ID: 1035980062

View in Genome Browser
Species Human (GRCh38)
Location 8:4360499-4360521
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035980055_1035980062 12 Left 1035980055 8:4360464-4360486 CCTCTTTTTTCTTGCACATACTT 0: 1
1: 0
2: 3
3: 42
4: 492
Right 1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG No data
1035980054_1035980062 24 Left 1035980054 8:4360452-4360474 CCGTTATCATAACCTCTTTTTTC 0: 1
1: 0
2: 3
3: 38
4: 488
Right 1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG No data
1035980053_1035980062 25 Left 1035980053 8:4360451-4360473 CCCGTTATCATAACCTCTTTTTT 0: 1
1: 1
2: 1
3: 32
4: 434
Right 1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr