ID: 1035980055

View in Genome Browser
Species Human (GRCh38)
Location 8:4360464-4360486
Sequence AAGTATGTGCAAGAAAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 3, 3: 42, 4: 492}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035980055_1035980058 5 Left 1035980055 8:4360464-4360486 CCTCTTTTTTCTTGCACATACTT 0: 1
1: 0
2: 3
3: 42
4: 492
Right 1035980058 8:4360492-4360514 TCCTCCCAGGTTCTTTGAGATGG No data
1035980055_1035980062 12 Left 1035980055 8:4360464-4360486 CCTCTTTTTTCTTGCACATACTT 0: 1
1: 0
2: 3
3: 42
4: 492
Right 1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG No data
1035980055_1035980064 30 Left 1035980055 8:4360464-4360486 CCTCTTTTTTCTTGCACATACTT 0: 1
1: 0
2: 3
3: 42
4: 492
Right 1035980064 8:4360517-4360539 TCTGGCTCTGTCGCCCAGGCTGG 0: 1687
1: 49225
2: 143194
3: 197819
4: 176370
1035980055_1035980063 26 Left 1035980055 8:4360464-4360486 CCTCTTTTTTCTTGCACATACTT 0: 1
1: 0
2: 3
3: 42
4: 492
Right 1035980063 8:4360513-4360535 GGAGTCTGGCTCTGTCGCCCAGG 0: 964
1: 32869
2: 86251
3: 131983
4: 146364
1035980055_1035980056 -8 Left 1035980055 8:4360464-4360486 CCTCTTTTTTCTTGCACATACTT 0: 1
1: 0
2: 3
3: 42
4: 492
Right 1035980056 8:4360479-4360501 ACATACTTCCTGTTCCTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035980055 Original CRISPR AAGTATGTGCAAGAAAAAAG AGG (reversed) Intronic
901592942 1:10361142-10361164 AAGGATGTGGAGGAAGAAAGAGG - Intronic
903017185 1:20368836-20368858 AAATATTTGAAAGAAGAAAGAGG + Intergenic
903609572 1:24600546-24600568 AAATATGTGCAAAAAAGAGGGGG - Intronic
904323326 1:29710717-29710739 TAGTATGGGCAAGAAGAGAGAGG - Intergenic
905710788 1:40100920-40100942 AAGCATTGCCAAGAAAAAAGAGG + Intergenic
906159936 1:43640619-43640641 AGGTATGTGCAATAAAATAATGG - Intergenic
909471452 1:76033411-76033433 AAATATAAGCAAGAAATAAGAGG + Intergenic
911404061 1:97413828-97413850 AAATATGTTGAAAAAAAAAGAGG - Intronic
911835164 1:102609698-102609720 AGGTATGAGAAAGAAAAAATAGG - Intergenic
913332358 1:117678086-117678108 AAGGATGTGAAGGAAGAAAGAGG + Intergenic
914390877 1:147222067-147222089 AAGTCTGTGTAAGAAAAGAGAGG + Intronic
915125647 1:153661754-153661776 AAGCCAGTGCAATAAAAAAGTGG - Exonic
915167354 1:153955713-153955735 AATTATCTGCCAGAAAAAAAAGG + Intronic
915776483 1:158493489-158493511 TATTATGTCCCAGAAAAAAGAGG - Intergenic
916017982 1:160767154-160767176 AAGGATGTGTAATTAAAAAGGGG + Intergenic
916307087 1:163348952-163348974 AATAAAGTTCAAGAAAAAAGAGG + Exonic
916464609 1:165061694-165061716 AGGAATGTTCAAGAAACAAGAGG + Intergenic
916764923 1:167850971-167850993 AATTATGTGAAAGAAATAAAAGG + Intronic
917095588 1:171396009-171396031 AATTATGTAGAAGAAAAAATTGG + Intergenic
918618452 1:186575254-186575276 AAGAATGGGGAATAAAAAAGAGG + Intergenic
918748000 1:188230922-188230944 AAGTGTGGGAAAGAAAGAAGTGG + Intergenic
919008857 1:191933554-191933576 AGGTATGTACATAAAAAAAGAGG + Intergenic
919197040 1:194299274-194299296 AAGTATATGCAGGAAAATAAAGG - Intergenic
919266783 1:195278479-195278501 AAGGATGAGGAAGGAAAAAGAGG - Intergenic
919359693 1:196576853-196576875 AAGTATAGGCAAGATAGAAGAGG - Intronic
921521730 1:216164410-216164432 AAGTATTTACAATAAAGAAGTGG + Intronic
922138872 1:222860903-222860925 AAGTGATTGCTAGAAAAAAGTGG + Intergenic
923170680 1:231414251-231414273 AAGAATGTGCTAGAATAAAAGGG + Intronic
924016958 1:239737596-239737618 ACAAATGTGCAAGAAGAAAGTGG - Intronic
924396285 1:243624872-243624894 AAGTATGTTCAAGAACACAGAGG - Intronic
924441681 1:244090982-244091004 AAGCATCTCCAAGAAAAAAATGG + Intergenic
924674764 1:246164653-246164675 CAGTATGAGCAAAAAACAAGTGG - Intronic
1063010508 10:2017803-2017825 AATTATGACCAAGAAAACAGCGG + Intergenic
1063813824 10:9747092-9747114 AACTATGTGCTAAAAAAAGGAGG + Intergenic
1063830361 10:9945550-9945572 AATTATGAGGAAGAAGAAAGAGG - Intergenic
1063870145 10:10408650-10408672 AATTATGTAGAAGAAAAAAGTGG + Intergenic
1064706705 10:18079940-18079962 AAGTATGTGCATGATACAAAAGG + Intergenic
1065666221 10:28064335-28064357 AAGTCTGGCAAAGAAAAAAGTGG + Intronic
1065942622 10:30578623-30578645 AATTATGTTCAAGTTAAAAGGGG - Intergenic
1067517776 10:46968226-46968248 AAGGATGTACCAGAAAACAGAGG - Intronic
1067644472 10:48083603-48083625 AAGGATGTACCAGAAAACAGAGG + Intergenic
1068109133 10:52658172-52658194 AAGTGTGTGCCAGAAAAAAATGG - Intergenic
1068191900 10:53663327-53663349 TGGTATGTGCAAGAGAAGAGTGG - Intergenic
1068248605 10:54406801-54406823 AAGTATTTAGAAGAAAACAGGGG + Intronic
1068837898 10:61575527-61575549 AAATTGGTGCAAGAAAAAATAGG + Intergenic
1069167050 10:65174212-65174234 AAATATGGGCAAGAAAGATGAGG - Intergenic
1069374078 10:67776180-67776202 TAATATGTGCTAGAAATAAGTGG - Intergenic
1069729949 10:70603999-70604021 AAGTATCTGCGGGAAAAGAGAGG + Intergenic
1070303219 10:75220465-75220487 AAGTTAGTGCAACAACAAAGAGG - Intronic
1070481463 10:76887143-76887165 AAATATGTGTAAAAAAAAAGGGG + Exonic
1070602313 10:77874312-77874334 AAGTATGTGGAAGCACAGAGAGG - Intronic
1071006865 10:80893569-80893591 AAGTATGTATAAGAAAATGGTGG + Intergenic
1072380223 10:94860225-94860247 TCGTATGTTCAAGAAAACAGAGG + Intergenic
1072504877 10:96055798-96055820 TAGTCTGTTAAAGAAAAAAGGGG - Intronic
1074521830 10:114232711-114232733 CAGTATGTACAAGAAAAAAAAGG - Intergenic
1074782803 10:116814048-116814070 AGGAATGTTCAAGAAAACAGAGG + Intergenic
1074825750 10:117214822-117214844 AAGTTGGGGCAAGAAACAAGGGG - Intergenic
1075273397 10:121072600-121072622 TATTAAGTGGAAGAAAAAAGAGG + Intergenic
1076264916 10:129102135-129102157 AACTTTTTGCAAGAAACAAGTGG + Intergenic
1076453208 10:130571209-130571231 AAATATGTGGTAGAAAAATGAGG + Intergenic
1078509425 11:11974508-11974530 AAGAAAGGGCAAGAGAAAAGGGG + Intronic
1079408364 11:20164113-20164135 AAGGATTTTCAAGGAAAAAGAGG - Intergenic
1080121513 11:28683393-28683415 AAGAATGTGGAATAAAAAAATGG - Intergenic
1080141904 11:28931744-28931766 AAGTTTGTTCAAGAAAAAGAGGG - Intergenic
1080290716 11:30668069-30668091 AATAATGTGCAGGAATAAAGAGG - Intergenic
1080635468 11:34119707-34119729 ATTTATGTGCATGAAAAAAGAGG - Intronic
1080717360 11:34817315-34817337 TGGAATGTGCAAGAAAAAACAGG - Intergenic
1081109562 11:39118146-39118168 AAGGATGGGCAAGGAAAAAGGGG - Intergenic
1081498532 11:43641248-43641270 GAGAAAGTGCAAAAAAAAAGGGG - Intronic
1081920975 11:46776072-46776094 AAGCATGTGAAAGGAAAAAATGG + Intronic
1082173546 11:49035231-49035253 AAGTAGATGCAAAAAAAAAGTGG - Intronic
1082199176 11:49342416-49342438 ATGTATATTCAAGAAAAAACAGG - Intergenic
1083087744 11:60168132-60168154 GAGTCTGTGCCATAAAAAAGGGG - Intergenic
1084376052 11:68778366-68778388 AAGACTTTGCAAGAAAAAACTGG + Intronic
1084526733 11:69702834-69702856 AAGAATGGGAAAGAAAAAAGAGG - Intronic
1085031049 11:73271099-73271121 AAGTACCTGTAAGAAAGAAGAGG + Intronic
1086120426 11:83299868-83299890 AAGTTTGTGCAACCAAAATGCGG - Intergenic
1086576475 11:88344212-88344234 ATGCCTGTGAAAGAAAAAAGAGG + Intergenic
1087524471 11:99292400-99292422 ACTTATGTGTAAGAAAATAGAGG + Intronic
1087563091 11:99816272-99816294 AAGTATGTGAAATAAGAAATAGG - Intronic
1087570759 11:99924685-99924707 AAATAGGTGAAAGTAAAAAGAGG - Intronic
1087796329 11:102458201-102458223 AAGAAAGTGCAAGAAAAATTGGG - Intronic
1088704034 11:112445093-112445115 AAGTCTGAGAAAGAAAGAAGAGG - Intergenic
1090989273 11:131801618-131801640 AAAAATGTGCAAGAAAAAAAGGG - Intronic
1091538967 12:1441507-1441529 AAGTATGACCACGAAGAAAGGGG - Intronic
1092022135 12:5211451-5211473 AGGTATGTACAAGAAAAGGGAGG - Intergenic
1092323347 12:7502561-7502583 AAGTCTGTGAAAAAGAAAAGAGG + Exonic
1092444251 12:8538935-8538957 AAGTAGGTGAATGAAAAAAAAGG + Intronic
1093153828 12:15656151-15656173 AAGTGTGTGAAATAAATAAGAGG + Intronic
1093373467 12:18393094-18393116 AAATATATTCAAGCAAAAAGAGG + Intronic
1093625591 12:21343436-21343458 AAGGTCCTGCAAGAAAAAAGGGG - Intronic
1093959887 12:25260641-25260663 TGGTATGTTCAAGGAAAAAGAGG - Intergenic
1094372635 12:29754522-29754544 AGGTAGATGCAAGAAGAAAGTGG + Intronic
1094676256 12:32622953-32622975 AATTATGTGGAATCAAAAAGTGG + Intronic
1095408288 12:41892156-41892178 GAGTATGATCAAGAAAAAAAGGG + Intergenic
1095592217 12:43916022-43916044 ATGGTTGGGCAAGAAAAAAGTGG + Intronic
1096728599 12:53586732-53586754 AAGTAAATGCAAAGAAAAAGTGG - Intronic
1096745017 12:53721153-53721175 AAGTCAGTGCAAGATAAGAGAGG - Intronic
1097390057 12:58999511-58999533 AAGTAAGTGAAAGCAAAAACTGG + Intergenic
1097478265 12:60086557-60086579 AAGTATGTACTTGAAAACAGAGG + Intergenic
1098843273 12:75503431-75503453 AATGATGTGCAAGAACAAAATGG + Exonic
1099453771 12:82839635-82839657 TAATTTGTGCAAGAAAAAATAGG + Intronic
1099851308 12:88100760-88100782 AAGTATGCTTAAGAAAAAAAAGG + Intronic
1099966306 12:89449502-89449524 AAATAAATGAAAGAAAAAAGGGG + Intronic
1099998075 12:89801455-89801477 ACATTTGTGGAAGAAAAAAGGGG - Intergenic
1100812033 12:98348373-98348395 AAGTATGTTTAAGAAAAATCTGG - Intergenic
1102249073 12:111373751-111373773 AAGTATTTAAAAAAAAAAAGAGG - Intergenic
1102754702 12:115328048-115328070 GAGTATGTGGAAGAAAATTGAGG - Intergenic
1103017344 12:117505766-117505788 AAGAAGGTGGCAGAAAAAAGAGG - Intronic
1103253642 12:119522168-119522190 AAGCATTTGGAAGAAAGAAGGGG + Intronic
1103429479 12:120870594-120870616 AAGAATGGGTAAGAAAAATGTGG + Intronic
1103444300 12:120984031-120984053 CAGTAGGTTCTAGAAAAAAGTGG + Intronic
1104190850 12:126480575-126480597 AAGCATTTCCAAGGAAAAAGAGG - Intergenic
1104323063 12:127770422-127770444 AACTCTGTGAAAGAGAAAAGAGG - Intergenic
1104799192 12:131541903-131541925 AAGTGTGTGCAAGGGAAAAAAGG + Intergenic
1105578334 13:21673046-21673068 ACGTGTGTGCAAGCATAAAGTGG - Intronic
1106738857 13:32617498-32617520 TTATATGTGCAAGAAACAAGTGG - Intronic
1106820634 13:33460549-33460571 AAATATGTACAAGACAAAGGAGG - Intergenic
1106979985 13:35268124-35268146 AAGAATGAGTAAGAAAAATGTGG + Intronic
