ID: 1035980054

View in Genome Browser
Species Human (GRCh38)
Location 8:4360452-4360474
Sequence GAAAAAAGAGGTTATGATAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 530
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 488}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035980054_1035980058 17 Left 1035980054 8:4360452-4360474 CCGTTATCATAACCTCTTTTTTC 0: 1
1: 0
2: 3
3: 38
4: 488
Right 1035980058 8:4360492-4360514 TCCTCCCAGGTTCTTTGAGATGG No data
1035980054_1035980062 24 Left 1035980054 8:4360452-4360474 CCGTTATCATAACCTCTTTTTTC 0: 1
1: 0
2: 3
3: 38
4: 488
Right 1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG No data
1035980054_1035980056 4 Left 1035980054 8:4360452-4360474 CCGTTATCATAACCTCTTTTTTC 0: 1
1: 0
2: 3
3: 38
4: 488
Right 1035980056 8:4360479-4360501 ACATACTTCCTGTTCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035980054 Original CRISPR GAAAAAAGAGGTTATGATAA CGG (reversed) Intronic
901675747 1:10882987-10883009 GAAAGATTAGTTTATGATAAAGG - Intergenic
904234918 1:29109205-29109227 AAAAAAAGAGGTCATTCTAAGGG + Intronic
906902428 1:49849796-49849818 AAGAAAAGATGTTATGAGAAAGG + Intronic
906986544 1:50689075-50689097 GACAAAAAAGGTTTTGAAAATGG + Intronic
908330341 1:63064637-63064659 CAAAAGAGGGGTTGTGATAAAGG - Intergenic
909043245 1:70678782-70678804 GAAAAATGAAAATATGATAATGG + Intergenic
909352481 1:74671183-74671205 AAAAACAGAGCTAATGATAAGGG - Intronic
909425629 1:75521552-75521574 TTAAAAACAGGTTAAGATAATGG + Intronic
909561939 1:77016916-77016938 GAAAAAAGAGGTCTTAATAATGG - Intronic
909778986 1:79519015-79519037 GAAAAAATATGTCATTATAAGGG + Intergenic
909995154 1:82269952-82269974 GAAAAAAGAGGTGAAGGGAAGGG - Intergenic
910017568 1:82546473-82546495 GAAAAAAGAGGCTACAATAATGG - Intergenic
910241909 1:85095876-85095898 GAGAAAAGAGATTAAGATCATGG - Intronic
910953706 1:92678555-92678577 GAAAAAAGATGTCCTGAAAAGGG + Intronic
910979506 1:92945222-92945244 AAAAAATAAGGCTATGATAAAGG + Intronic
911545002 1:99205979-99206001 AAAAAGAGAGGTTAAGAAAACGG - Intergenic
911992117 1:104712031-104712053 GAGAAAAGAGGTAAAGATAGTGG - Intergenic
912583830 1:110743710-110743732 TTAAAATGAGGTTATGATAGTGG + Intergenic
913375895 1:118152176-118152198 GAAAAGAGAGGGAATAATAAGGG + Intronic
915657736 1:157375597-157375619 GAAAGAACAGGTTATGAAAAAGG - Intergenic
915671330 1:157491379-157491401 GAAAGAACAGGTTATGAAAAAGG + Intergenic
915849317 1:159304245-159304267 GAAAAAACAGGTTATTCCAAGGG + Intronic
916829573 1:168476812-168476834 GAACAAGGAGGTTATTATGAAGG + Intergenic
916895675 1:169159496-169159518 GAGAAAAGAGGTGAATATAATGG - Intronic
917421725 1:174870725-174870747 AAAAAAAGAAGTTATAATAGTGG - Intronic
917734179 1:177905382-177905404 GAAACATGTGGTCATGATAAAGG + Intergenic
918266724 1:182849119-182849141 GAAATAAGTGATTATGAAAAAGG - Intronic
918645714 1:186902390-186902412 GAAGAAAGATTTTGTGATAAGGG - Intronic
918808854 1:189088720-189088742 GAAAAAAAAGGAAAAGATAATGG + Intergenic
919233256 1:194803675-194803697 GAAAAAAGGGCTTAAGAAAAAGG - Intergenic
919284320 1:195534652-195534674 GAGAAAAGAGATTATGTTGAAGG + Intergenic
919357493 1:196542802-196542824 GAAACAAGTGGTTCTGTTAAAGG + Intronic
919708819 1:200705797-200705819 GAAAAAGGAAGTTAACATAAGGG - Intergenic
919977222 1:202620453-202620475 AAAAAAAAAGGATAAGATAAAGG - Intronic
920545519 1:206813356-206813378 GAAAAAAAAAGTTATGATGAAGG - Intronic
921533475 1:216314202-216314224 TGAAAAAGAGGTTATGAGCATGG - Intronic
921718317 1:218441963-218441985 AAAAAAAGAGGTCATATTAATGG + Exonic
921911299 1:220552117-220552139 AAAAAAAGAGGTTACCATACTGG - Intronic
922950194 1:229552779-229552801 GAAAAACGAGGATAAGATGAGGG - Intronic
922950317 1:229553612-229553634 GAAAAATGAGGATAAGATGAGGG + Intronic
923021737 1:230169776-230169798 TAAAAAATATGTTATGATAAAGG - Intronic
923916996 1:238518828-238518850 GAAACAATAGGTTAAGAAAATGG + Intergenic
924207326 1:241726405-241726427 AAAAAAAGAGATTATGATAATGG + Intronic
1063638026 10:7803635-7803657 TGAAAAAAAGGTTAAGATAATGG + Intronic
1064082018 10:12315930-12315952 GTAATAAGAGTTTATGATAAAGG + Intergenic
1065134300 10:22653094-22653116 GAAAGAAGGGTTTATGAGAAAGG + Intronic
1065908522 10:30280998-30281020 GAAAAAAATGCTTAAGATAAGGG + Intergenic
1066092723 10:32041629-32041651 GAAAAAAAATGTTATGAGACAGG + Intronic
1066240921 10:33533951-33533973 GAGAAGAGAGGTTAGGAAAAAGG - Intergenic
1068732500 10:60374920-60374942 GAAAAATGAGGTTACAAAAAAGG + Intronic
1068807443 10:61214127-61214149 GAAAATAGAGGGAATGATAAAGG + Intergenic
1070348684 10:75570854-75570876 AAAAAATGAAATTATGATAATGG - Intronic
1070370984 10:75781712-75781734 GAAAAAAGAGGTTTAGGTAAGGG + Intronic
1070660582 10:78302966-78302988 GGAAGAAGAGGCTATGAGAATGG + Intergenic
1071259381 10:83906270-83906292 GAAAAAAAATGTTACAATAATGG + Intergenic
1072363098 10:94679462-94679484 GAAAAAAGACAATATGCTAAGGG + Intergenic
1073552784 10:104418649-104418671 GAACAAAGAAGTCATGGTAATGG - Intronic
1073718765 10:106140797-106140819 GAATAATTATGTTATGATAAAGG + Intergenic
1074163236 10:110851859-110851881 CAAAATCGAGGTTATGATATAGG - Intergenic
1074461884 10:113645778-113645800 GATAAAAGAGGTGATGCTCATGG + Intronic
1078290289 11:10003962-10003984 GAAGAAATAAGCTATGATAAAGG - Intronic
1078984993 11:16585038-16585060 AAATGAAGAGGTTATAATAAAGG + Intronic
1079257887 11:18848384-18848406 GAAACAAGAGGTAATGACAGAGG - Intergenic
1079542262 11:21590634-21590656 GGAAAAAGATGTCATGCTAAAGG - Intergenic
1079708988 11:23656865-23656887 GAAAAACAAGGAAATGATAAAGG - Intergenic
1079886307 11:25993510-25993532 GAAAAATGAGTTGATGAAAAGGG - Intergenic
1080986569 11:37474088-37474110 GAAAAAAGAGGGAGTGGTAAAGG - Intergenic
1081024605 11:37994666-37994688 GAAATAAGAGGTTAAAATAGTGG + Intergenic
1081370619 11:42296873-42296895 GAATTAAGATGTTATGAGAAAGG - Intergenic
1081713998 11:45235713-45235735 GAAGACAGAGGTTAAGAAAAAGG - Intergenic
1081924989 11:46818645-46818667 GAAAAAAGAGTTTAAGAAATTGG + Intronic
1083032628 11:59607441-59607463 GAAAAATGATGTTAAAATAAAGG + Intronic
1083402748 11:62435287-62435309 GAAGAAAGAAGTTATGTGAATGG - Intronic
1084076327 11:66780454-66780476 TAAAAATGAGGTTAAGGTAAAGG - Intronic
1086189968 11:84067412-84067434 GAAAACAGAAGTTATGAAAAGGG + Intronic
1086270050 11:85052423-85052445 GAGAATAGAGGTTTTCATAAAGG + Intronic
1086800429 11:91167794-91167816 GAAAAGAGATGGTAAGATAACGG + Intergenic
1087080646 11:94168113-94168135 GAAGAGAGAGTTTATGAAAAGGG - Intronic
1087706692 11:101501416-101501438 GAAAAAAGAAGTTATTTTTAAGG + Intronic
1087816857 11:102667489-102667511 AAAAAAAAAGTTTATGATAATGG - Intergenic
1087858141 11:103118504-103118526 AAAAAAAAAGGTTAAGAGAAAGG - Intronic
1087955134 11:104276934-104276956 GAAAAAAAAGCTTTAGATAAGGG - Intergenic
1087974662 11:104530214-104530236 GAAAAGAAAGGTTACCATAATGG + Intergenic
1091519223 12:1219338-1219360 GGAAGAAGAGGTTTTGAAAAAGG - Intronic
1092059399 12:5536225-5536247 GAAGAAAAAGGATATTATAAAGG - Intronic
1092685163 12:11035069-11035091 GAAAAGATAGATTATGTTAAAGG - Intronic
1092687363 12:11065215-11065237 GAAAAGACAGATTATGTTAAAGG - Intronic
1092689853 12:11095976-11095998 GAAAAGATAGATTATGTTAAAGG - Intronic
1092857977 12:12692993-12693015 GACAAAAAAGGTAGTGATAATGG - Intronic
1093024516 12:14233853-14233875 GCAAAAAGAGGTTGGGATGAGGG - Intergenic
1093028021 12:14262100-14262122 GGAAAAAGAGGATGTGATATGGG + Intergenic
1093266150 12:17006252-17006274 GAAAAAAAAAGTTAAGATGATGG - Intergenic
1093487405 12:19666371-19666393 GAAAAAATAGGCCAGGATAAAGG - Intronic
1093686441 12:22060153-22060175 AAAAAAGGAGGATATGATTAAGG + Intronic
1093771452 12:23022818-23022840 GAATAATGAGGTTTTGACAAAGG - Intergenic
1094300695 12:28961991-28962013 GATAAAAGAGGTTTTAGTAAAGG - Intergenic
1094742043 12:33301081-33301103 AAATAAAAGGGTTATGATAAAGG + Intergenic
1095679937 12:44962229-44962251 AAAAACAGATATTATGATAAAGG + Intergenic
1095694092 12:45124810-45124832 GAAAGAAGAGGTGAGGATAGAGG - Intergenic
1095869205 12:47007341-47007363 AAAAAGAGAGGTTATGATGTTGG - Intergenic
1096863567 12:54547924-54547946 GAAAAAAGTGGAAATAATAAGGG - Exonic
1097579609 12:61438678-61438700 GAAAAAGGAAGTTAGGAAAATGG - Intergenic
1097601781 12:61702046-61702068 AAAAAAAGAGGATTTGAAAATGG + Intergenic
1097650277 12:62289441-62289463 TAAAAAAGAAGATATTATAACGG - Intronic
1097745800 12:63302051-63302073 GAAAAAAAAAGTTGTGAAAATGG + Intergenic
1098053946 12:66483849-66483871 AAAAAAAGAAGTTAGGATAATGG - Intronic
1098226237 12:68328025-68328047 GAAAAAGGAGATTATGAAAGGGG - Intronic
1099019537 12:77386193-77386215 GGAAAAAGAAGTTATGAAATTGG - Intergenic
1099318196 12:81111129-81111151 AAAAAAAGACCTTATGAAAAGGG + Intronic
1099336360 12:81364773-81364795 GAAATAAGAGGATTTGATATTGG + Intronic
1099571047 12:84319119-84319141 GAACAAAGATTTTATGATGAAGG + Intergenic
1100020377 12:90062194-90062216 GAACAATGAGATTATTATAATGG + Intergenic
1100538536 12:95535711-95535733 GAAAAAAGTGTTTGTGATCACGG - Intronic
1100634768 12:96425207-96425229 GATAAAAGAGATGAAGATAATGG + Intergenic
1101037352 12:100718073-100718095 GAAATAAAAGTTTATGAAAAAGG + Intronic
1101068099 12:101044170-101044192 GAAAAAAGAGTTTCTTAGAAAGG - Intronic
1101757833 12:107635252-107635274 GAAAGAGGAGGTCATGATACAGG - Intronic
1102448820 12:113025158-113025180 GATAAAGGAGGTCATGAGAAAGG + Intergenic
1102529294 12:113534324-113534346 AAAAAAAGAGGTTATTAGAAAGG - Intergenic
1102727278 12:115076792-115076814 GAAAGAAGAGGTTATCATATGGG - Intergenic
1103253161 12:119518349-119518371 GAAAACAGAGGTTTAGAGAAAGG - Intronic
1103280892 12:119757127-119757149 AAAAAAAGAGGTTAGCACAAGGG + Intronic
