ID: 1035980255

View in Genome Browser
Species Human (GRCh38)
Location 8:4362339-4362361
Sequence GGGGGCAGACAGATGAGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 303}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035980255_1035980269 29 Left 1035980255 8:4362339-4362361 CCCAAGCTCATCTGTCTGCCCCC 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1035980269 8:4362391-4362413 GGACAGAGTCTCAGGTCCGAGGG No data
1035980255_1035980264 8 Left 1035980255 8:4362339-4362361 CCCAAGCTCATCTGTCTGCCCCC 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1035980264 8:4362370-4362392 TAGTGGTCCAGCAGAGCCTGGGG No data
1035980255_1035980257 -9 Left 1035980255 8:4362339-4362361 CCCAAGCTCATCTGTCTGCCCCC 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1035980257 8:4362353-4362375 TCTGCCCCCTGCACTCATAGTGG No data
1035980255_1035980262 6 Left 1035980255 8:4362339-4362361 CCCAAGCTCATCTGTCTGCCCCC 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1035980262 8:4362368-4362390 CATAGTGGTCCAGCAGAGCCTGG No data
1035980255_1035980263 7 Left 1035980255 8:4362339-4362361 CCCAAGCTCATCTGTCTGCCCCC 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1035980263 8:4362369-4362391 ATAGTGGTCCAGCAGAGCCTGGG No data
1035980255_1035980268 28 Left 1035980255 8:4362339-4362361 CCCAAGCTCATCTGTCTGCCCCC 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1035980268 8:4362390-4362412 GGGACAGAGTCTCAGGTCCGAGG No data
1035980255_1035980266 21 Left 1035980255 8:4362339-4362361 CCCAAGCTCATCTGTCTGCCCCC 0: 1
1: 0
2: 0
3: 24
4: 303
Right 1035980266 8:4362383-4362405 GAGCCTGGGGACAGAGTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035980255 Original CRISPR GGGGGCAGACAGATGAGCTT GGG (reversed) Intronic
900476331 1:2878068-2878090 GGGTGCAGAGACCTGAGCTTGGG + Intergenic
901000247 1:6145456-6145478 GGTGGCTGACAGATGGGCCTTGG - Intronic
901004930 1:6166978-6167000 GGTGGCTGCCAGAAGAGCTTAGG - Intronic
902603265 1:17554377-17554399 GGAGGGAGACAGAGGAGCTGAGG + Intronic
902727522 1:18347025-18347047 GGGGCCAGACAGATGGGTTTGGG + Intronic
903061474 1:20671754-20671776 GGAGGCAGACAGATGTGGGTTGG - Intronic
903293363 1:22328724-22328746 GGTGGCAGACAGATGAGACCTGG - Intergenic
904425531 1:30420304-30420326 GGGGGCTTACAGATGTTCTTGGG + Intergenic
905208894 1:36359735-36359757 GGGGCCAGACAAAGGAGTTTGGG - Intronic
905789979 1:40784513-40784535 GGGGGGAGAGAGATGAGGGTCGG - Intronic
905866769 1:41381152-41381174 GGGGGCGGACAAATGAGCCGCGG + Intronic
906466277 1:46082830-46082852 GGAGGCGGACAGATCAGCTGAGG + Intronic
907319799 1:53595054-53595076 GGGGGCAGACAGGGAAGCTGAGG + Intronic
909793143 1:79700895-79700917 GGGTGCAGAGATATGAGGTTGGG + Intergenic
912274480 1:108242035-108242057 GGGGGCAGGCAGATGGGCAGGGG - Intronic
912286787 1:108377823-108377845 GGGGGCAGGCAGATGGGCAGGGG + Intronic
912293739 1:108452306-108452328 GGGGGCAGGCAGATGGGCAGGGG + Intronic
915210340 1:154304026-154304048 GGGGGCAGGCAGATCACCTGAGG + Intergenic
915727984 1:158032326-158032348 GGGAGCAGGGAGATGAGGTTGGG + Intronic
915938102 1:160100706-160100728 GGGGACAGACAGACAAGCCTGGG - Intergenic
916845126 1:168642778-168642800 TGTGGCAGACAGATGAGATTGGG + Intergenic
919324317 1:196086975-196086997 TGGGGCAGACAGACAACCTTAGG + Intergenic
919476184 1:198035711-198035733 GGGTGCAGAGATATGAGGTTGGG - Intergenic
920030311 1:203033748-203033770 GTGGGCAGACAGCTGAGGTCAGG + Intronic
921493801 1:215811677-215811699 GTGGGCAGACATTTGAGGTTGGG + Intronic
921926311 1:220712412-220712434 GGAGCCAGCCAGGTGAGCTTGGG + Intergenic
1063509790 10:6634248-6634270 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1063509800 10:6634290-6634312 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1063527867 10:6801745-6801767 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1064256497 10:13746917-13746939 TAGGGCCGACAGATGAGCTATGG + Intronic
1065932480 10:30491822-30491844 AGGGTCTGACTGATGAGCTTAGG + Intergenic
1067015968 10:42756455-42756477 GTGGGCACACAGGTGAGCTCCGG + Intergenic
1067144514 10:43684753-43684775 GGCGGCAGACAAGAGAGCTTGGG - Intergenic
1068592529 10:58865659-58865681 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1070527854 10:77310627-77310649 GCCCGCAGACAGACGAGCTTTGG + Intronic
1070832954 10:79431449-79431471 GGGGGCACACAGATCACCTGGGG + Intronic
1073208507 10:101781006-101781028 GGGGGCAGATAAGCGAGCTTAGG - Intergenic
1074255931 10:111802469-111802491 GGGGGCTCTCAGATCAGCTTTGG - Intergenic
1075441000 10:122479316-122479338 GGAGCCAGACAGATGGGGTTAGG + Intronic
1077471480 11:2762899-2762921 GTGGGCAGACAGATGAACAGTGG - Intronic
1077923569 11:6658936-6658958 GGGGGCAGGCTGGTGACCTTGGG + Intergenic
1079944219 11:26721563-26721585 GGGGGAAGGCAAATGAGCTTTGG - Exonic
1080903839 11:36521258-36521280 GGGAGCTGAAAGATGAGATTTGG - Intronic
1083335612 11:61920030-61920052 GGGCACAGACAGGTGAGCTCAGG - Intronic
1084040888 11:66542061-66542083 GGGGGCAGTCAGCTGGGCTCGGG + Intronic
1084233517 11:67770553-67770575 TGAGGCAGACAGATGACCTGAGG + Intergenic
1084432158 11:69117054-69117076 GGGGGCAGACAGAACACCCTGGG - Intergenic
1084529016 11:69715815-69715837 GAGGACAGAGTGATGAGCTTGGG - Intergenic
1087098907 11:94346739-94346761 GGGAGCAGAGATATGAGGTTGGG - Intergenic
1088289284 11:108219124-108219146 GCAGGCCGACAGAAGAGCTTGGG - Intronic
1089398275 11:118149830-118149852 GGGGCCAGTCATAAGAGCTTTGG + Intronic
1089682727 11:120128367-120128389 GGGAGCAGCAAGGTGAGCTTGGG + Intronic
1089775696 11:120834385-120834407 TGGGGCTGACAGGTGAGCTCAGG - Intronic
1090994395 11:131852229-131852251 GAGGACAGACAGATGATCTATGG + Intronic
1091253670 11:134165336-134165358 AGGGGCACACTCATGAGCTTGGG + Intronic
1091253796 11:134166201-134166223 GGGCACAGTGAGATGAGCTTAGG + Intronic
1091253837 11:134166494-134166516 GGGCACAGTGAGATGAGCTTAGG + Intronic
1091495078 12:965480-965502 GGAGGAGGACAGATGAGATTTGG - Intronic
1092027508 12:5254914-5254936 CGGGGCAGAGAGAGGAGCCTGGG + Intergenic
1092739500 12:11614306-11614328 GGGCGCAGAGATATGAGGTTGGG + Intergenic
1092789515 12:12059387-12059409 GGGTGCAGAGATATGAGGTTGGG - Intronic
1092789532 12:12059471-12059493 GGGAGCAGAGATATGAGGTTGGG - Intronic
1095379837 12:41577587-41577609 AGGGATAGACAGATGAGTTTAGG - Intergenic
1096429663 12:51532334-51532356 GGGAGCTCACAGATGAGCTGAGG - Intergenic
1096587781 12:52634329-52634351 GGAGGCAGACAAAGGAGCTATGG - Intergenic
1096605773 12:52765106-52765128 GAAGCCAGACAGATGACCTTTGG - Intergenic
1097049673 12:56214594-56214616 CGGGACAGGCAGATGAGCTGAGG + Intronic
1099188539 12:79541005-79541027 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1102595611 12:113990618-113990640 GGGGGGAGCCAGCTGGGCTTGGG - Intergenic
1104915568 12:132262682-132262704 AGGTGCAGACAGATGAGCTATGG - Intronic
1104915584 12:132262759-132262781 AGGTGCAGACAGATGAGCTATGG - Intronic
1105327831 13:19386435-19386457 GGGGGGAGTCAGGTGGGCTTTGG - Intergenic
1105864069 13:24443248-24443270 GGGGGGAGTCAGGTGGGCTTTGG + Intronic
1108692937 13:52876091-52876113 GTGAGCAAACAGATGAGCTGTGG - Intergenic
1108729228 13:53216183-53216205 GGAAGGAGACAGCTGAGCTTGGG + Intergenic
1111301813 13:86359248-86359270 GGGGGCAGAGATAAGAGGTTGGG - Intergenic
1111301850 13:86359416-86359438 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1112012665 13:95305000-95305022 GGAGGCAGACAGATCACCTGAGG + Intergenic
1112236636 13:97643327-97643349 GGGCGCAGAGATATGAGGTTGGG - Intergenic
1113133570 13:107063907-107063929 GGGGGTTCACAGAAGAGCTTGGG + Intergenic
1114069496 14:19096329-19096351 GTGGGCACACAGGTGAGCTGTGG - Intergenic
1114092766 14:19303674-19303696 GTGGGCACACAGGTGAGCTGTGG + Intergenic
1114826275 14:26084347-26084369 GGGTGCAGACAGATTATCTTAGG + Intergenic
1114826918 14:26092061-26092083 GGAGGTAGACAGAAGAGGTTAGG + Intergenic
1115214075 14:30997357-30997379 GGGGCCAGACAGAGGAGGTGTGG - Intronic
1115344108 14:32323778-32323800 GGGGCCAGATAGAATAGCTTTGG + Intergenic
1115638415 14:35313724-35313746 GGAGGCAGACAGATCACCTGAGG + Intronic
1116589998 14:46760507-46760529 AGGGGCAGAAAGATAAGGTTTGG - Intergenic
1117326067 14:54670144-54670166 GGGGCCAGACAGACTTGCTTGGG - Intronic
1118355539 14:65010556-65010578 GTGGGCAGACAGATGGGGTGGGG - Intronic
1118864703 14:69693796-69693818 GGGGTCAGACAGATGAATCTGGG - Intronic
1120438241 14:84504859-84504881 GGGCGCAGAGATATGAGGTTGGG + Intergenic
1120960542 14:90120725-90120747 GGGGGCAGAATGATGTGATTTGG - Intronic
1121107979 14:91293329-91293351 GGGGACAGGAAGGTGAGCTTTGG - Intronic
1122075598 14:99232780-99232802 GGGGCCAGACAGCTGGGGTTTGG - Intronic
1124632982 15:31347751-31347773 AAGGGCAGACAGAAGAGGTTGGG - Intronic
1125132686 15:36302422-36302444 GGGGGCAAAGAAATGATCTTGGG - Intergenic
1125289535 15:38130532-38130554 ACGGGCATACAGATGAGCTGAGG + Intergenic
1126347875 15:47716135-47716157 GGGGGCGGAAAGAACAGCTTTGG - Intronic
1127693489 15:61420749-61420771 AAGGGCAGGCAGATGAGGTTTGG - Intergenic
1127892696 15:63269295-63269317 TGGGGCAGAGAGAAGAGCCTAGG - Intergenic
1128614286 15:69097213-69097235 TGGTGCAGTCAGGTGAGCTTGGG - Intergenic
1128835748 15:70807842-70807864 GGGGGCAGGCAAGTGACCTTAGG - Intergenic
1130854892 15:87832219-87832241 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1131221814 15:90590790-90590812 AGGGGCAGAGAGTTGAGATTAGG + Intronic
1131757282 15:95578884-95578906 TGGGGTGGACAGATGAACTTTGG + Intergenic