1106991986 13:35430468-35430490 AAGTAAGTGCAACAAAAAGAAGG - Intronic
1107154025 13:37145707-37145729 AAATCTGTGAAAGAAAAATGTGG + Intergenic
1107215911 13:37918506-37918528 ATATATGTCCAAAAAAAAAGAGG - Intergenic
1107534874 13:41319236-41319258 AATTATGTTTAAGAAAAAAATGG - Intronic
1107602294 13:42025881-42025903 AAGAAAGTGCAAGCAGAAAGAGG - Intergenic
1107611674 13:42119865-42119887 GAGAATGTGCAAAAAATAAGAGG - Intronic
1107627260 13:42301938-42301960 AAGTATGTGAATGAGGAAAGGGG - Exonic
1108493397 13:51002524-51002546 AAGCATGAGCATGAAATAAGGGG - Intergenic
1108937908 13:55908657-55908679 AAATAATTGAAAGAAAAAAGAGG + Intergenic
1109088876 13:58012942-58012964 GAGAATGTTCAAGAAAAGAGAGG - Intergenic
1109760711 13:66825112-66825134 AAGAATGTAAAAGAGAAAAGTGG + Intronic
1109929062 13:69188480-69188502 ATGTATGTGCAAAGAGAAAGAGG + Intergenic
1110288450 13:73777218-73777240 ACGTATGTGCAAAAAGGAAGAGG + Intronic
1111229679 13:85328035-85328057 AAGTATTTGCAAGAATGTAGAGG - Intergenic
1111265764 13:85810685-85810707 AATTATATTCATGAAAAAAGTGG - Intergenic
1111619752 13:90709152-90709174 AACTATGTGTAAGAATAAATAGG + Intergenic
1112307511 13:98288422-98288444 AAGTCTGTTCAAGAAGCAAGAGG - Intronic
1112649745 13:101382157-101382179 AATTATGAGCAATTAAAAAGAGG - Intronic
1112843974 13:103614828-103614850 AAGTATGTGCAGAACAAAAAAGG + Intergenic
1113043754 13:106131721-106131743 AAGTATGTGCAAGATAATCTAGG - Intergenic
1113166072 13:107444011-107444033 AGGTATATGCAAGAAAAACTGGG - Intronic
1114743937 14:25126322-25126344 AATTATGTGCAATGAAATAGAGG + Intergenic
1114812200 14:25913933-25913955 AAGTATTTGCAGGATCAAAGGGG - Intergenic
1115010935 14:28543850-28543872 AAGTAAGGACAAGAAAAAAGTGG - Intergenic
1115301437 14:31889880-31889902 AAGTATTTGGAAAAAAAAATGGG + Intergenic
1116115405 14:40642764-40642786 AATTATGTGCAATAAATAAAGGG - Intergenic
1116378247 14:44231408-44231430 ATGAATGTGCAATACAAAAGAGG + Intergenic
1116539686 14:46085812-46085834 AAATATTTGGAAGAAAAAAATGG - Intergenic
1116555831 14:46305985-46306007 AATTATGTGCCAGAAAAAAAAGG - Intergenic
1117275616 14:54190316-54190338 AAAGAAATGCAAGAAAAAAGGGG + Intergenic
1117793634 14:59367545-59367567 AAATATGAGAAAGAAAAAGGAGG + Exonic
1119752971 14:77093563-77093585 AAGTATCAGCAAGAAGACAGAGG + Intergenic
1120096621 14:80396089-80396111 GTGTATTTGCAAGAAAAAAATGG + Intergenic
1120127286 14:80760438-80760460 GAGAAAGAGCAAGAAAAAAGAGG + Intronic
1120551445 14:85877706-85877728 AAGTATATGAAAGGAAAATGAGG - Intergenic
1120677858 14:87442886-87442908 AAGTATAGATAAGAAAAAAGAGG + Intergenic
1120775534 14:88432708-88432730 AAGCATTTGCAAGAAGGAAGAGG - Intronic
1120931670 14:89855036-89855058 AAAAATGGGAAAGAAAAAAGAGG + Intronic
1121946425 14:98126978-98127000 AGCTATGTGCCAGGAAAAAGGGG + Intergenic
1122936974 14:104964165-104964187 AAATATGGGCAAGAAAACACTGG + Intronic
1123955727 15:25332436-25332458 AAGTATGTGAAAGTACAATGTGG - Intergenic
1124452259 15:29805848-29805870 AAGGATGTCCAGGAAAAAAGTGG + Intronic
1124826070 15:33096904-33096926 AAGTATGTGTAAATAAAAATGGG - Intronic
1125365215 15:38906518-38906540 AAATATGTGTAACAGAAAAGAGG + Intergenic
1126382037 15:48058736-48058758 AACTAAGTGCAAGGAAACAGAGG + Intergenic
1126401451 15:48275486-48275508 AATTATGGGAAAGAAAGAAGGGG + Intronic
1126916152 15:53468312-53468334 GAGCATGTGCAAGAAATAATGGG - Intergenic
1126924628 15:53570099-53570121 AAGTATATACTGGAAAAAAGGGG - Intronic
1127032823 15:54882555-54882577 GGGTATGTGCAAGAAGATAGGGG - Intergenic
1127967720 15:63935997-63936019 AAGAATGAGCAAGCAACAAGAGG - Intronic
1128834779 15:70800498-70800520 GTGTGTGTGCCAGAAAAAAGGGG - Intergenic
1128959435 15:71986001-71986023 AAGTAAGGAAAAGAAAAAAGAGG + Intronic
1130918727 15:88326200-88326222 AAGTATGTCAAAGAATAGAGCGG - Intergenic
1131780829 15:95856982-95857004 AAGTATGTGCTGGAAGAATGGGG - Intergenic
1132957458 16:2603087-2603109 AAGTATTTGGAAAAAAAAAAAGG - Exonic
1133196190 16:4172452-4172474 AAGTGTCTTCATGAAAAAAGAGG + Intergenic
1134366558 16:13584477-13584499 AAGTATCTGGAAGAAAGAAATGG - Intergenic
1134798809 16:17065866-17065888 AAGTATCTGTAGGACAAAAGTGG - Intergenic
1135151803 16:20013820-20013842 AAAGAAGTGCAAGCAAAAAGGGG - Intergenic
1136418820 16:30119671-30119693 TGGTTTGTGCAAGAAAAATGAGG + Intronic
1137644538 16:50062633-50062655 GAGGATGAGCAAGAAAAAAGTGG - Intergenic
1137853947 16:51774194-51774216 AAGTTTGTGTATGATAAAAGTGG + Intergenic
1138709699 16:58956681-58956703 AAATATGTGTATTAAAAAAGAGG - Intergenic
1139043407 16:63028406-63028428 AAGTATGTGCAAGGGAGGAGGGG + Intergenic
1140818316 16:78640636-78640658 AAGTTGGTGAAAGAAAGAAGGGG + Intronic
1141102542 16:81208634-81208656 AATGGTGTGCAAGACAAAAGAGG + Intergenic
1141332966 16:83128830-83128852 AAGTATGGGCAACACATAAGGGG - Intronic
1143033059 17:3978463-3978485 AAGTGGATGCAAGAAAAAGGTGG - Intergenic
1143587498 17:7857694-7857716 AAGGATGTGTAAGAAACCAGAGG - Exonic
1144245602 17:13360958-13360980 AAATATTTGAAAGAAAAATGAGG - Intergenic