1103644921 12:122384066-122384088 TAAAAAAGAGGTAATAATAGTGG - Intronic
1105237927 13:18578034-18578056 GAAAAAACACTTTATGATATTGG + Intergenic
1106739185 13:32620669-32620691 AAAAAAAGTGGTAGTGATAACGG + Intronic
1106998674 13:35519150-35519172 GACAAAAGAAGTCTTGATAAAGG - Intronic
1107148665 13:37087224-37087246 GAAGCAAGAGGTCATGAAAATGG + Intergenic
1107750039 13:43555169-43555191 GTAAAAAGATGTTAGGATTAAGG + Intronic
1108043847 13:46364400-46364422 AAAAAAAGAAGTTATGTGAAGGG + Intronic
1108343124 13:49517162-49517184 AAGAAATAAGGTTATGATAACGG - Intronic
1108838865 13:54586474-54586496 GAAAAAAGAGGTATTGATCTGGG - Intergenic
1110977036 13:81851472-81851494 GAAAAAAAAGGATGAGATAAAGG + Intergenic
1111100384 13:83576660-83576682 GAAAAAATAAGTCATGAGAAAGG - Intergenic
1111216999 13:85157010-85157032 GTGAATAGAGGTTTTGATAAAGG - Intergenic
1111552382 13:89831256-89831278 GAAAATGGAGAGTATGATAAAGG + Intergenic
1111877367 13:93914054-93914076 AAAAAAGGAGCTTATGAGAAAGG - Intronic
1113322607 13:109250347-109250369 GAAAAGAAAGGTAATGACAATGG + Intergenic
1114444195 14:22775714-22775736 GAAGAAAGAGGTTGTGGTATCGG + Intronic
1114781866 14:25547215-25547237 GAGAAAAGATGAAATGATAAAGG - Intergenic
1114949555 14:27731890-27731912 AAAAAAAAAGGTTACAATAATGG - Intergenic
1115636147 14:35292013-35292035 GATAAAAGAGGTTAGGAAGAAGG + Intronic
1115728561 14:36243424-36243446 GAAAAATGAGGTTACCATAATGG + Intergenic
1115895747 14:38084846-38084868 GAAAACAGAGGCTATTTTAAAGG + Intergenic
1116597463 14:46869027-46869049 GGAAAAAGAGGTAATAAAAAGGG - Intronic
1117262557 14:54051163-54051185 GAAAAAAGAGGGTAAGATGAAGG - Intergenic
1117316551 14:54576724-54576746 GAAATAAGAGGTTTTGTCAAAGG - Intronic
1119196639 14:72722039-72722061 GACAAAAGGGGAAATGATAAGGG + Intronic
1119518647 14:75269043-75269065 GAAGTAAGAGGTTATGAAATAGG - Intronic
1119961175 14:78858464-78858486 GAAGAAAGAGGTAAAGATGAAGG + Intronic
1120142926 14:80948514-80948536 CAATAAAGAGGTTATGGAAAGGG + Intronic
1120243442 14:81977219-81977241 AAAGAGAGAGGTTTTGATAATGG - Intergenic
1121070461 14:91015564-91015586 GAAAAATGAGGTTATGACTTAGG - Intronic
1121295859 14:92822190-92822212 GAGAAAAGAGATTATGAGAAAGG - Intronic
1123221438 14:106860589-106860611 GACAAAAGAGGAGATGATAGAGG - Intergenic
1124492886 15:30168837-30168859 GAAAGAAAAGGATAAGATAAAGG - Intergenic
1124750648 15:32369488-32369510 GAAAGAAAAGGATAAGATAAAGG + Intergenic
1125061494 15:35431359-35431381 TAAAAGGGAGGTTATGAAAATGG + Intronic
1125239364 15:37556059-37556081 GAAAGAAGAAGTTATTTTAAGGG + Intergenic
1125843356 15:42826837-42826859 AAAAATAGAGGTTGTGGTAAAGG + Intronic
1126457733 15:48882456-48882478 CAAAACAGAGGTGAGGATAACGG - Intronic
1126547457 15:49888772-49888794 GAACAGAGAGGTTTGGATAAAGG - Intronic
1126759036 15:51952385-51952407 GCAAAAAGAGGTTAAGAAAGTGG + Intronic
1127819942 15:62645898-62645920 GAAAAAAGCGTTTGTGATACAGG + Intronic
1129026149 15:72576164-72576186 GAAAGAGGAGGTAAGGATAAAGG + Intronic
1129556664 15:76517337-76517359 AAAAAAAGATGTTAATATAAAGG - Intronic
1129805378 15:78452258-78452280 GGAAGATGAGGTGATGATAAGGG + Intronic
1130685718 15:86035647-86035669 AAAAAAAGATGTTAACATAAAGG - Intergenic
1132069487 15:98763197-98763219 GAAATAAGAGCTTATCAAAATGG - Intronic
1133839942 16:9398794-9398816 GAAAAGACAGCTTCTGATAAAGG + Intergenic
1135079843 16:19424650-19424672 AAAAAAAAAGAATATGATAAAGG + Intronic
1135487863 16:22881590-22881612 GAACAAAGAGGTCAACATAAGGG + Intronic
1135636796 16:24084473-24084495 GATAAAAGCGGTTAAGAAAATGG + Intronic
1136611613 16:31369951-31369973 AAAAAAAAAGGTAATAATAATGG - Intronic
1136651088 16:31671912-31671934 GAAAAAAAATGTTTTGAAAACGG - Intergenic
1137745006 16:50814043-50814065 GATAAAACAGGTTGTGGTAAAGG + Intergenic
1137911910 16:52386052-52386074 GAAATAAGAAATTATGCTAAGGG + Intergenic
1137929409 16:52572707-52572729 GAAAGAAGAGATTATGAGGAGGG - Intergenic
1140165908 16:72550721-72550743 CAAAATGGAGGATATGATAAAGG + Intergenic
1140791302 16:78393851-78393873 TAAAAAAAAGGTTAAAATAACGG + Intronic
1141095510 16:81160083-81160105 GAACAAAGAGGTTAAGGAAAAGG - Intergenic
1142106585 16:88306979-88307001 GAACAAGGAGCTGATGATAAAGG - Intergenic
1143230106 17:5346273-5346295 TAAAAAAGAGGAAATTATAATGG - Intronic
1144473077 17:15561882-15561904 GAAAAAACAGGTTGCAATAAAGG + Intronic
1144923405 17:18782838-18782860 GAAAAAACAGGTTGCAATAAAGG - Intronic
1146242549 17:31243846-31243868 GAAAGAAGAGGTAAGAATAAAGG - Intronic
1146309645 17:31757428-31757450 AAAAAAAAAGCTTATGAAAAGGG - Intergenic
1146979145 17:37143192-37143214 AAAAAAAGATGTTATGAGCATGG - Intronic
1146979286 17:37144732-37144754 GAAAAAAGAAGTTATGTGATGGG - Intronic
1147468941 17:40638877-40638899 GAAAAATAAGGTTATGATTGGGG - Intronic
