGTTAGGATAACTGG - Intergenic
984008207 4:174338997-174339019 AAATAAGAGGGTAATATAACAGG - Intergenic
984182912 4:176507409-176507431 AAAAAAGAGGTTTGGAGAAGGGG - Intergenic
984603987 4:181762712-181762734 AAATAAGAAGTTTTGATAATGGG - Intergenic
984654066 4:182298675-182298697 AAAAAAGAGGTAATGGGATCGGG + Intronic
985165157 4:187085831-187085853 AGACAAGAGGCTATGATAAGAGG + Intergenic
985182383 4:187279493-187279515 AAAAAAGAGGATATGATATAGGG + Intergenic
986858360 5:11898721-11898743 AAAATACATGTTATGATAAAAGG - Intronic
987392717 5:17390913-17390935 ATTAAAGAAGTTATGATAAAAGG - Intergenic
987460947 5:18209644-18209666 AAAAAAGAGATGAAGAGAACTGG - Intergenic
987613116 5:20234345-20234367 AAAAAAGTGGTTATGACCAATGG - Intronic
989001326 5:36763398-36763420 CAAAAAGAGGTTGTGAAAAGAGG + Intergenic
989138919 5:38182714-38182736 AAAAAAGAGGATTTCCTAACAGG + Intergenic
990659777 5:58000488-58000510 AAAAAAAAGCTCATGATCACTGG + Intergenic
991059417 5:62357070-62357092 AAAAAAGAAGTTGTGATGCCAGG - Intronic
991433541 5:66572911-66572933 AAAAAAGAGGTTACTTAAACAGG + Intergenic
991902308 5:71473170-71473192 AAAAAAGAGGCTAGGACAAGTGG - Intronic
991924955 5:71696379-71696401 AACAAAGTGGTTAAGATCACAGG + Intergenic
993086855 5:83374057-83374079 ACAAAAGAGTTTAGGATCACAGG - Intergenic
993664342 5:90677128-90677150 AATAATGAGGTAATGATACCGGG - Intronic
993861016 5:93137190-93137212 AAAAAAGAGGTTATCAAAGTAGG - Intergenic
994315090 5:98324260-98324282 AATAAAGAGCTTATAATAAATGG - Intergenic
994371127 5:98969106-98969128 AAAAAAAAGTTTATGATTTCAGG - Intergenic
994950235 5:106452448-106452470 AAAAAAGAGTTTATGCTTAGAGG + Intergenic
995399830 5:111728490-111728512 AAAAAAGAGCTAAAGTTAACAGG - Intronic
995619053 5:114003190-114003212 AAAAAAGACTTTGTGATAAAAGG - Intergenic
996694474 5:126378739-126378761 AAAAATGAGGGGCTGATAACAGG - Intronic
996937684 5:128966662-128966684 AAAAAAAAGGGTATGAAAGCAGG - Intronic
998676001 5:144408782-144408804 AGAAAGGAGGTGATAATAACAGG - Intronic
999053481 5:148549110-148549132 AAAAAAGAGGTTTTGGTATAAGG - Intronic
999091337 5:148938853-148938875 AAAAAAGCGGGTATGAAAATGGG - Intronic
1000687354 5:164268771-164268793 TAACAAGAGGAGATGATAACAGG - Intergenic
1000714977 5:164631267-164631289 AAAAAAGAGTTTAAAATAAAAGG + Intergenic
1001059756 5:168478351-168478373 AAAAAAGAGGTCATGAGGATGGG - Intergenic
1002702661 5:181136647-181136669 AAAAAAGAGATGAAGATATCAGG + Intergenic
1002743776 5:181454433-181454455 ATAAAATAGGCAATGATAACAGG + Intergenic
1003068710 6:2926725-2926747 TAAGAAGAGGTTATGATATGGGG - Intergenic
1003094437 6:3131468-3131490 AGAAGAGAGGTGAGGATAACTGG - Intronic
1003792037 6:9557016-9557038 AAAAAAGATATTATTATACCAGG - Intergenic
1004028484 6:11842582-11842604 AAAAAAAAGGTCATCATCACTGG + Intergenic
1004067800 6:12266353-12266375 CAAAAAGAGTTTGAGATAACAGG + Intergenic
1004857034 6:19761659-19761681 AGAAAAGAAGTTGTGATAATTGG - Intergenic
1008162887 6:48100405-48100427 AAAAGAGAGGTTCTGTTAATGGG - Intergenic
1008228449 6:48952834-48952856 AAAAAAAAAATTATCATAACAGG + Intergenic
1008671369 6:53772543-53772565 AAAAAAGAGGTTATAAAATGAGG - Intergenic
1008785633 6:55164017-55164039 AAAAAAAAGCTTATCATCACTGG + Intronic
1009504878 6:64464655-64464677 AAAAAAGAAGTCAAGATAACTGG + Intronic
1009811640 6:68675414-68675436 AAAAAGGAAATTATTATAACTGG + Intronic
1010634010 6:78234243-78234265 AAAAATGAGAATATGATAAAGGG - Intergenic
1011003654 6:82619872-82619894 AAAAATGAAGTTATAAAAACAGG - Intergenic
1012023895 6:93963180-93963202 AAAAATGAATTGATGATAACTGG + Intergenic
1012834725 6:104251297-104251319 GAAAATGAGGTTTTGAAAACTGG + Intergenic
1012950789 6:105515688-105515710 AAAAAAGAACTGATGATAGCAGG - Intergenic
1013238485 6:108220975-108220997 AAAAAAGATGTTTTGATGTCTGG + Intronic
1013570829 6:111423759-111423781 AATCAAGAGGCTATGGTAACTGG + Intronic
1014908391 6:127059028-127059050 AAAAAAGAGGTTAAAAAAAGAGG - Intergenic
1015009346 6:128325563-128325585 AAAAAAAAGGTCATCATCACTGG + Intronic
1015135644 6:129866785-129866807 TAAGAATAGGTTATGAAAACAGG + Intergenic
1015306083 6:131709620-131709642 AGAAAAGAGGACATGATAATTGG - Exonic
1015830609 6:137364680-137364702 AAAAAAGAGGTTCTAATTATAGG + Intergenic
1015944490 6:138486183-138486205 AAACTAGAGCTTATGAAAACAGG - Intronic
1015978364 6:138814194-138814216 AACAAAGAGGTAATGATTCCTGG - Intronic
1016110129 6:140212843-140212865 AAAAAAGATGTTATGACAGTGGG - Intergenic
1016348025 6:143137060-143137082 AAAAAAGAGTTCATTATAAGAGG + Intronic
1017139843 6:151180513-151180535 AAAAAAGAGGAAGTGATACCGGG - Intergenic
1017873961 6:158508856-158508878 AATAAAGAGGATATGATAGAAGG + Exonic
1018354513 6:162998875-162998897 ATAAGAGGGGTTGTGATAACTGG - Intronic
1018405781 6:163480891-163480913 GAAAAAGGGGTTTTGTTAACTGG - Intronic
1018411904 6:163558149-163558171 AAAAAAGAGGTCAGAAAAACTGG + Intronic
1018670850 6:166175902-166175924 AAAAAAAAGGTCATAATAAAAGG + Intergenic
1019248635 6:170727662-170727684 ATAAAATAGGCAATGATAACAGG + Intergenic
1020129483 7:5551550-5551572 AAAAAAGAAGTTGTAATAATAGG + Intronic
1020550831 7:9602509-9602531 AAAATAAAGATTATGATAAATGG - Intergenic
1021045662 7:15920047-15920069 AAAAAAGAGGGTGAGATAAAAGG - Intergenic
1021190588 7:17615362-17615384 AATAAAGTGTTTATCATAACAGG - Intergenic
1021501821 7:21340096-21340118 AAAAAAAAGGTCATCATCACTGG - Intergenic
1022086391 7:27072077-27072099 AAAAGGGAGGTTATAATAAAAGG + Intergenic
1023436902 7:40148759-40148781 ATGAAAGAGGTTATGGGAACCGG + Intronic
1023714794 7:43032661-43032683 ATAAAAGAGGCTATAATAGCTGG - Intergenic
1025620501 7:63165899-63165921 ATAAAAGTGTTTATGATAATGGG + Intergenic
1025959552 7:66207956-66207978 AAAAAAGATGTTATGAAGAGAGG - Intronic
1026180096 7:68031661-68031683 AAAAAAGAGAGCATGATAGCTGG - Intergenic
1026220394 7:68391475-68391497 AAAATAAAGGTTATGAAAAATGG - Intergenic
1026732385 7:72923411-72923433 AAAAAAAAAGTTATGATAAAGGG - Intronic
1027111592 7:75443953-75443975 AAAAAAAAAGTTGTGATAAAGGG + Intronic
1027283823 7:76628487-76628509 AAAAAAAAAGTTGTGATAAAGGG + Intergenic
1027516242 7:79145983-79146005 AAAAATGAGGGCATGGTAACTGG - Intronic