1145035042 17:19534698-19534720 ATGTATGTGAAAGAAAAAAGGGG + Intronic
1145727198 17:27141145-27141167 AAGTATTTAGAAGAAAACAGGGG + Intergenic
1147116124 17:38301183-38301205 AAGGATGTGCAAAGACAAAGAGG - Intronic
1148413557 17:47488407-47488429 AAGGATGTGCAAAGACAAAGAGG + Intergenic
1148864198 17:50620100-50620122 AAGAATCTGGAAGAGAAAAGAGG + Intronic
1149096171 17:52843514-52843536 AAGTATCTGCAAAAATAAAGGGG - Intergenic
1149130835 17:53299910-53299932 GAGTATGAGCAAGAACAAATAGG + Intergenic
1149227547 17:54492086-54492108 AAGTATTTGAAAGGAAAAACAGG + Intergenic
1150717266 17:67582724-67582746 AAGTATGTGCATAAAATAAATGG - Intronic
1152983078 18:297175-297197 TAGTATATGCATGAAAACAGTGG + Intergenic
1153690919 18:7592707-7592729 GAGTGTGTGCTATAAAAAAGGGG + Intronic
1154965962 18:21356547-21356569 ATGTATGTACAAGGAAAATGTGG - Intronic
1155419255 18:25636694-25636716 AAGCATGCTCAAGAAAAAGGTGG - Intergenic
1155456092 18:26015545-26015567 AAGTATTACCAAGAAAAGAGTGG - Intergenic
1156215662 18:34995626-34995648 AAGGAGGAGCAAGAAAAAAGTGG + Intronic
1156557905 18:38088249-38088271 TCTTATGTGGAAGAAAAAAGGGG + Intergenic
1156930214 18:42632740-42632762 AAGTAAGGGCTAGAAAAATGAGG - Intergenic
1157330086 18:46697449-46697471 CAGTATGTGGAAGCAAAAAGAGG + Intronic
1157600720 18:48891671-48891693 AATTATGTGGCAAAAAAAAGTGG + Intergenic
1158299295 18:56033677-56033699 AAGTTTGTGCCAGTAATAAGGGG - Intergenic
1158767717 18:60474932-60474954 AAGTAAGTGAAAGAAATATGGGG + Intergenic
1158966345 18:62625384-62625406 TATGATGAGCAAGAAAAAAGTGG + Intergenic
1160153292 18:76411882-76411904 AAGTATGTGATAATAAAAAGTGG - Intronic
1161791534 19:6362737-6362759 CAGTATGTGCAGGATCAAAGAGG - Intronic
1163016014 19:14455193-14455215 ACGTATGTACAAAAAAAAAAGGG + Intronic
1163198023 19:15738711-15738733 AAACTGGTGCAAGAAAAAAGGGG - Intergenic
1164211937 19:23106197-23106219 AAGGAAGGGGAAGAAAAAAGAGG + Intronic
1166103520 19:40585838-40585860 AAGTAAGTGAAATAAGAAAGAGG - Intronic
1168104726 19:54159761-54159783 AAGTAGGGACAAGAAAAAGGGGG - Exonic
1168485124 19:56754982-56755004 AAGGATGAGTAAGAAGAAAGAGG + Intergenic
1168564899 19:57414674-57414696 AGGTTTGAGAAAGAAAAAAGAGG + Intronic
1168683512 19:58333999-58334021 AAATATGTGCATTAGAAAAGAGG + Intronic
926026204 2:9547192-9547214 ATGTGTGTGCAAGAAAGGAGGGG - Intronic
926794520 2:16607901-16607923 CAGTATGAGCAAGAAAACAGAGG - Intronic
927050804 2:19326491-19326513 ATGTGTGTGCAAGTAAACAGGGG + Intergenic
928273344 2:29876919-29876941 AAGGATGGACAAGAAAAAACTGG - Intronic
928591538 2:32821459-32821481 AAGAAAATGCAAGAAAAAAATGG + Intergenic
928886844 2:36159073-36159095 AAATATGAACAAGACAAAAGAGG - Intergenic
929046338 2:37794201-37794223 AAGTCTGTGAAAGATAAAAGGGG + Intergenic
930669151 2:54130141-54130163 ATGTATGTGCAAGAAACATGGGG + Intronic
931355532 2:61535142-61535164 AATTCTGGGCAACAAAAAAGTGG - Intronic
933369120 2:81392819-81392841 AAATATGTGCAAAAGAAAATAGG - Intergenic
935408412 2:102734301-102734323 AAGTATCTGGAGGAAAAAAGTGG + Intronic
937307977 2:120883995-120884017 AAGTATGAGCAGGAACACAGGGG - Intronic
937492170 2:122381435-122381457 AAGGATGTACAAGAAAGAGGTGG + Intergenic
937535733 2:122884464-122884486 AGGTATCTGCAAGGATAAAGAGG + Intergenic
938671940 2:133595157-133595179 AAGTAAGGTCAAGAACAAAGAGG + Intergenic
938759256 2:134409001-134409023 AAGTATCTGCACTAAAAAACGGG - Intronic
938963167 2:136361252-136361274 CAATCTGTGGAAGAAAAAAGAGG - Intergenic
939246269 2:139627148-139627170 AAGATTGTGCATGAAAAAGGAGG + Intergenic
940946032 2:159618618-159618640 AAGTATGTGGAACTAAAAAATGG + Intergenic
940995128 2:160141251-160141273 AAGTAAAGGCAAAAAAAAAGGGG + Intronic
941398761 2:165004559-165004581 AAGAAAGTGCAGGAAAAAAATGG - Intergenic
941948843 2:171131813-171131835 AAGTATGTGGAAAAAAAGACTGG - Intronic
942618526 2:177821433-177821455 AAGTATGTACAAGAATTTAGGGG - Intronic
943144339 2:184022760-184022782 AAGATTCAGCAAGAAAAAAGAGG - Intergenic
943256871 2:185605383-185605405 AAGAAAATGCAAGAAAAGAGAGG + Intergenic
943379381 2:187124532-187124554 AAATTTCTGCAAGAAAAAACAGG + Intergenic
943536441 2:189156869-189156891 AAGAATTTGCAATAAAATAGTGG + Intronic
943579936 2:189673286-189673308 AAGTGTGTGGAAAAAAAAAAAGG - Intergenic
944038264 2:195324136-195324158 AAGCAAGTGCATGCAAAAAGAGG - Intergenic
944328372 2:198434633-198434655 AAATATGTGCAAGTAAAAAATGG - Intronic
944996047 2:205295138-205295160 AAATATGTGGGAGAATAAAGTGG + Intronic
945052111 2:205833912-205833934 AATTATGTGCCAGAACAATGTGG - Intergenic
945153511 2:206812713-206812735 CAGTATGTGCATAAAAAATGAGG - Intergenic
945205335 2:207325591-207325613 AGGTAAGTGCAACCAAAAAGAGG - Intergenic
946073970 2:217058391-217058413 GAATCAGTGCAAGAAAAAAGTGG - Intergenic
946628521 2:221641361-221641383 AAGTGAGTGCAAGACAAATGGGG - Intergenic
947298259 2:228657321-228657343 AAGTAAGTGCAAGAAATTAAGGG + Intergenic
947336885 2:229095428-229095450 AAATTTGTGCAATAAAAATGAGG - Intronic
1169032331 20:2419250-2419272 AAGTATGTGAAAGGAGAGAGAGG - Intronic
1169553254 20:6723067-6723089 AAGTTTGTCCAAGTAGAAAGTGG + Intergenic
1169667854 20:8058617-8058639 AACTATGTGCAATAACATAGAGG - Intergenic
1169966129 20:11219415-11219437 AAGTACGTTGAAGGAAAAAGTGG - Intergenic
1170131920 20:13030012-13030034 AAGGAGGTGCAAGAAGAAATTGG + Intronic
1170156676 20:13275225-13275247 ATGTCTGTGCAAGGAAAAAAAGG - Intronic
1172705642 20:36880402-36880424 AAGTATATTTAAGAAAAAGGAGG + Intronic
1173357456 20:42307270-42307292 AAGTCTGAGAAAGAAAAATGTGG - Intronic
1173874392 20:46360935-46360957 AAATATTTGTAATAAAAAAGAGG + Intronic
1177046844 21:16181929-16181951 AAATATTTTAAAGAAAAAAGAGG + Intergenic
1177066595 21:16444485-16444507 AAGAAAGTGCTAGAAAAAATGGG - Intergenic
1177892507 21:26823507-26823529 GAGTACCTGCAAGCAAAAAGTGG + Intergenic
1177933576 21:27316093-27316115 AGGTCTTTGCAGGAAAAAAGGGG + Intergenic
1178219125 21:30635578-30635600 AAGTATCTGGAAGAAAAAATAGG + Exonic
1178228962 21:30758556-30758578 AAGCATCTGCACGAATAAAGTGG + Intergenic
1180164687 21:46018511-46018533 TAATATATGAAAGAAAAAAGTGG - Intergenic
1181835161 22:25599865-25599887 AAGTATGTTCAAGGAGAAACAGG + Intronic
1183016103 22:34988767-34988789 TAGAAAGAGCAAGAAAAAAGTGG + Intergenic
949161411 3:887260-887282 AAGGAAGTGAAAGAGAAAAGAGG - Intergenic
949221149 3:1635552-1635574 AATTATGAGCAAGAAAGAAAAGG - Intergenic
950648621 3:14393306-14393328 AAGAATGAGCAAGAAGAGAGGGG - Intergenic
950719306 3:14871192-14871214 AACGATGGGCAAGAAAACAGAGG - Intronic
950812064 3:15658497-15658519 AAGTTTGGGCAAGATAAAAGTGG - Intergenic
951284722 3:20795446-20795468 ATGCATGTGAAAGAAAGAAGGGG - Intergenic
951497077 3:23341678-23341700 AAGGAAGTGAAAGAAAAGAGGGG - Intronic
951790311 3:26475446-26475468 AAGTATGTGCTACTATAAAGTGG - Intergenic
952124940 3:30289715-30289737 AAGAAAGGGCAAGAAATAAGGGG - Intergenic
953078410 3:39592890-39592912 AAGTATCTGCAGGAAACACGTGG - Intergenic
953753281 3:45625717-45625739 AAGCATGTGCAAGAGAAAGCAGG - Intronic
956457561 3:69438432-69438454 AAATATGTTCAAGACAAAAAAGG + Intronic
957320311 3:78621789-78621811 AAACATGTTCAAGAGAAAAGCGG + Intronic
957849677 3:85791103-85791125 AAGTATTTGAAAGAACAGAGGGG + Intronic
958097492 3:88965196-88965218 ACATCTGTGCAATAAAAAAGTGG + Intergenic
958724907 3:97893317-97893339 AAGTATGATCAACAAAATAGTGG - Intronic
959413438 3:106054499-106054521 CTATATGTGCAATAAAAAAGTGG + Intergenic
959658950 3:108843684-108843706 GAGTAGGTTCAAGAAAGAAGAGG - Intronic
959720610 3:109483258-109483280 AAATATGTGCAACAAAAATAGGG - Intergenic
960289699 3:115868456-115868478 AAGTATTTGGAAGAAAACAGAGG + Intronic
960820824 3:121729381-121729403 TAGTATGTGCTAGATAAGAGGGG - Intronic
961113471 3:124305854-124305876 AAGTATGACCAGGAAAAAAAAGG + Intronic
962260497 3:133899950-133899972 AATTATGTGAAAAAAAAAATAGG - Intergenic
963135074 3:141895488-141895510 AATTATGCTAAAGAAAAAAGAGG - Intronic
963322689 3:143826448-143826470 AGGTAGATGCAAGAAAAACGAGG - Intronic
963624385 3:147652717-147652739 AACTATGTACAATAAAAAATGGG - Intergenic
963791212 3:149584404-149584426 AAACATGTGCAAAAAGAAAGTGG - Intronic
964506105 3:157401444-157401466 AAGTAGGTGCAAAGAAAAATAGG - Intronic
964758596 3:160112014-160112036 AAATGAGTGCAAGACAAAAGTGG + Intergenic
965172486 3:165284300-165284322 AAGTATGAAAAATAAAAAAGAGG - Intergenic
965515411 3:169616271-169616293 AAGTTTGGGGAAGAAAAGAGGGG + Intronic
965923960 3:173954590-173954612 AAGAATATGCAAGAAGAAGGTGG - Intronic
965956712 3:174379048-174379070 AATAATGTTAAAGAAAAAAGTGG + Intergenic
966056758 3:175702826-175702848 AAATATTTGGAAGAAAATAGTGG + Intronic
966522960 3:180893368-180893390 AAGTATGTATAAGAAACAATTGG - Intronic
967466263 3:189809476-189809498 AAGAATGTTCAAGACCAAAGTGG + Intronic
967535567 3:190598319-190598341 AAGTATATAGAAAAAAAAAGAGG - Intronic
968422970 4:500371-500393 AAGTGTTTGAAAGAAAAAAAAGG - Intronic
969921506 4:10544765-10544787 AAGTAAGTCCAGGAACAAAGAGG + Intronic
970125300 4:12803086-12803108 AAGTATGTGCAAAAAATGAAAGG + Intergenic
970140713 4:12979297-12979319 AGGTGTGTGGAAGAAATAAGCGG - Intergenic
970295283 4:14623182-14623204 AAGTATATGCTACAAAGAAGGGG + Intergenic
970604789 4:17668842-17668864 AAGTATTTGTAAGAAAATTGTGG - Intronic
970699421 4:18717042-18717064 AAGTACTTGCAAGATAGAAGTGG - Intergenic
970844190 4:20516495-20516517 AAGAAACTGAAAGAAAAAAGTGG - Intronic
971600384 4:28584125-28584147 AAGTATCTGCATGAAGAAAAGGG + Intergenic
971708961 4:30086586-30086608 ATAGATGTGCAAAAAAAAAGTGG - Intergenic
972512400 4:39781399-39781421 AAGTATCTGTAAGAAAGAATTGG + Exonic
972649931 4:41006773-41006795 TAGTATTTGTAAGAAAAAAGGGG + Intronic
972921354 4:43946277-43946299 AACTGTTTGCAATAAAAAAGTGG - Intergenic
974540840 4:63232627-63232649 AATTATGAGCAAAAAAAAAATGG - Intergenic
974706460 4:65522958-65522980 AAGCATGATCAACAAAAAAGAGG + Intronic