1132517535 16:372806-372828 GGGGGCAGGCAGAGGTGCTGTGG - Intronic
1134278854 16:12800714-12800736 TGGAGCAGAAAGATGAGGTTGGG - Intronic
1135233790 16:20736496-20736518 GCAGGCAGACAGCTGAGCTGTGG + Intronic
1136512593 16:30748464-30748486 GGGGGCAGGCAGAGGAGCCAGGG - Exonic
1138438484 16:57020363-57020385 GAGGGCAGGCAGGTGAGCTGGGG - Intronic
1138759288 16:59522250-59522272 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1138804730 16:60079779-60079801 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1139689341 16:68629930-68629952 GAGGGCAGGCAAATGGGCTTTGG + Intergenic
1140480539 16:75260404-75260426 GGAGGCAGACGGATGAGGTCAGG + Intronic
1141986880 16:87585870-87585892 GAGGGGACACAGATGAACTTGGG - Intergenic
1142157201 16:88538000-88538022 GTGGGGAGACAGGTGGGCTTGGG - Intergenic
1203139458 16_KI270728v1_random:1751283-1751305 TGAGGCAGACAGATCAGCTGAGG + Intergenic
1143893724 17:10120960-10120982 GTGGGCACGCAGATGAGTTTCGG + Intronic
1144045787 17:11453335-11453357 GGTGGGAGACAGAAGAGCTCAGG - Intronic
1144181087 17:12753224-12753246 GGGGGCAAACTGATGTGCTGTGG - Exonic
1144764095 17:17723650-17723672 GGGGGGCGAGAGATGAGCTCGGG - Intronic
1146550197 17:33774128-33774150 AGGGGAAGAAATATGAGCTTGGG - Intronic
1148340812 17:46872479-46872501 GGAGGGAGACAGGTGAGCCTTGG - Intronic
1148469482 17:47884461-47884483 GGGGGCAGAGAGGAGAGCTCGGG - Intergenic
1148760171 17:49995581-49995603 GGGGGATGAGAGATGGGCTTAGG + Intergenic
1149557466 17:57584386-57584408 GCGGGCAGGCAGATGACCATCGG - Intronic
1150211016 17:63441510-63441532 AGGGGCGTGCAGATGAGCTTTGG + Intronic
1150640836 17:66948427-66948449 GGGGGCAGAGGGCTGTGCTTGGG - Intergenic
1151100817 17:71553466-71553488 AGGGGCAGACAGGTGAACTGAGG + Intergenic
1151362528 17:73597111-73597133 AGAGAAAGACAGATGAGCTTGGG - Intronic
1151578710 17:74965538-74965560 GGGGGAAGAGAGAACAGCTTGGG - Intronic
1155697189 18:28697691-28697713 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1156203072 18:34856205-34856227 TGGCTCAGAGAGATGAGCTTAGG - Intronic
1156498457 18:37541467-37541489 GGGGGCAGCCAGAGGAGCAATGG - Intronic
1157327380 18:46678906-46678928 TGGGGCAGTCAGCTGGGCTTAGG - Intronic
1160281623 18:77496041-77496063 GGGGAAAGACAAATGGGCTTTGG - Intergenic
1161084802 19:2329944-2329966 GGGGGCTGACAGAGCAGCTGGGG - Intronic
1161144207 19:2667680-2667702 GGAGGCAGGCAGATCAGCTGAGG + Intronic
1162740563 19:12771327-12771349 CAGGGCAGAAAGATGAGCTTGGG + Intronic
1162759771 19:12881661-12881683 TGGGTCAGACAGAAGAGCGTGGG - Intergenic
1162969051 19:14169375-14169397 GGGGGCAGTCAGATGGGTGTAGG - Intronic
1163177919 19:15577405-15577427 AGGGGCAGCCAGGTAAGCTTGGG - Intergenic
1165034254 19:33021724-33021746 GGGGGCACACACCTGAGCTTGGG - Intronic
1165264331 19:34647427-34647449 GGAGGGAGACAGAGGAGTTTAGG - Intronic
1166289189 19:41850820-41850842 GGGGCCAGGCTGAGGAGCTTGGG - Intronic
1166499106 19:43328062-43328084 GGGTGCAGACATAAGAGGTTGGG + Intergenic
1166678924 19:44755968-44755990 GGGGACAGACAGTAGAGCATAGG + Intronic
1168315566 19:55483411-55483433 GAGGGCAGCAGGATGAGCTTGGG - Exonic
927250173 2:20989738-20989760 GGGGGCACACAGAGGAGCTGAGG - Intergenic
927380846 2:22477345-22477367 AGGGGCAGAATGATGAGGTTTGG + Intergenic
927518071 2:23683390-23683412 GGGGGCAGGCAGATGAGGCAAGG + Intronic
928674859 2:33640455-33640477 TGGGGCAGATAAAGGAGCTTTGG - Intergenic
929480539 2:42303313-42303335 AGGGTCATACAGATGAGCTTTGG + Exonic
929561502 2:42959270-42959292 GGGGGCAGAGAGAGGATCTGAGG - Intergenic
932295656 2:70621629-70621651 GGGTGCAGAGATATGAGGTTGGG - Intronic
933012883 2:77089345-77089367 GGGTGCAGAGATATGAGGTTGGG - Intronic
934681239 2:96285457-96285479 GAGTGCAGACAGAGGAGCTAAGG + Intronic
936894115 2:117407378-117407400 GCGGGCAGAGAGATGTGCTTAGG - Intergenic
936931181 2:117790417-117790439 GAGGGCTGAACGATGAGCTTGGG - Intergenic
937220619 2:120341308-120341330 TGGGGCAGACAGAGGAGCTGAGG - Intergenic
937274070 2:120673086-120673108 GGGGCCAGACAGATGGGGGTGGG - Intergenic
938649713 2:133370112-133370134 GGGGGAAGACAGGAGACCTTAGG + Intronic
939999687 2:148954545-148954567 GGGGGCAGACCAATGTGGTTAGG + Intronic
940676009 2:156724809-156724831 GGGTGCAGAGATATGAGGTTGGG + Intergenic
941465003 2:165815069-165815091 TGGGGCAGACAGAGGAGGATGGG - Intergenic
942629247 2:177938230-177938252 AGTGGCAGAAATATGAGCTTAGG + Intronic
943835898 2:192513550-192513572 AGGAGCAGACAGATGATGTTTGG + Intergenic
945156131 2:206840055-206840077 GGGGAGAGAAAAATGAGCTTAGG - Intergenic
946306435 2:218859461-218859483 GGGGGGAGAAAGAGGAGCTGAGG - Intergenic
947303878 2:228721847-228721869 GAGGTCAGAGAGATGAGCATGGG - Intergenic
947960282 2:234230467-234230489 GGGAGAAGAGAAATGAGCTTGGG + Intergenic
948159855 2:235814767-235814789 GGAGGCAGACAGCAGAGCTGCGG + Intronic
1169103923 20:2977947-2977969 GGAGGCACAGAGATGTGCTTTGG + Intronic
1169936679 20:10891154-10891176 TGAGGCAGACAGATGACCTGAGG - Intergenic
1170363992 20:15580381-15580403 GGGGGCACACAGATGATCCCAGG - Intronic
1172132073 20:32662367-32662389 GGGGGCAGGCAGATCACCTGAGG + Intergenic
1173224050 20:41151570-41151592 GGTGGCAGCCAGATGTGCTCAGG + Intronic
1173324180 20:42017531-42017553 GGGAGCAGTCAGATGTGCTCAGG - Intergenic
1173835510 20:46122785-46122807 GGAGGGGGACAGAGGAGCTTAGG + Intronic
1175964487 20:62653656-62653678 GGGCCCAGAGAGATGACCTTGGG - Intronic
1177445021 21:21183476-21183498 GGGGGCAGCTAAATCAGCTTTGG + Intronic
1178518566 21:33268159-33268181 GGGGACAGACAAAGGAGCCTTGG - Intronic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1179333501 21:40428127-40428149 GGGTTAAGACAGATGAGCTTTGG - Intronic
1179584331 21:42365290-42365312 GGGCGCAGGCAGATGGGCCTGGG + Intronic
1180122700 21:45764641-45764663 GTGGGCAGGCAGCTGTGCTTAGG + Intronic
1180487965 22:15818892-15818914 GTGGGCACACAGGTGAGCTGTGG - Intergenic
1181786361 22:25230090-25230112 GGGGGTCCACAGATGAGCTTTGG + Intronic
1181818532 22:25457913-25457935 GGGGGTCCACAGATGAGCTTTGG + Intergenic
1182127881 22:27829376-27829398 GGGGGCAGGCATTTGAGCTGAGG + Intergenic
1183037412 22:35150677-35150699 GGGGCCAGAAATATGAGCTCTGG + Intergenic
1183503869 22:38197885-38197907 CGAGGCAGACAGATGACCTGAGG + Intronic
1184035863 22:41917789-41917811 GGGGGCAGGCAGAAGAGATAAGG - Intergenic
1184736822 22:46403738-46403760 GGAGGCAGACAGATCACCTGAGG + Intronic
1185173558 22:49306829-49306851 GTGGGCAGAAAGAGGGGCTTCGG - Intergenic
950473788 3:13203416-13203438 GTGGGCAGAGAGATGGGCTATGG - Intergenic
950491046 3:13305325-13305347 GGGGGCTGACAGATGAGCAGAGG - Intergenic
950686440 3:14621857-14621879 AGGTGCAGGCAGATGAGGTTTGG - Intergenic
955155893 3:56416301-56416323 GTAGGGAGACAGATCAGCTTTGG - Intronic
955549045 3:60063467-60063489 GAGGGAAGGCAGATGAGCTGTGG - Intronic
956402752 3:68897396-68897418 GGGGGCAGACACCTGAGATCAGG + Intronic
959972440 3:112422175-112422197 GGGCGCAGAGATATGAGGTTGGG + Intergenic
960708485 3:120504490-120504512 GGTGGCAGAAGGATGAGGTTTGG + Intergenic
961382923 3:126507818-126507840 GGGGGCAGACAGAGGGGCTGAGG + Intronic
961591063 3:127982362-127982384 GGGGCCAGACAGAGGAGGTGTGG - Intronic
961881082 3:130061694-130061716 GGGGTCAGTCAGAGAAGCTTGGG - Intergenic
962757525 3:138477371-138477393 GGTGGCAGCCAGAAGGGCTTTGG - Exonic
963274605 3:143317509-143317531 GGGGGCTGAAAGATGAGATTTGG + Intronic
964004233 3:151810136-151810158 TGGGGCAGATAGTTGGGCTTTGG - Intergenic
964655994 3:159066716-159066738 GGGGGCAGGCAGACCAGCTGTGG + Intronic
965626516 3:170688055-170688077 GGGTGCAGAGATATGAGGTTGGG + Intronic
966430357 3:179825648-179825670 GGAGGAAAACAGATGGGCTTTGG + Intronic
966869741 3:184282538-184282560 TGTGGCAGACAGCTGCGCTTGGG + Intronic
969501373 4:7555489-7555511 TGGGGTAGAGAGATGAGCTGAGG - Intronic
969511087 4:7618370-7618392 GAGGGCAGACAGAGGGGCTGGGG - Intronic
970240488 4:14003447-14003469 GGGGGCAGAATGATGTGGTTTGG + Intergenic
972834520 4:42853616-42853638 GTGGTCAGAAAGATAAGCTTTGG - Intergenic
973876618 4:55226394-55226416 GAGAGCAAATAGATGAGCTTAGG + Intergenic
975831478 4:78373543-78373565 GGAGGCAGACAGATCACCTGAGG + Intronic
975865312 4:78718647-78718669 GGGTGCAGAGATATGAGGTTGGG + Intergenic
977013110 4:91659243-91659265 GGGTGCAGAAATATGAGGTTGGG + Intergenic
977062696 4:92276135-92276157 GGGTGCAGAGATATGAGGTTGGG + Intergenic
980293198 4:130871313-130871335 GGGGGCAGAATGATGTGGTTTGG + Intergenic
980627503 4:135392043-135392065 GTGGGCAGACAGTTGGACTTTGG - Intergenic
980720137 4:136684927-136684949 GAGGGTAGACAGATGAGGTGAGG - Intergenic
982084137 4:151817199-151817221 GGGTGCAGAGATATGAGGTTGGG + Intergenic
982537671 4:156627016-156627038 GAGGGCAGAAAAATGAGCCTTGG - Intergenic
983659360 4:170117327-170117349 GGGTGCAGAGATATGAGGTTGGG - Intergenic
984375594 4:178924634-178924656 GGCAGCAGAGAGAAGAGCTTGGG + Intergenic
984961423 4:185101593-185101615 GGGGGCACACAGAAGGGCTCTGG + Intergenic
985848895 5:2374199-2374221 GTGGGCACACAGAGGGGCTTGGG - Intergenic
986552989 5:8979714-8979736 GGGGGCAGAGGGCAGAGCTTAGG - Intergenic
987256156 5:16153967-16153989 TTGGGCAGACAGATAAACTTAGG + Intronic
987293394 5:16528880-16528902 GTAAGCAGACAGATGAGCGTGGG + Intronic
990721871 5:58705702-58705724 GGGGGAAGACAAAAGTGCTTGGG - Intronic
990738258 5:58887532-58887554 TGGGGCAGAGACATGGGCTTGGG - Intergenic
990999501 5:61768698-61768720 GAGGGCAGAGAGAAGAGTTTCGG - Intergenic
994779203 5:104069200-104069222 GGGTGCAGAGATATGAGGTTGGG + Intergenic
994989345 5:106979409-106979431 GGGCGCAGAGATATGAGGTTGGG - Intergenic
995678198 5:114686972-114686994 GGTTGTAGATAGATGAGCTTAGG + Intergenic
995899603 5:117051204-117051226 GGGCGCAGAGATATGAGGTTGGG + Intergenic
996110190 5:119556428-119556450 GGGGCCTGACAGAGGAGCTGAGG + Intronic
997653342 5:135537711-135537733 GGGGGCAGAGAGAGGACCCTTGG - Intergenic
997908552 5:137844977-137844999 AGGGGCAGACAGAAGAGGTGAGG + Intergenic
999094576 5:148966520-148966542 GGCTGCAGACAGCTCAGCTTGGG + Intronic
1001331687 5:170766840-170766862 GGGTGCAGAGATATGAGGTTGGG + Intronic
1001412014 5:171518851-171518873 CGGGGCAGGGAGATGAGCTGGGG + Intergenic
1002078340 5:176723131-176723153 GCCGGCATACAGATGAGCGTGGG + Intergenic
1003330254 6:5123426-5123448 GGGGTCCTACAGAAGAGCTTAGG - Intronic
1004731681 6:18365653-18365675 GGTGGCAGACAAGAGAGCTTGGG - Intergenic
1004768799 6:18758858-18758880 GGGCGCAGAGATATGAGCTTGGG + Intergenic
1005486353 6:26304054-26304076 GCGGGCAGACACATGAGGTCAGG - Intergenic
1007133083 6:39495265-39495287 TGGGGCAGACACATGATGTTGGG + Intronic
1007758276 6:44115349-44115371 GGAGGCAGTGAGATGAGTTTGGG - Intronic
1008543317 6:52564505-52564527 TGGGGCAGGCAGATGTGCTGGGG - Intronic
1008712681 6:54247733-54247755 GTTGGCAGGCAGATGAGCTAAGG - Intronic
1008972381 6:57384607-57384629 AGGGGCAGACACATGATCTTAGG - Intronic
1009161291 6:60286131-60286153 AAGGGCAGACACATGATCTTAGG - Intergenic
1011883442 6:92060092-92060114 GGGGGCAGAATGATGTGGTTTGG + Intergenic
1014557482 6:122851952-122851974 GGTGGCAGACATATGCCCTTAGG - Intergenic
1015165013 6:130193320-130193342 GGGAGCAGAGATATGAGGTTGGG - Intronic
1015538904 6:134295270-134295292 GGGGGCAGAGAGCTGAGCCAGGG + Intronic
1017248339 6:152252035-152252057 GGAGGCAGGCAGATGACCTGAGG + Intronic
1017487336 6:154915423-154915445 TGGGGCAGGCAGATGACCTGAGG + Intronic
1018091634 6:160350587-160350609 GAGGGCAGACAGCTGATTTTTGG + Intronic
1019496509 7:1342883-1342905 GTGGACACACAGATGAGATTTGG - Intergenic
1019703842 7:2488142-2488164 GGGGTCAGAGGGATGAGCCTCGG + Intergenic
1020154940 7:5715254-5715276 GGTGGCAGAGAGATGAGGATGGG - Intronic
1020316084 7:6906206-6906228 GGGGTCAGTCAGAGAAGCTTGGG - Intergenic
1021886478 7:25144631-25144653 GGAGGGAGACAGAGGAGCATGGG + Intronic
1022406340 7:30093748-30093770 TGCGGCAGGCAGCTGAGCTTAGG - Intronic
1023699074 7:42875226-42875248 GGGCGCAGAGATATGAGGTTGGG + Intergenic
1023793275 7:43770619-43770641 GGGGGCAAACAGGTGAGCAGGGG - Intronic
1023817364 7:43961383-43961405 GGGGGAGGACAGAGGACCTTGGG + Intergenic
1026064508 7:67058418-67058440 GGGGGCGGACAGAGTTGCTTGGG + Intronic
1026387433 7:69864087-69864109 GAAGGCAGACAGATGTACTTGGG - Intronic
1026938959 7:74275627-74275649 GGTGGCAGCCAGCTCAGCTTGGG - Intergenic
1027851736 7:83460652-83460674 GGGCGCAGAGATATGAGGTTGGG - Intronic
1029741989 7:102496257-102496279 GGGGGAGGACAGAGGACCTTGGG + Intronic
1029759978 7:102595422-102595444 GGGGGAGGACAGAGGACCTTGGG + Intronic
1029874555 7:103736003-103736025 GGGTGCAGACACATTATCTTTGG - Intronic
1032472897 7:132191107-132191129 GGAAGCAGACAGAGGAGCCTGGG + Intronic
1032609397 7:133395408-133395430 GGAGGCAGCCAGAAGAGCTTGGG + Intronic
1033676147 7:143541865-143541887 GGGCGCAGAGATATGAGGTTGGG + Intergenic
1034702273 7:153106806-153106828 GGATGCGGACAGCTGAGCTTGGG + Intergenic
1035925097 8:3719644-3719666 TAGGGCGGTCAGATGAGCTTGGG + Intronic
1035980255 8:4362339-4362361 GGGGGCAGACAGATGAGCTTGGG - Intronic
1036759488 8:11497446-11497468 GGGGACACACAAATGGGCTTGGG - Intronic
1037909955 8:22738373-22738395 GGGGTCAGACAGAGGATCCTGGG + Intronic
1037928725 8:22865103-22865125 GGGGGTAGACAGAAGGGCTGGGG + Intronic
1039473481 8:37827466-37827488 GGGGGCAGAGAGTTGTGCCTAGG + Intronic
1039928521 8:41961217-41961239 GGAGGCAGACAGATGTGGGTGGG - Intronic
1040550633 8:48434645-48434667 TGGGGCAGATAGAGGAGCCTGGG + Intergenic
1041248452 8:55911662-55911684 GGGGGCAGTCCTATGAGCTGCGG + Intronic
1043027676 8:75091338-75091360 GGGGGGAGACTGATGAGAATTGG - Intergenic
1043240275 8:77924783-77924805 GGAGGCAGACAGATCACCTGAGG + Intergenic
1044939054 8:97321919-97321941 TGGGGCAGAGGGATGAGCTCTGG + Intergenic
1044978411 8:97690221-97690243 GGGGGCAGGCAGATGACCTGAGG - Intronic
1045197281 8:99944744-99944766 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1045950079 8:107841566-107841588 GGGGGCAAACATATGGGATTTGG - Intergenic
1048097404 8:131311174-131311196 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1048819669 8:138369311-138369333 GGGGGCAGTAAGAGGGGCTTTGG - Intronic
1049148542 8:141019685-141019707 GGGGGCAGAGAGAAGAGCTGGGG - Intergenic
1055366338 9:75548706-75548728 GAGGGAGGACAGATGAACTTGGG - Intergenic
1055440549 9:76332129-76332151 GGTGGGACACAGATGAGATTTGG + Intronic
1055468592 9:76589933-76589955 GGGGGAAGACAAAGGATCTTGGG + Intergenic
1055809833 9:80138343-80138365 GGGTGCAGAGATATGAGGTTGGG - Intergenic
1056437415 9:86587906-86587928 TGGGGCACAGAGATGAGGTTGGG + Intergenic
1056522239 9:87411940-87411962 GGGCGCAGAGATATGAGGTTGGG - Intergenic
1056693478 9:88827367-88827389 GTGGGCAGATAGAGGGGCTTGGG + Intergenic
1056958825 9:91104045-91104067 GGGGGCACAAAGATGGCCTTGGG + Intergenic
1057075454 9:92135995-92136017 TGGGGCACACAGAAGACCTTGGG + Intergenic
1059682899 9:116603854-116603876 GGAGGGAGAAAGATCAGCTTGGG + Intronic
1059733647 9:117080730-117080752 TAGAGCAGAGAGATGAGCTTAGG + Intronic
1060640891 9:125237867-125237889 GGAGGCAGGCAGATGACCTGAGG + Intronic
1061569628 9:131469099-131469121 GGAGGCAGACAGATCACCTGAGG + Intronic
1062107226 9:134762362-134762384 GGTGGCAGAAAGCTGAGATTTGG + Intronic
1062724189 9:138062093-138062115 AGAGGCAGACAGATGGGCCTTGG - Intronic
1185604267 X:1358704-1358726 GGGGGCAAAATAATGAGCTTAGG - Intronic
1187400607 X:18956614-18956636 GGGGACAGACAGTATAGCTTTGG - Intronic
1192214063 X:69145692-69145714 GGGCCCAGACAGATAAGCTTGGG - Intergenic
1192227994 X:69242559-69242581 GGCAGCAGGCAGATGAGCTCAGG + Intergenic
1195759031 X:108226360-108226382 GGGGGCAGAGATGTGTGCTTGGG + Intronic
1195925200 X:110017799-110017821 GGAGGCAGACAGATCACCTGAGG - Intronic
1197984820 X:132256215-132256237 GAAGGCAAACAGATGAGGTTAGG + Intergenic
1198599571 X:138268912-138268934 GGGTGCAGAGATATGAGGTTGGG + Intergenic
1200119847 X:153785056-153785078 GTGGGCAGAAAGAGGAGGTTGGG - Intronic