1148940578 17:51206769-51206791 TAAAAAATATGTTATGATATAGG - Intronic
1150489438 17:65564196-65564218 GAAAAAAGAGGTTTTCAAAAAGG + Intronic
1150662277 17:67093184-67093206 AAAACAAGATGTTATGAAAAAGG + Intronic
1152170611 17:78744644-78744666 GAAAAAAGAGTTGATGGCAAAGG + Intronic
1155126613 18:22883711-22883733 GAAGAAAGAGGTAAACATAATGG + Intronic
1155320030 18:24609957-24609979 GAAAAAAATGGCTATGATAAAGG - Intergenic
1155610357 18:27660355-27660377 GGAGAAAGAGGTTTGGATAAAGG + Intergenic
1155858897 18:30871393-30871415 AAACAAAGAGGTTTTGATGAAGG + Intergenic
1156645922 18:39162265-39162287 CAAAAAAAAGATTATTATAAAGG + Intergenic
1157129218 18:44988316-44988338 GAACAAATAAGTGATGATAATGG + Intronic
1158149850 18:54356314-54356336 GAAAGAGGAGGTTATAATAATGG - Intronic
1158821134 18:61159905-61159927 AAAAAAAGAGTTACTGATAATGG + Intergenic
1158994093 18:62899496-62899518 TAAAAAAGAGGCTATGGAAAAGG - Intronic
1159656635 18:71036672-71036694 GAAAATAGAAGTTATCAGAAGGG - Intergenic
1159746691 18:72244246-72244268 TAAAAAAGAGATTATGAAAATGG + Intergenic
1166173289 19:41047507-41047529 GAAAAAAGAGGCTGTGGTAGGGG - Intergenic
1166274873 19:41746211-41746233 GACAAAAGAGGGTGTGAAAATGG + Intronic
1166774237 19:45302798-45302820 GGAAACTGAGGTGATGATAAAGG - Exonic
1167129542 19:47574854-47574876 GAAAAAAAGGGTTATGGTGATGG + Intergenic
926795099 2:16612379-16612401 GAAAAAAGAGGGTGGGATGAAGG + Intronic
927687083 2:25178603-25178625 GAAAAAAGGGCTTGGGATAAGGG - Intergenic
928019867 2:27695730-27695752 GAAATATGAGGTTATGCTATGGG + Intergenic
928226529 2:29453694-29453716 GAGAAAAGAGGAGCTGATAAAGG + Intronic
928482396 2:31695609-31695631 GAAAAAAGAGGTGATAACACTGG - Intergenic
931490738 2:62743896-62743918 GAAGAAAGAGGCTAGGAAAAAGG - Intronic
931609574 2:64084111-64084133 CAAAAAAGAGATTTTGGTAATGG + Intergenic
931631030 2:64299344-64299366 GAAAAAAAAGGTCATGTTCAAGG + Intergenic
932348115 2:71008841-71008863 TAATAAAGAGGGTATGATGAAGG + Intergenic
932838988 2:75064096-75064118 AAAAAAAAAGGTTCTGAAAAGGG + Intronic
933151658 2:78922561-78922583 GAGAAATCAGGTTATGGTAAAGG + Intergenic
933216957 2:79642073-79642095 GAAAAAGGAGATTCTGAAAAGGG + Intronic
934126890 2:88903321-88903343 AAAAAAAGCAGTTATGACAATGG + Intergenic
935540621 2:104343996-104344018 TAAAAAAGAGCCTATGATACAGG - Intergenic
937438011 2:121895258-121895280 GACAAATGTGTTTATGATAATGG - Intergenic
939536173 2:143432182-143432204 GAAAAAAGAAGTTCTAAAAAAGG + Intronic
940483631 2:154268893-154268915 GACAAAAGAGCTTATTTTAAGGG - Intronic
941183270 2:162287314-162287336 GAAAAAAGACTTTCTGATCAAGG + Intronic
942770315 2:179509932-179509954 GAAAAGTGACCTTATGATAAGGG - Intronic
942850645 2:180481159-180481181 AAAAATAGAGGTTAAAATAAAGG - Intergenic
943273020 2:185831449-185831471 GAAAAAAGATGTAATAATAAGGG - Intronic
943495903 2:188620495-188620517 GAAAAAAAAGGTGAAGATAAGGG - Intergenic
943910363 2:193558217-193558239 GAAATAAAAGTTTATAATAATGG - Intergenic
944264891 2:197712351-197712373 GAAAAAAGAGGCAAAGAAAAAGG + Intronic
944298892 2:198100164-198100186 GAAAAAAGTGATTATGTAAATGG + Intronic
944382717 2:199130211-199130233 GAAAAATGAGGTAATTATATAGG + Intergenic
944607742 2:201368403-201368425 GGAAAAATATTTTATGATAATGG + Intergenic
945004232 2:205386490-205386512 GAACAGAGAGCTTAGGATAAGGG + Intronic
945691972 2:213047446-213047468 GAACAAAGAGGTTAAGGTAGAGG + Intronic
946123795 2:217541085-217541107 TAACAAATAGGCTATGATAAAGG + Intronic
946279331 2:218655391-218655413 AAAATAAGAGGTGAGGATAATGG + Intronic
946629491 2:221651320-221651342 TAAAAAACAGTTTAAGATAAAGG - Intergenic
946658023 2:221969911-221969933 GGACAAAGAGGTGAGGATAAAGG + Intergenic
947246370 2:228053225-228053247 GTTAAATGAGGTTATGAGAATGG - Intronic
947627897 2:231632471-231632493 GAAAAAAGAGGCTACAATGAAGG - Intergenic
1169368457 20:5010107-5010129 AAAAAAAGAGGATATGAAAGAGG + Intronic
1169654083 20:7903437-7903459 GAAAAGAGAGGTGGTGATGATGG + Intronic
1169976740 20:11337845-11337867 GCAAGAAGAGGTCATGCTAATGG + Intergenic
1169993789 20:11533990-11534012 GAAAAAAGAGAATATGATTCTGG + Intergenic
1172673196 20:36648534-36648556 AAAAAAAAAGGATACGATAAAGG - Intergenic
1173657960 20:44714135-44714157 GATAAAAGAGGTGATGTCAAGGG - Intergenic
1173967441 20:47123679-47123701 GAATAAAGGGGATATGAAAAGGG + Intronic
1174675302 20:52348236-52348258 GAAAAAAGTGCTTCTGATTATGG - Intergenic
1174772059 20:53309389-53309411 GAAAAAAGAATTTATCAAAAAGG + Intronic
1175190448 20:57208751-57208773 AAAAAATGAAGTTCTGATAAAGG + Intronic
1176514370 21:7772854-7772876 AAAAAAAGAGGATAGGATTAGGG + Intergenic
1177969736 21:27774884-27774906 AAAAGAAGAGGTAATGATAGAGG + Intergenic
1178301871 21:31459930-31459952 GGAAAAAGAGGGGAAGATAATGG - Intronic
1178522547 21:33298690-33298712 GAAAAAAGAAGTTATTATCCAGG + Intergenic
1178648483 21:34403378-34403400 AAAAAAAGAGGATAGGATTAGGG + Intronic
1179311927 21:40203833-40203855 GAAAAAAAGTGTTAAGATAATGG + Intronic
1179348409 21:40583565-40583587 GAAAAAAGAGAAGAGGATAAAGG + Intronic
1180711654 22:17843300-17843322 GAGAATAGTGGTGATGATAAGGG - Intronic
1180919470 22:19513457-19513479 GAAAAAAATGGATGTGATAAAGG - Intronic
1181411168 22:22720821-22720843 GACAGAAGAGGTGAGGATAAGGG - Intergenic
1181917950 22:26295965-26295987 GAGAAAAGAGGATAAGATATAGG + Intronic
1182360585 22:29744315-29744337 GAAAACAGAGGTTCAGACAAGGG + Intronic
1182967874 22:34539742-34539764 CACAAAAGAGGTTATAAAAATGG - Intergenic
1183776577 22:39970103-39970125 AAAAAAAGATGCAATGATAAAGG - Intronic
1184088075 22:42277692-42277714 GCAAAAAGAGGAGATGATGAAGG + Intronic
1184996326 22:48210007-48210029 GGAAATAGAGATTATTATAACGG + Intergenic
949134130 3:541879-541901 AAAAAAAAAGGTTATGTTATTGG - Intergenic
949439490 3:4065304-4065326 GAAAGAAGAGGAAATGAGAATGG + Intronic
950321468 3:12058804-12058826 GAGGAAAGAGGGAATGATAAAGG - Intronic
951111703 3:18811666-18811688 AACAACAGAGGTTAAGATAAAGG - Intergenic
952516399 3:34108746-34108768 GACATAAGAGGTGATGAAAAAGG - Intergenic
952590182 3:34943111-34943133 GAAAAAAGAAGTTATAAGAAAGG - Intergenic
952657637 3:35805319-35805341 AAAAAAAAAGCTAATGATAAAGG + Intergenic
956027744 3:65001671-65001693 GAAAAAGGAGGCTATAATAGGGG - Intergenic
956203592 3:66732893-66732915 GAAAAAAATGGTTATGATTGAGG - Intergenic
956303740 3:67801793-67801815 GATAAAGAAGGTCATGATAAAGG - Intergenic
956634039 3:71345567-71345589 GAAAAAAGAAGTAATTTTAAGGG - Intronic
956714586 3:72067413-72067435 GAAAGTAGAGGTTAAAATAAGGG - Intergenic
956898986 3:73694043-73694065 GAAATGAGAGGTGAGGATAAAGG - Intergenic
957497045 3:81006307-81006329 GGAAATAGAGGTTAATATAAAGG - Intergenic
957638896 3:82823258-82823280 GAAGAAAAAAGTTATGATTAGGG - Intergenic
957669608 3:83283563-83283585 GAAAAAATAGGTCATGCTCATGG - Intergenic
958215903 3:90575254-90575276 CCAAAAAGAGTTTATGAAAACGG + Intergenic
958541958 3:95489119-95489141 GAAGATAGAGGTTATAATACTGG - Intergenic
959283003 3:104370402-104370424 GAATGAAGAGCTTATGATGAAGG - Intergenic
959556076 3:107720001-107720023 TAAAACAGTGGGTATGATAAAGG - Intronic
961425632 3:126844859-126844881 CAGAAAAGAAGATATGATAAGGG + Intronic
964748439 3:160033170-160033192 TAAAAAAAAGAATATGATAAAGG + Intergenic
965799920 3:172481484-172481506 GAAAAAAGAAGAAATGATAGTGG - Intergenic
966153410 3:176891050-176891072 GTAAAAAGAGGTTTTGAAAGGGG - Intergenic
967284167 3:187852626-187852648 GTAAAAAGAGGTTCTGATGTTGG + Intergenic
967332298 3:188302955-188302977 GATAAAAGAGGTTCTGCCAAAGG + Intronic
967702613 3:192610993-192611015 GAAAATAAAGATCATGATAAGGG - Intronic
968160755 3:196424690-196424712 AAAAAAAAAGGTTATAAAAATGG - Intronic
968248324 3:197178656-197178678 GAAAAAGGAGGATACTATAAAGG + Intronic
968605984 4:1536004-1536026 GTAAAATGAGGTGATCATAATGG - Intergenic
969286196 4:6203648-6203670 AAAAAAAGAAGATATTATAAAGG - Intergenic
970332252 4:14999270-14999292 GAGGAAAGAGGTCATGATGAAGG + Intergenic
971445340 4:26740613-26740635 GGAAAAAAAAGATATGATAAAGG - Intronic
971735547 4:30444788-30444810 GAAAATGCAGGTTATGTTAATGG + Intergenic
972768335 4:42172330-42172352 GAAAAGAGATGTGATCATAAGGG - Intergenic
972862474 4:43187384-43187406 GAAAATAGAGATATTGATAAAGG + Intergenic
973184322 4:47306542-47306564 GAAAAAAGAGGATGGGATGAAGG - Intronic
973716220 4:53679262-53679284 AAAAAAAGAATTTATGATGATGG + Intronic
974236068 4:59182981-59183003 GAAAAAAGAAGTAAGGATGAAGG + Intergenic
974279635 4:59775760-59775782 GAACATAGTGGTTATGAAAATGG - Intergenic
974389406 4:61246040-61246062 GAAAAGAAAAGTGATGATAAGGG - Intronic
974631080 4:64489906-64489928 GAAAAAAGAGGCATTTATAAGGG - Intergenic
974865328 4:67573185-67573207 GAAAGAAGAGATTAGGACAATGG + Intronic
975312315 4:72916303-72916325 AAATAAAGAGGATATGATACCGG + Intergenic
975822822 4:78289235-78289257 GAGAAAAGAGAAAATGATAAGGG - Intronic
976235258 4:82890364-82890386 GAAAAAATAAGTTAGGAGAAAGG + Intronic
976310559 4:83607653-83607675 AAAAAAAATGGTTAAGATAATGG + Intergenic
977955051 4:103017137-103017159 GAATATAGAGGTGATGAAAAAGG - Intronic
978014539 4:103726327-103726349 GATAAAAGTGGTAATTATAAGGG - Intergenic
978093676 4:104748852-104748874 GAAAAAATTGATTATAATAAAGG + Intergenic
978130165 4:105186334-105186356 GAAGACAGAGGTTAAGATAAGGG - Intronic
978563691 4:110059984-110060006 CCAAAAAGAGGTCATGAAAAAGG + Intronic
978795856 4:112706360-112706382 GAGAAAAGAGGTTTAGAGAATGG - Intergenic
979751375 4:124283557-124283579 AAAAATATAGGTTATGTTAATGG - Intergenic
979774919 4:124578289-124578311 GAAAAAAAATCTTATGCTAATGG - Intergenic
980620295 4:135292744-135292766 GAAAAAAGAAGTTAAATTAAAGG - Intergenic
982250191 4:153398197-153398219 GATAAAAGAGTGTATTATAAAGG + Intronic
982420653 4:155193024-155193046 GAGTAAAGATGTTATGAGAAGGG + Intergenic
982503551 4:156190404-156190426 GAAAAAAGGGTTTTTGAAAAGGG + Intergenic
982541040 4:156671828-156671850 GAACAAAGAGCTTATGGAAATGG - Intergenic
982610709 4:157571166-157571188 GAAAAAAGAGGATATGAAAAAGG - Intergenic
982853431 4:160348871-160348893 GGAAGAAGAGGATGTGATAAAGG + Intergenic
982876427 4:160656978-160657000 GAAAAAAGGGGTTAGGAGACAGG - Intergenic
983024558 4:162717435-162717457 GAAAAAAGAGATAAAGATGAAGG - Intergenic
983121952 4:163897358-163897380 GAAGAAAGTGATTATAATAATGG - Intronic
983223621 4:165066104-165066126 CAAAAAAGAGGTCATGAGATGGG - Intergenic
983987273 4:174074391-174074413 GAAAGAAGAGATCATGACAATGG + Intergenic
984140948 4:176002845-176002867 GAAGAAAGAGGAGATGACAAAGG - Intergenic
984151919 4:176143806-176143828 GAGAGAGGAGGTGATGATAAAGG - Intronic
984182913 4:176507410-176507432 TAAAAAAGAGGTTTGGAGAAGGG - Intergenic
984532702 4:180936320-180936342 GAAAAAAGAGAATATTAAAATGG + Intergenic
984603988 4:181762713-181762735 TAAATAAGAAGTTTTGATAATGG - Intergenic
984964906 4:185131159-185131181 GAAAGGAATGGTTATGATAAGGG + Intergenic
985143941 4:186873767-186873789 TAAAAAAGATGTTAAGATACAGG - Intergenic
985182382 4:187279492-187279514 GAAAAAAGAGGATATGATATAGG + Intergenic
986163627 5:5253042-5253064 GAAAGAAGAGTTTAAGATTATGG - Intronic
986962868 5:13236929-13236951 GAAAGAAGATGATGTGATAATGG - Intergenic
987150323 5:15032809-15032831 GAAAAAAGAGTTAAAGACAAAGG - Intergenic
988121084 5:26963393-26963415 GAAAATAGAGTTAATTATAAAGG + Intronic
988276647 5:29089619-29089641 GAAGAAGGAGGTAATGACAATGG - Intergenic
988276782 5:29090878-29090900 AAAAAAAGACTTTATGAAAATGG - Intergenic
988355886 5:30173745-30173767 AAAAAAAGAGGATATTTTAAAGG + Intergenic
988394793 5:30683168-30683190 GAATATAGAGCATATGATAAGGG + Intergenic
988721661 5:33885209-33885231 GAAACAATAGGATATAATAAAGG + Intronic
989096157 5:37783441-37783463 GAAAAAAAAAGTTATAAAAAAGG - Intergenic
989334809 5:40303407-40303429 GAAAGCAGAGCTTATGACAAGGG + Intergenic
989560634 5:42846261-42846283 GAAAGAATATGTAATGATAATGG - Intronic
989720961 5:44527401-44527423 AAAAAAAGAGCTTAAGATATAGG - Intergenic
989751399 5:44898624-44898646 GCAAAAATAGGTTATGGCAATGG - Intergenic
990061486 5:51655170-51655192 AAGAAAAGAGGTAATGTTAAAGG - Intergenic
990240929 5:53816019-53816041 GAAAAAGGAGGGTAAGAAAATGG + Intergenic
990282372 5:54264841-54264863 GAAAAAATAGCACATGATAAAGG - Intronic
990346517 5:54876876-54876898 GTAATTAGAGATTATGATAAGGG - Intergenic
990667892 5:58094338-58094360 AAAAAAAGAGGACATGAGAAAGG - Intergenic
991278808 5:64885531-64885553 GAAAAAAGAAGTGAAGGTAAGGG + Exonic
991291723 5:65039550-65039572 GAAGAATGAGATTATAATAAAGG + Intergenic
991312679 5:65261965-65261987 GGAGAATGATGTTATGATAACGG - Intronic
991319520 5:65355214-65355236 GTTAAAAGATGTGATGATAATGG + Intronic
993121641 5:83782069-83782091 GAAAACAAAAGTTATGATACAGG - Intergenic
993822631 5:92638332-92638354 GAAAAAATACGTTATTTTAAGGG - Intergenic
994193558 5:96896686-96896708 GAAAAAAGAGATAAAGAAAATGG - Intronic
994352264 5:98759817-98759839 GGAAAAATAGGACATGATAATGG - Intergenic
994552220 5:101250527-101250549 GAAAAAATAGTTTATCAGAATGG + Intergenic
994851668 5:105062462-105062484 GAAAAGAGAGATAATGAGAAAGG + Intergenic
995296345 5:110528403-110528425 GAAAAAAGAGTTTCTGAGAAGGG + Intronic
995360506 5:111291225-111291247 GAAAATACAGGATATCATAAAGG - Intronic
995565470 5:113429581-113429603 GAGAAAAGAGGTTGAGAAAAAGG - Intronic
996263292 5:121501164-121501186 GAAAGAAGAGATGATTATAAGGG + Intergenic
997155756 5:131554906-131554928 GAAAAAAGAACTTAAAATAAAGG + Intronic
998165629 5:139841456-139841478 GAAAAATGCTGTTATGAAAATGG + Intronic
998603634 5:143610909-143610931 GAAAAATGAAATTATGAGAAAGG + Intergenic
999091338 5:148938854-148938876 TAAAAAAGCGGGTATGAAAATGG - Intronic
999115338 5:149157976-149157998 TAAATAAGAGGTCATTATAAGGG - Intronic
999782559 5:154861677-154861699 CAAAAAAGAGCTTATCATAAAGG - Intronic
1000682479 5:164202958-164202980 GAAAACAGATGTCATGCTAAGGG + Intergenic
1001059757 5:168478352-168478374 AAAAAAAGAGGTCATGAGGATGG - Intergenic
1002082232 5:176743944-176743966 AAAAAAAAAGATTATGAAAATGG - Intergenic
1003068711 6:2926726-2926748 TTAAGAAGAGGTTATGATATGGG - Intergenic
1003301443 6:4886617-4886639 GAAAAAAATTGTTTTGATAAGGG - Intronic
1004533745 6:16479105-16479127 GAAATAAAAGATTATGATAGAGG + Intronic
1004770987 6:18781269-18781291 GAGAAAAGATGTTCTGACAAAGG + Intergenic
1005466164 6:26116369-26116391 GAAAAAATATGTAATAATAATGG - Intronic
1005576576 6:27195305-27195327 GAATACAGAGGTGATTATAATGG - Intergenic
1005602073 6:27436870-27436892 GAAAAAGGAGGACATGAAAAAGG + Intergenic
1005789332 6:29280862-29280884 GAAAAAAAAGGCTAATATAATGG + Intergenic