975502602 4:75103486-75103508 AAGTATGTGTCAGTAAAATGGGG + Intergenic
975841429 4:78478507-78478529 AACTATGTGTAAGAAATAAAGGG + Intronic
976751599 4:88455752-88455774 AACTATGTAAAAGAAAAAAATGG + Intergenic
977525574 4:98141993-98142015 AAGTGTTTCCAAGAATAAAGTGG + Intronic
980290203 4:130840021-130840043 AAGTATGTGCAAGTTAAAATGGG + Intergenic
980294860 4:130899787-130899809 ACTTAACTGCAAGAAAAAAGAGG - Intergenic
980755351 4:137151445-137151467 AAGTTTTTGGAAGAAAAAATAGG - Intergenic
980769692 4:137355018-137355040 AGGTAAGAGCAAGAAAAAAAAGG + Intergenic
982256486 4:153456346-153456368 AAGTATGTAGAGGAAAAAGGGGG + Intergenic
982282848 4:153703271-153703293 AAGAATGTTAAAGAAGAAAGGGG - Exonic
982338206 4:154264367-154264389 AAATATGAGCAAGGAACAAGAGG + Intronic
984460428 4:180029481-180029503 AATTATATGCAAAAAAAAAGTGG + Intergenic
984798844 4:183693504-183693526 AAGTATTTAAAAGAAATAAGAGG - Intronic
985030034 4:185780365-185780387 AAGCATATGCAAGAAAAATAAGG + Intronic
985118237 4:186613412-186613434 AAGTAATTGAAAGACAAAAGGGG - Intronic
985208899 4:187571048-187571070 GGGTATGTGAAAGAAAGAAGTGG + Intergenic
986232219 5:5876746-5876768 AAGTATGTGTGAGAGAGAAGGGG + Intergenic
986359323 5:6960797-6960819 AAGGAAATGCAAGAAAAAAAAGG + Intergenic
986829072 5:11555723-11555745 AATAATGTGAAAGAATAAAGGGG + Intronic
987209572 5:15666417-15666439 AACTTTGTGCAAGAAGAAAATGG + Intronic
987248488 5:16075203-16075225 AAGTTTGTGCAAGAGCAGAGAGG - Intronic
987741872 5:21919505-21919527 AAGAATTTGCATGAAAGAAGTGG - Intronic
988030416 5:25756476-25756498 AAGTATGTTGCAAAAAAAAGGGG + Intergenic
988066069 5:26229622-26229644 AAGTAATGGCAAAAAAAAAGTGG - Intergenic
988277033 5:29094353-29094375 AAAAAAGTGCAAGAAAAAAATGG - Intergenic
988541767 5:32116537-32116559 AAGTAGTTATAAGAAAAAAGAGG + Intergenic
988573352 5:32394072-32394094 AGGTATGTAAATGAAAAAAGTGG + Intronic
990620436 5:57553424-57553446 TAGTATGTTCAAGATTAAAGGGG + Intergenic
991190248 5:63863599-63863621 AAGTATGAGCAAGAATAAAATGG + Intergenic
991190282 5:63864223-63864245 ATGGATGAGCAAAAAAAAAGTGG - Intergenic
991285878 5:64975192-64975214 AAATAACTGCAAGAAAAAGGTGG - Intronic
991331226 5:65494621-65494643 AAGTATATGCAAAATAAAATTGG + Intergenic
991462494 5:66873938-66873960 AAATATGGGCCAGAAATAAGGGG + Intronic
991531425 5:67619502-67619524 AAATATGTGCAAGAAAGTAATGG + Intergenic
991740777 5:69672202-69672224 AAGTATATAAAAAAAAAAAGGGG - Intergenic
991772705 5:70054338-70054360 AAGTGTGTGGAGGAGAAAAGAGG + Intronic
991792351 5:70251943-70251965 AAGTATATAAAAAAAAAAAGGGG - Intergenic
991820235 5:70548309-70548331 AAGTATATATAAAAAAAAAGGGG - Intergenic
991851998 5:70929762-70929784 AAGTGTGTGGAGGAGAAAAGAGG + Intronic
992640090 5:78761599-78761621 AAGTATGTGTAGAAAAAAAGAGG - Intronic
993196992 5:84761835-84761857 AATTATCTGCATTAAAAAAGAGG - Intergenic
993249727 5:85504517-85504539 TTATATGTGCAAGAAAAAAATGG - Intergenic
993258037 5:85618098-85618120 AAATATGTGCACAAGAAAAGAGG + Intergenic
993827427 5:92709076-92709098 AAGTATCTGGTAGAAAAAGGTGG + Intergenic
995036538 5:107540375-107540397 AAATATGTGCAAGAATAAATGGG - Intronic
995163948 5:109015149-109015171 TACTATGTGCTAGAAACAAGGGG - Intronic
995449607 5:112286216-112286238 AAGGATGTGCAAGGAAATTGAGG - Intronic
995491388 5:112695477-112695499 AAGTAAGTGAAAGAAAAATAAGG - Intergenic
995889421 5:116934163-116934185 AAGTATGTGAGAAAAAAAAATGG + Intergenic
996230662 5:121059710-121059732 AAGTAAGTGGAAGAAGAAATAGG - Intergenic
996312693 5:122124795-122124817 AAGTGTGTTCAAGAGAAAAATGG - Intergenic
996449714 5:123607089-123607111 GAGGATGTGAAAGAAGAAAGTGG + Intronic
996889576 5:128402168-128402190 AAATATTTGAAATAAAAAAGAGG + Intronic
996957257 5:129199079-129199101 AAGCATCTGCCACAAAAAAGTGG - Intergenic
997036403 5:130197499-130197521 CAGTTTGTGCAAGAAGAGAGAGG + Intergenic
998044230 5:138973222-138973244 AAGGTTGTGTAAGAATAAAGTGG + Intronic
998975245 5:147638103-147638125 AATTAGGTACAAGAAAAAATAGG - Intronic
999405610 5:151304184-151304206 AAGTATCTGTTAGTAAAAAGCGG + Intergenic
999420875 5:151441349-151441371 TAGTATGTGCTATAAACAAGAGG + Intronic
999469359 5:151838104-151838126 AAGTATGTTCAACAAACTAGAGG + Intronic
999570027 5:152909420-152909442 AATTAAGTGGAAGAAAAGAGTGG - Intergenic
999832841 5:155337188-155337210 AATTATGTGCTGGAGAAAAGAGG + Intergenic
1000518491 5:162270390-162270412 AAGTAGGTGAAAGAGAAAGGAGG - Intergenic
1000812112 5:165875944-165875966 ATGTCTGAGTAAGAAAAAAGAGG - Intergenic
1000915134 5:167072289-167072311 GAGAAAGTGGAAGAAAAAAGAGG - Intergenic
1001322448 5:170693800-170693822 AAGGATTAGCAAGAAGAAAGTGG + Intronic
1005017074 6:21384602-21384624 ATGTATGTTCGAGAAGAAAGGGG - Intergenic
1005411628 6:25554496-25554518 AAGAAAGTGCAAGAACAAAATGG + Intronic
1006201190 6:32292989-32293011 AAGGAAGTACAACAAAAAAGTGG - Exonic
1006428514 6:33981053-33981075 AAGGAAGTGCAAGTTAAAAGAGG + Intergenic