1027648028 7:80829168-80829190 AAAAAAAAAGTTATGTTAATGGG + Intronic
1027753687 7:82183938-82183960 AAAGAATAGGTTGAGATAACTGG - Intronic
1027765468 7:82335447-82335469 AAAATATAGGTTATGTTAACAGG + Intronic
1027902444 7:84134878-84134900 CAAAAGGAAGGTATGATAACTGG + Exonic
1028726549 7:94094248-94094270 AAAAAAGAGATTTTTATATCAGG + Intergenic
1028878568 7:95852342-95852364 ATAAAAGAAGATATTATAACTGG - Intronic
1029953910 7:104616894-104616916 AAAAAAAAGGTCATCATCACTGG + Intronic
1031603346 7:123740582-123740604 AAAAAAAAAGTTATGATGAAAGG - Intronic
1032490352 7:132319732-132319754 AAAAGAAAGGTTAGGATGACAGG - Intronic
1033678898 7:143573193-143573215 AGAAAAGAGGACATGATAATTGG + Exonic
1033692940 7:143756261-143756283 AGAAAAGAGGACATGATAATTGG - Exonic
1033731467 7:144184879-144184901 AGAAAAGAGGACATGATAATTGG + Exonic
1033740197 7:144267853-144267875 AGAAAAGAGGACATGATAATTGG - Exonic
1034191464 7:149216512-149216534 AGAACAGAGGTTCTGATAAGAGG - Intronic
1035980053 8:4360451-4360473 AAAAAAGAGGTTATGATAACGGG - Intronic
1037241451 8:16783488-16783510 AATACAGTGGTTATGATAGCAGG + Intergenic
1039242678 8:35573786-35573808 AAACAATAGTTTAAGATAACAGG - Intronic
1039577035 8:38632046-38632068 AAAAAACGGGTTCAGATAACAGG - Intergenic
1040433256 8:47364774-47364796 AGAAAAAAGGTAATGATTACAGG - Intronic
1040918636 8:52591220-52591242 ACAAAAAAGGTTATGATAAATGG - Intergenic
1041706822 8:60855278-60855300 ATAAAGGAGGTTAGCATAACAGG - Intronic
1041930114 8:63277251-63277273 AAAAAAGAGGTTCTGAGAGCTGG - Intergenic
1041981634 8:63868329-63868351 ACAAAAAAGATTATGATAACTGG + Intergenic
1041982463 8:63878512-63878534 AAAAAAGAGATGTTGATATCAGG - Intergenic
1042460782 8:69065019-69065041 AACAAAGAGGGTATTATAAAAGG + Intergenic
1042544463 8:69938681-69938703 AAAAAAGAGGATAGGAAAAGAGG + Intergenic
1042636903 8:70886637-70886659 AAAAAAAAGCTTATCATCACTGG - Intergenic
1042657664 8:71117853-71117875 AAAAAAAAGAATATGATTACTGG + Intergenic
1043239213 8:77910791-77910813 AAAACAGAGGGTATGAAAAGAGG + Intergenic
1043309147 8:78836642-78836664 AAAAAAAAGGTCATCATCACTGG + Intergenic
1043640374 8:82442870-82442892 ACAACAGAGGCTATGATACCGGG + Intergenic
1044364726 8:91330619-91330641 AGAAATGAGGTTATAAAAACTGG + Intronic
1045177174 8:99738269-99738291 AAAAAAGGTGTCATGATAAAGGG - Intronic
1045510474 8:102808791-102808813 AAAATAGAGGTGATGATTCCTGG + Intergenic
1045632234 8:104138429-104138451 AAAAAAGAGGTGATGAATGCTGG - Intronic
1045962314 8:107982576-107982598 TAAAAAGAGAATCTGATAACTGG - Intronic
1046911613 8:119633805-119633827 AAAAAAAAGTTTATGAAATCTGG - Intronic
1048177493 8:132165838-132165860 AAAAATGGGGTTATGAAAAATGG + Intronic
1048783544 8:138026676-138026698 AAAAAAGAAGCTAAGAAAACAGG - Intergenic
1052079669 9:24188537-24188559 CAAAAAGAAGTTATGTAAACAGG + Intergenic
1052550491 9:29941454-29941476 TAGAAAGAGGATATGATAAGAGG + Intergenic
1052620849 9:30907933-30907955 AATAAAGATATTATAATAACAGG + Intergenic
1053091303 9:35279993-35280015 CAAAAAGAGGTCTTGATAACTGG + Intronic