1006302797 6:33202685-33202707 GAAAAAAGAGGCTTAGGTAAGGG + Exonic
1007539179 6:42625258-42625280 GAAAAAACATGTTATTAGAAGGG - Intronic
1008162888 6:48100406-48100428 GAAAAGAGAGGTTCTGTTAATGG - Intergenic
1008307107 6:49916926-49916948 GAAAAAGGAGGTTCAGAGAAAGG - Intergenic
1008356157 6:50555890-50555912 GAGAAAAAAGGTTAGGAAAAGGG + Intergenic
1008527673 6:52422699-52422721 CAAATTAGAGGTTATGTTAATGG - Intronic
1008698993 6:54076244-54076266 GTTAATAGAGATTATGATAAAGG - Intronic
1009595453 6:65729578-65729600 GAAAAATGAGGTAAACATAATGG + Intergenic
1010089339 6:71961484-71961506 GAGAAAAGAGGGTATAATGAAGG - Intronic
1010458666 6:76087800-76087822 GACAAAATAGGTTATGGGAAGGG - Intergenic
1010634011 6:78234244-78234266 AAAAAATGAGAATATGATAAAGG - Intergenic
1010915622 6:81614368-81614390 GCAAAAAGAAAGTATGATAATGG + Intronic
1011207932 6:84921600-84921622 GAAAAAAGCAGTTAAGATAGGGG - Intergenic
1011339582 6:86299093-86299115 GAAACAAGAATTTATCATAAAGG - Intergenic
1013324859 6:109035051-109035073 GAAAGAAGAGATAATGTTAAGGG + Intronic
1014249038 6:119097216-119097238 GAAAAAACATGTTTTGAAAAAGG - Intronic
1014410191 6:121106352-121106374 GAAAGAAGAAATTTTGATAAAGG + Intronic
1016110130 6:140212844-140212866 TAAAAAAGATGTTATGACAGTGG - Intergenic
1018518058 6:164609939-164609961 GAAAAAAGAGAATAAAATAAAGG - Intergenic
1018815820 6:167330150-167330172 GAAAACAGATGTTATAAAAATGG + Intronic
1018973619 6:168546672-168546694 GAAAACAGAGGATGTGTTAAGGG + Intronic
1019654407 7:2182328-2182350 GAAAAAAGACATCATAATAAGGG + Intronic
1020471529 7:8541302-8541324 GAGAAAAGAGGATATGAAAGAGG + Intronic
1020634400 7:10678930-10678952 GAAAAATGTGGTTTTGGTAATGG - Intergenic
1021019805 7:15583289-15583311 AAAAAATGAGGTTATAATAAAGG - Intergenic
1021185344 7:17557621-17557643 AAAAAAAGATGTTAGGATAAAGG - Intergenic
1021573786 7:22089989-22090011 TATACAAGAGGTTGTGATAAAGG + Intergenic
1021579771 7:22140475-22140497 GAAAAAACATGTTTTGATGAAGG - Intronic
1021905118 7:25325873-25325895 GAGAACAAAGGTTATGAGAAAGG - Intergenic
1022270348 7:28801066-28801088 GCAAAAATAGGTAATAATAATGG - Intronic
1022351375 7:29568752-29568774 GAAAAAAGAATTCATGATAAGGG + Intergenic
1023153617 7:37225767-37225789 TAAAATAGAGGTTAGAATAATGG + Intronic
1023368221 7:39486405-39486427 GAATAAAGAGGCTATGGTGATGG + Intronic
1023645238 7:42305588-42305610 AAACAAAGAATTTATGATAAAGG - Intergenic
1024433796 7:49324378-49324400 GATAAAACAGGTTGTGGTAAAGG - Intergenic
1024717107 7:52092289-52092311 GAAAAATGAGGATAAGATGAGGG + Intergenic
1024724374 7:52176018-52176040 GGAAAAAGAGATTGTGGTAAAGG - Intergenic
1025620500 7:63165898-63165920 AATAAAAGTGTTTATGATAATGG + Intergenic
1026047508 7:66917304-66917326 GAAAAAAAAAATTATGATGATGG - Intergenic
1026188220 7:68100726-68100748 GATAAAAGTATTTATGATAATGG + Intergenic
1026305278 7:69134926-69134948 GAAGAAAGAGGTAGAGATAAGGG - Intergenic
1026732386 7:72923412-72923434 AAAAAAAAAAGTTATGATAAAGG - Intronic
1027111591 7:75443952-75443974 AAAAAAAAAAGTTGTGATAAAGG + Intronic
1027283822 7:76628486-76628508 AAAAAAAAAAGTTGTGATAAAGG + Intergenic
1027648027 7:80829167-80829189 AAAAAAAAAAGTTATGTTAATGG + Intronic
1027764851 7:82326708-82326730 GAAACAAGAAGTTGTGGTAAGGG - Intronic
1028076561 7:86524038-86524060 AAAATCAGAGGTTAAGATAAAGG + Intergenic
1028812704 7:95106117-95106139 AAAAAAAGAGAGTATGATATGGG + Intronic
1028916380 7:96263840-96263862 GAAAAAGGAGTTTTTGGTAATGG - Intronic
1030435888 7:109519988-109520010 AAAAGAAGATGTTATAATAAAGG - Intergenic
1030898757 7:115095377-115095399 GAAGAAAGAGATAATGAGAATGG + Intergenic
1031349995 7:120719396-120719418 CTAATAAGGGGTTATGATAATGG - Intronic
1031802157 7:126260395-126260417 GAAAGAACAGGATATGCTAATGG - Intergenic
1032012452 7:128355804-128355826 GAATAAAGAGGGTGTGGTAAGGG - Intronic
1032884695 7:136124845-136124867 GAAAAACAAGGATCTGATAAAGG + Intergenic
1033375332 7:140755976-140755998 GATAAAAGAGGGGAAGATAAAGG + Intronic
1033709733 7:143930034-143930056 GAAAAAAGATGGTAGGAAAATGG - Intergenic
1033920210 7:146381708-146381730 GAAAGAAGAGCTAAAGATAAGGG + Intronic
1035980054 8:4360452-4360474 GAAAAAAGAGGTTATGATAACGG - Intronic
1036964753 8:13284224-13284246 GAAAAAAATAGTTAAGATAACGG + Intronic
1037394246 8:18425243-18425265 AAAAAAAAAGGGTAAGATAAAGG + Intergenic
1037473025 8:19229244-19229266 GAAAAAAAAGGTTAAAACAAAGG + Intergenic
1038112903 8:24519372-24519394 GAAAATACAGGTTATAAAAAAGG + Intronic
1038128485 8:24701428-24701450 GAAAAAAGAAGATATGATTGTGG + Intergenic
1039067152 8:33618631-33618653 AAAAAAAAAGTTTATGATAGTGG + Intergenic
1039480586 8:37870419-37870441 GAACAATGAGGTCATGATGAAGG - Exonic
1040582111 8:48706498-48706520 GAAAATAGAGTTCATGATAAAGG - Intergenic
1040934625 8:52769534-52769556 GAATTAAGAGGTTAGGATAGAGG - Intergenic