1006621784 6:35370381-35370403 AAGTATGTGTAAGAAGATACTGG + Intronic
1007212096 6:40201779-40201801 AAGTATGAGCAAGAGAAATCAGG - Intergenic
1007973967 6:46081514-46081536 AAGAATGGGTAAGGAAAAAGAGG + Intergenic
1008051627 6:46905769-46905791 AAATATGTAAAACAAAAAAGTGG + Intronic
1008098371 6:47363865-47363887 AAGTGTTTTCAAGAAAGAAGGGG + Intergenic
1008847081 6:55980658-55980680 AAGTCTTTGCAAGAAAAAAAAGG + Intergenic
1009681751 6:66902490-66902512 AAATATGTGTAAGAAACAAGAGG + Intergenic
1009687245 6:66978220-66978242 AAATATGTGCAGTAAATAAGAGG + Intergenic
1010374561 6:75151746-75151768 AATTATGTGATAGAAAAAAATGG + Intronic
1010703991 6:79086173-79086195 CAGTATGTGCAAAAAAATAAAGG - Intergenic
1010926112 6:81748730-81748752 AAGTATTTGCAAGAAAAAATAGG + Exonic
1011521429 6:88210697-88210719 GAGAAAGTGCATGAAAAAAGGGG + Intergenic
1011850878 6:91627418-91627440 AAGAAAGAGCAAGAAAGAAGGGG - Intergenic
1011863185 6:91786359-91786381 AAGTGTGTGGAAAAAAACAGAGG + Intergenic
1012526709 6:100186457-100186479 AAGGATTTGCAAGAAAAGTGAGG - Intergenic
1012718346 6:102705801-102705823 AAGTCTATTCAAGAAAAAACTGG + Intergenic
1012773343 6:103470455-103470477 AAGTATGTCCAGAAAAAAAAAGG + Intergenic
1013303645 6:108827833-108827855 AAGTATGTACAAGAAAACACAGG + Intergenic
1013905452 6:115211716-115211738 AAGCAATTGCAAGAAAAAAATGG + Intergenic
1016328975 6:142936145-142936167 TATTATGGGCAAGAAAAAAATGG - Intronic
1016793036 6:148086638-148086660 AAGGCTGTGCAAGAAGAAAAGGG + Intergenic
1016889344 6:148990254-148990276 AAATATGGCCAAGCAAAAAGAGG - Intronic
1017442170 6:154474581-154474603 AAGAATGTGCAAGATAGACGGGG + Intronic
1017692583 6:156981797-156981819 AAGCATGTGAAAAAAAAACGAGG - Intronic
1017869647 6:158476093-158476115 AAGGCTGTGCTAGAAAAACGGGG - Intronic
1019693237 7:2429374-2429396 AAATAAGTACAAAAAAAAAGAGG - Intronic
1020038613 7:4983294-4983316 AACTATGAACAAGAAAGAAGTGG - Intergenic
1020074629 7:5249608-5249630 AGGTATGTCCAAGAACAAAAGGG + Intergenic
1020459843 7:8417047-8417069 ATGTGTGTTCAAGAACAAAGGGG + Intergenic
1020483274 7:8689413-8689435 AAGTATGGGCAAGTTTAAAGGGG + Intronic
1020895373 7:13932592-13932614 AAGTATAACCAAGAACAAAGAGG - Intronic
1022040281 7:26574797-26574819 AATCAGGTGCAAGAAAAAAAAGG + Intergenic
1022744801 7:33160519-33160541 AAGCATAAGCAAGAAAAAATAGG + Intronic
1022793434 7:33712333-33712355 AAGGTTGAGCATGAAAAAAGGGG - Intergenic
1023168354 7:37365320-37365342 AAGTATGGGCAAGATAAGAGTGG + Intronic
1023236427 7:38095030-38095052 AAGTGTTGGCAAGAATAAAGAGG + Intergenic
1023434453 7:40127731-40127753 AATTATGAGCAAAATAAAAGAGG + Exonic
1024892093 7:54215277-54215299 AAGTGCCTGCATGAAAAAAGAGG + Intergenic
1025204474 7:56984198-56984220 AGGTATGTCCAAGAACAAAATGG - Intergenic
1026104368 7:67409477-67409499 AAGTAAGTAAAAGAAAAAGGTGG - Intergenic
1026571531 7:71535469-71535491 AAATATGTACAGAAAAAAAGAGG + Intronic
1026678573 7:72448442-72448464 AAGCAGGGGCAAGCAAAAAGAGG - Intergenic
1028319129 7:89438198-89438220 GGGTATGTGCCATAAAAAAGGGG + Intergenic
1028722177 7:94046008-94046030 AAGTAGGTGAAATAAAGAAGAGG + Intergenic
1028813036 7:95110730-95110752 ATGTATATGCAAGTAAAATGAGG + Intronic
1028830421 7:95321712-95321734 AAGTGTGAGCAAATAAAAAGAGG - Intronic
1029856807 7:103525818-103525840 AAGTATGTGTAAGATATTAGGGG - Intronic
1030120266 7:106103123-106103145 AAGAATGTTCATGAAAAATGGGG + Intronic
1030554532 7:111006979-111007001 AAGTAGGTTCAAGAGAAAATGGG - Intronic
1030684684 7:112472744-112472766 ACTTATGTGAAAGAAAAAGGTGG - Exonic
1030779385 7:113580351-113580373 AAATCTTTGCAAGAAAAAAAGGG + Intergenic
1031486865 7:122337411-122337433 AAGAATGTTCAAGAAATATGTGG - Intronic
1032402549 7:131633863-131633885 AAGTACAGGCAAGAACAAAGAGG + Intergenic
1032553205 7:132805124-132805146 AAGGATGTGCAGGAACAAAGGGG + Intronic
1033638742 7:143239379-143239401 AGGCATGTCCAAAAAAAAAGTGG + Intergenic
1033842402 7:145390303-145390325 AAATATATGCAAGAAAAACATGG - Intergenic
1034521266 7:151621960-151621982 AAGTCTGTTCAGGAAAAAATGGG - Intronic
1034824220 7:154246867-154246889 AAGCATGTGGAAGAAAATAATGG + Intronic
1035063059 7:156083604-156083626 AAGTATTTGCAACACAAAAAAGG - Intergenic
1035980055 8:4360464-4360486 AAGTATGTGCAAGAAAAAAGAGG - Intronic
1036079285 8:5536478-5536500 GAGAATATGGAAGAAAAAAGAGG - Intergenic
1037535484 8:19819282-19819304 AACTATTTGAAAGAAAAAATAGG - Intronic
1038139575 8:24829203-24829225 AAGTATTTGCAAGAAATGTGAGG - Intergenic
1038255526 8:25947691-25947713 GTGCATGTGCAAGAAAGAAGGGG - Intronic
1038580066 8:28740263-28740285 AAATAGGTGTAAGAAAAACGAGG - Intronic
1039025931 8:33257859-33257881 ATGTATGTGCAAGGAAAACTAGG - Intergenic
1039534488 8:38295771-38295793 AAGTTTTTCCAAGAACAAAGAGG - Intronic
1039795647 8:40911588-40911610 AATTATATGAAAGAAAAAAGAGG + Intergenic
1039862086 8:41467810-41467832 CAGTTTGTTCAATAAAAAAGAGG - Intergenic
1040372190 8:46788077-46788099 CAGTATGGGGAAGAAAAATGTGG + Intergenic