1053725048 9:40991291-40991313 AGAAAATACGTTATGATAGCGGG + Intergenic
1054154322 9:61629418-61629440 AAAGGATAGGGTATGATAACAGG - Intergenic
1054340920 9:63860703-63860725 AGAAAATACGTTATGATAGCGGG - Intergenic
1054474104 9:65560538-65560560 AAAGGATAGGGTATGATAACAGG - Intergenic
1055417900 9:76104079-76104101 AAAAATGACGTTATGAAAACTGG - Intronic
1057614113 9:96572878-96572900 TAAAAAGAGGTAATGATAGTGGG - Intronic
1058368076 9:104234200-104234222 AAAAAAGAGGATGTGATCTCTGG - Intergenic
1058582934 9:106478660-106478682 AAAAAACAGGCTAGGACAACAGG + Intergenic
1058654341 9:107206249-107206271 AAAAAACAGCTTAAAATAACTGG + Intergenic
1059317453 9:113438310-113438332 AAAAAAAAGCTCATCATAACTGG - Intergenic
1061357192 9:130115236-130115258 AAAGAAGAGGTTATTAAATCTGG - Intronic
1061376811 9:130230967-130230989 AAAAAAAAGAGTAAGATAACAGG - Intronic
1203609594 Un_KI270748v1:84926-84948 ATAAAATAGGCAATGATAACAGG + Intergenic
1186006331 X:5076595-5076617 ATCAAAGAGGTTATGAGAAGGGG - Intergenic
1186846301 X:13534270-13534292 CAAAAAGAGGTTGTGTTGACTGG + Intergenic
1187544253 X:20232049-20232071 TAAATAGAGGTTAGGATAACAGG + Intronic
1187638926 X:21265070-21265092 AAAAAAAAGCTCATGATCACTGG - Intergenic
1188614626 X:32142368-32142390 AAAAGAGAGGTTTTGACAAAGGG + Intronic
1188950777 X:36370736-36370758 AAAAAATAGGATAGGAAAACAGG + Intronic
1189610484 X:42728139-42728161 AAAATAAAGCTTATTATAACTGG + Intergenic
1189747146 X:44180802-44180824 AAAAAAGAAGTTATGATGTCTGG + Intronic
1190027458 X:46938230-46938252 AAAAAAGAGGAAATAAAAACAGG - Intronic
1191675841 X:63791552-63791574 GAAAAAGAGGTCATGAAAAAAGG + Intergenic
1191928165 X:66338630-66338652 GAAAAAGAGATTATCATCACTGG - Intergenic
1193275402 X:79581020-79581042 AGAAAAGTGGTTGTGATAAAAGG - Intergenic
1194343754 X:92735961-92735983 AAAAAAGAGGTTAAAAGAAATGG + Intergenic
1195028763 X:100905781-100905803 TCAAAAGAGGATATGAAAACAGG + Intergenic
1195573665 X:106425105-106425127 AGAAAAGAGGTTATAGTATCAGG - Intergenic
1195664841 X:107419710-107419732 AAAAAAGAGGGAAAGATAACAGG - Intergenic
1195872389 X:109499952-109499974 AAAAAAGGGCTTATGACAGCAGG - Intergenic
1196156997 X:112441168-112441190 AAAAAAGAGGTTCCTATTACTGG - Intergenic
1196414869 X:115460137-115460159 AAAAAAGCCATTCTGATAACAGG + Intergenic
1196631004 X:117939687-117939709 AAAAAAAAGCTCATGATTACTGG - Intronic
1196969475 X:121093116-121093138 AAGAAAGAGGATTTGATTACAGG + Intergenic
1197222734 X:123929296-123929318 AAAAAAGAGGCTATGATAACAGG - Intergenic
1198456104 X:136819546-136819568 AAAAAAAAAGTCAAGATAACAGG - Intergenic
1198867779 X:141143739-141143761 AACAAAGAGGTTATATCAACTGG - Intergenic
1199410496 X:147517113-147517135 ATAAAAGATGTTGTGAGAACTGG - Intergenic
1200652108 Y:5852624-5852646 AAAAAAGAGGTTAAAAGAAATGG + Intergenic
1201437532 Y:13975446-13975468 AAAAAAGAGAAAATGACAACAGG - Intergenic
1202265000 Y:23008746-23008768 GAAATTGGGGTTATGATAACTGG - Intergenic
1202417991 Y:24642488-24642510 GAAATTGGGGTTATGATAACTGG - Intergenic
1202452795 Y:25027598-25027620 GAAATTGGGGTTATGATAACTGG + Intergenic