1041054003 8:53964090-53964112 GAAAAAACAGCTTATAATCATGG - Intergenic
1041504962 8:58586320-58586342 GATAAAAGAGGTTTTGCCAATGG - Intronic
1042468388 8:69154843-69154865 GAAAGAAGAGATGAAGATAAAGG + Intergenic
1043080272 8:75757078-75757100 TGAAAAAGAGGTAATGGTAAAGG - Intergenic
1043592073 8:81843966-81843988 GAAAAAAGAGGGGTTGAAAATGG - Intergenic
1043830791 8:84986096-84986118 GAAAAAAAATGTTGTTATAAAGG + Intergenic
1044078944 8:87860103-87860125 GAAAAAAGAGGTAATATGAAAGG + Intergenic
1044539377 8:93392505-93392527 GAAAACAGGGGTGATGGTAATGG - Intergenic
1044602137 8:94015951-94015973 TAAAAATGAGATTATGTTAACGG + Intergenic
1044935467 8:97289647-97289669 GAAAGAAGGGGTTGTGATGATGG - Intergenic
1045177175 8:99738270-99738292 CAAAAAAGGTGTCATGATAAAGG - Intronic
1045178971 8:99759406-99759428 GTTAAAAGAGGATATGAAAATGG - Intronic
1045306298 8:100959464-100959486 GAATAAAGAGCTGCTGATAAGGG - Intergenic
1046149703 8:110207488-110207510 GAACAAAGATTTTATGACAAAGG + Intergenic
1046453445 8:114424329-114424351 GAAAGAAAAGCTTAAGATAAGGG - Intergenic
1046555922 8:115773255-115773277 TTAAAAAGAGCTTATGATAATGG - Intronic
1048047307 8:130785058-130785080 GAAAAAAGAGGCTAGTATTAGGG + Intronic
1050140972 9:2515308-2515330 GAAGAAAGATTTTATGGTAAGGG - Intergenic
1050757612 9:9026827-9026849 GAGAAAAGAGGTTTGGAGAATGG - Intronic
1052036938 9:23693435-23693457 GAGTAAAGAGGTAATGATAGAGG - Exonic
1052384094 9:27804990-27805012 AAAAAAAGGAGTTTTGATAAAGG + Intergenic
1052558603 9:30052894-30052916 GAAAAGAGAGGTTTAGGTAAAGG + Intergenic
1055576044 9:77661119-77661141 GACAAAACAGATTATGAGAAGGG + Intergenic
1055726955 9:79240716-79240738 GAATAAGGAGGTTATGAATAAGG + Intergenic
1055758429 9:79580568-79580590 GAAAAAAAAAGTTATCATAAGGG - Intronic
1055816398 9:80212413-80212435 CAAAAAAGAGGTCATTATGATGG + Intergenic
1056473900 9:86933840-86933862 TAAATAGGAGGGTATGATAATGG - Intergenic
1056649285 9:88444212-88444234 GGAACAAGAGGCTATGAAAAGGG - Intronic
1057401179 9:94724950-94724972 GAAAAAAGAGCTCAGGAAAAGGG + Intergenic
1057411750 9:94822583-94822605 GAAAATAGAAGTTATAAAAACGG - Intronic
1057614114 9:96572879-96572901 TTAAAAAGAGGTAATGATAGTGG - Intronic
1058574683 9:106387869-106387891 GAAATAACAGGATACGATAATGG - Intergenic
1059983524 9:119799027-119799049 GGAAAATGAGGCCATGATAAGGG + Intergenic
1060326805 9:122624437-122624459 GAGAAAAGTTGTTATGATTATGG - Intergenic
1062660834 9:137631885-137631907 GAAAAAAAAGATTATAATAGAGG + Intronic
1062692471 9:137849842-137849864 GAAGAAAGATTTTATGGTAAGGG - Intronic
1203655798 Un_KI270752v1:23382-23404 AAAAAAAGAGGTTATGTTTATGG - Intergenic
1186006332 X:5076596-5076618 TATCAAAGAGGTTATGAGAAGGG - Intergenic
1186874637 X:13804740-13804762 GGAAAAAGAGGTTTTGATACAGG - Intronic
1187113746 X:16328179-16328201 GAAACAAAAGGATATGAAAATGG - Intergenic
1188108766 X:26172869-26172891 TAAAAAATAGATTATGACAAAGG + Intergenic
1188345705 X:29062788-29062810 GAAAAAAGAAGCTAGGATCAAGG - Intronic
1188614625 X:32142367-32142389 AAAAAGAGAGGTTTTGACAAAGG + Intronic
1188667757 X:32845474-32845496 AATAAAACAGGTTATCATAATGG - Intronic
1189037073 X:37504814-37504836 GGAAAAAGAGGATATAATACAGG + Intronic
1189823791 X:44896610-44896632 AAAAAAAAAGGAAATGATAATGG - Intronic
1190195183 X:48311486-48311508 GAAAAAACAGGGTATGATCTGGG - Intergenic
1190241676 X:48661429-48661451 GAAAACAGAGGTTATCAGATTGG - Intergenic
1190661625 X:52659705-52659727 GAAAAAACAGGTTATGACCTGGG - Intronic
1190830815 X:54057651-54057673 AAAAAAATAATTTATGATAAAGG + Intergenic
1193551565 X:82899510-82899532 GAAAACAGAAGCTAAGATAAAGG + Intergenic
1194051041 X:89069514-89069536 GGTAAAACAGGTTATGAAAAGGG - Intergenic
1194691327 X:96989554-96989576 CATAAATGAGGTTATTATAATGG - Intronic
1194784798 X:98069536-98069558 GGAAAAATAGATTAGGATAAAGG + Intergenic
1195277875 X:103299824-103299846 GAAAAGAAATGTTATGGTAAAGG + Intergenic
1195768350 X:108320452-108320474 GAAAGAAGTGATTATGATTATGG + Intronic
1196017553 X:110955904-110955926 CAAAAAAGAGGGTAGGGTAAAGG + Intronic
1196551924 X:117038698-117038720 GAAAAAAGAAGTCATACTAATGG - Intergenic
1196642124 X:118074275-118074297 GAAAAAACTGGTTCTCATAAGGG + Intronic
1196737365 X:118991570-118991592 AAAGAAAGAGGCTATGATTATGG + Intronic
1197105607 X:122710772-122710794 GAAACAAGAGGACATGCTAAAGG + Intergenic
1197893282 X:131286466-131286488 GAAAAGAGAGATTATGGTAAAGG + Intronic
1197965878 X:132061287-132061309 GAAAAAAGTGGTTCTTACAATGG - Intergenic
1198812862 X:140553478-140553500 GTAAACAGAGGTTATGAAGAGGG - Intergenic
1199072400 X:143493551-143493573 TAAAAAACAGGCAATGATAAAGG - Intergenic
1199378579 X:147141982-147142004 AAAAAAAGAGATTAGGAAAAAGG - Intergenic
1201406198 Y:13652642-13652664 GAAGAAATGGGTTATGAAAATGG - Intergenic
1201958578 Y:19652345-19652367 GAAAAAAGACTTTATAATAGTGG - Intergenic