1041427729 8:57741593-57741615 AGGTATGTGCAGGACAACAGCGG + Intergenic
1042029607 8:64461729-64461751 TAATATGTCCAAGAAAATAGAGG - Intergenic
1042498750 8:69485873-69485895 AAGTTTTTGCTAGAAAACAGTGG - Intronic
1043220528 8:77656417-77656439 AAGAATTTGCTAGAAAAATGAGG - Intergenic
1043268877 8:78303466-78303488 AAGTTTGAGAAAGAAAAAAATGG + Intergenic
1043585298 8:81761471-81761493 AAATATGTCCAAGAAAGGAGAGG + Intergenic
1043784644 8:84383363-84383385 AAATATTTGCAACAAATAAGAGG + Intronic
1044089802 8:87985342-87985364 AATTAAGTGCAAAAAAAATGAGG + Intergenic
1044095979 8:88065154-88065176 AAATATGTGAAAGATTAAAGGGG - Intronic
1045058287 8:98388636-98388658 AATAACTTGCAAGAAAAAAGGGG + Intergenic
1045163443 8:99575358-99575380 AACTATTTGCAAGAACAAAAAGG + Intronic
1045289775 8:100823070-100823092 AAGTATGCACAAGATTAAAGAGG + Intergenic
1045653016 8:104359602-104359624 AATTATGGGAAAGAAGAAAGAGG - Intronic
1045817690 8:106295854-106295876 AGGTATGTGCAACAAAGAAATGG - Intronic
1045830381 8:106453019-106453041 AAGCTTGTGCAAAAACAAAGAGG - Intronic
1045920458 8:107522865-107522887 ATGTATGTCCACGAGAAAAGGGG + Intergenic
1045985070 8:108240344-108240366 AGGGATGTGAAAGAAAAAAAGGG + Intronic
1046091538 8:109508580-109508602 AAGTATTTTAAAGAAAAAAAAGG + Intronic
1046208447 8:111035860-111035882 AAATATGAGCAAAATAAAAGAGG + Intergenic
1046404662 8:113757363-113757385 AAGTATGGGAAAGAAATCAGTGG - Intergenic
1046778876 8:118194101-118194123 AAGCATTTGCAAGTAACAAGGGG + Intronic
1046940898 8:119930536-119930558 CAGTATTTAAAAGAAAAAAGGGG - Intronic
1047009784 8:120659348-120659370 ATGGATGAGCAAAAAAAAAGTGG - Intronic
1048274795 8:133058183-133058205 AAGTAGGTAGAAGAGAAAAGAGG + Intronic
1048777725 8:137966094-137966116 GAGTATTTGCAAAAGAAAAGTGG - Intergenic
1049184115 8:141240324-141240346 AATCATGTAAAAGAAAAAAGGGG - Intronic
1050723186 9:8614637-8614659 GAGTTTATGCAAGAAATAAGAGG + Intronic
1051166902 9:14272187-14272209 AAATATGTGGGGGAAAAAAGAGG - Intronic
1052578019 9:30315043-30315065 AATTATCAGCAATAAAAAAGAGG - Intergenic
1056160330 9:83884610-83884632 CAGTATGTATAAGTAAAAAGAGG - Intronic
1056359894 9:85845236-85845258 CAGTATGTATAAGTAAAAAGAGG + Intergenic
1057224367 9:93281757-93281779 AAGGATGCCCAAGAAAAAACAGG + Intronic
1057958745 9:99434392-99434414 AAGTATGTTCAAGAGAAACAGGG - Intergenic
1058346304 9:103967326-103967348 AAGCAAGTGAAAGAAATAAGGGG - Intergenic
1058989868 9:110245252-110245274 AATTATGAGCAAGAAATAAGAGG - Intronic
1059548787 9:115206553-115206575 GATTTTGGGCAAGAAAAAAGAGG + Intronic
1059853534 9:118369497-118369519 AAGGATGTAAAAAAAAAAAGTGG + Intergenic
1203692530 Un_GL000214v1:58780-58802 ATCTTTGTTCAAGAAAAAAGAGG + Intergenic
1203441207 Un_GL000219v1:10293-10315 AAGCAGGAGCAAGAAAAATGAGG + Intergenic
1203512016 Un_KI270741v1:129201-129223 AAGCAGGAGCAAGAAAAATGAGG + Intergenic
1203556713 Un_KI270744v1:5672-5694 ATCTTTGTTCAAGAAAAAAGAGG + Intergenic
1203643765 Un_KI270751v1:45411-45433 ATCTTTGTTCAAGAAAAAAGAGG - Intergenic
1186305979 X:8258210-8258232 AAGTATGAGGAAGAAAAAAGAGG + Intergenic
1187515303 X:19964186-19964208 CAGTATGTGAATGAAAAAGGGGG - Intronic
1187595693 X:20770230-20770252 GAGGATGATCAAGAAAAAAGAGG + Intergenic
1188024771 X:25196598-25196620 GACTCTTTGCAAGAAAAAAGTGG + Intergenic
1188432285 X:30117770-30117792 AAGTAAATGCAGGAAAAGAGGGG + Intergenic
1188966021 X:36552682-36552704 AAGTAAATGCAAGAAAAAATGGG - Intergenic
1189206392 X:39242915-39242937 AAGTATGAGCAAGCAGAAATTGG - Intergenic
1189954034 X:46260284-46260306 AAGTCTGAGCAAGAAAAACTGGG + Intergenic
1191734271 X:64372991-64373013 AAGTATGTCCAAGCCAAAAGTGG + Intronic
1193013175 X:76700993-76701015 AAGTGCCTACAAGAAAAAAGAGG + Intergenic
1193117196 X:77786460-77786482 TAATATGTCAAAGAAAAAAGAGG - Intergenic
1193630667 X:83883105-83883127 AACCAATTGCAAGAAAAAAGAGG - Intronic
1193729937 X:85090640-85090662 AAGCATGTTCAAGAAACAAATGG - Intronic
1194707792 X:97196579-97196601 AAGTTTGTTAAAGAAAAAAAGGG + Intronic
1195497267 X:105551209-105551231 AAGTATGTTCAAGACATAATGGG - Intronic
1196036233 X:111148630-111148652 TAATATGTGAAGGAAAAAAGTGG + Intronic
1196155859 X:112429221-112429243 AAATCTGTGGAAGATAAAAGAGG - Intergenic
1196389710 X:115194705-115194727 AGGTATGTGGAAGAAATGAGAGG + Intronic
1196512316 X:116526212-116526234 AAGTCTGGGCAAGAGAGAAGAGG + Intergenic
1196523618 X:116705212-116705234 AAGTATGTCCATGAGAAAAAAGG - Intergenic
1196618532 X:117795445-117795467 AAGAATGTGCTAAAATAAAGGGG - Intergenic
1197559621 X:128001643-128001665 AAGTATTTTCAAGAAAAATTGGG - Intergenic
1197599330 X:128508746-128508768 ATGAATATGCAAGAAGAAAGGGG - Intergenic
1197637621 X:128932846-128932868 AGGTATGTTCAAGAGATAAGGGG - Intergenic
1199229092 X:145414326-145414348 AAGTATATGCTAGAGAAAATTGG - Intergenic
1200777941 Y:7186516-7186538 CAGTAGGTGCAAGAAAAAACAGG + Intergenic
1201912484 Y:19146894-19146916 AAGCATGTGCAAGAGAAAGCAGG + Intergenic