ID: 1035980667

View in Genome Browser
Species Human (GRCh38)
Location 8:4367264-4367286
Sequence CTGTCTAGACTCATGCAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035980667_1035980669 4 Left 1035980667 8:4367264-4367286 CCAGACTGCATGAGTCTAGACAG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1035980669 8:4367291-4367313 CCCAGCTCCATTTTTTAAATAGG No data
1035980667_1035980671 5 Left 1035980667 8:4367264-4367286 CCAGACTGCATGAGTCTAGACAG 0: 1
1: 0
2: 2
3: 6
4: 81
Right 1035980671 8:4367292-4367314 CCAGCTCCATTTTTTAAATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035980667 Original CRISPR CTGTCTAGACTCATGCAGTC TGG (reversed) Intronic
902116296 1:14124389-14124411 CTCTCTAGCCTCATGCAGCCTGG + Intergenic
907787522 1:57627142-57627164 CTGTCCCGGCTCAAGCAGTCGGG - Intronic
911693224 1:100859013-100859035 CTGGCTAAACTCAGGCAGTCTGG + Intergenic
915795157 1:158723918-158723940 CTGTCTAGACTTATACAGGTGGG - Intergenic
917405990 1:174709116-174709138 CTCTCTAGATTCATGCTCTCTGG + Intronic
917590969 1:176476568-176476590 CTGCCTAGACTCAAGAACTCTGG + Intronic
921444327 1:215227173-215227195 CTCTCTAGTGTCATGAAGTCAGG + Intronic
924589279 1:245387806-245387828 CTATGTAGACTCATGGAGTTTGG + Intronic
1076939255 10:133590719-133590741 CAGTCTAGTCCCATGCAGTGGGG - Intergenic
1083006922 11:59355505-59355527 CTGTCTTGACTCAGGCAGGGTGG + Intergenic
1087269378 11:96096001-96096023 CTGTCTATCCTCATGGGGTCAGG + Intronic
1087834929 11:102863804-102863826 CAGCCAAGACTCAGGCAGTCTGG - Intronic
1087841695 11:102927402-102927424 CTGGCTAGACATATACAGTCTGG - Intergenic
1088234850 11:107712051-107712073 CTGTCTGGACTCCTGGACTCTGG + Exonic
1091277881 11:134364585-134364607 CTGTGTAGGCTGATGCAGTGTGG + Intronic
1091643632 12:2256483-2256505 CTGTCTAGCTTCATGCTGTTTGG + Intronic
1094379319 12:29825889-29825911 CTTCCTAGACTCATGTATTCTGG - Intergenic
1096089219 12:48887405-48887427 CTGTCTGAACCCAGGCAGTCTGG - Intergenic
1100063407 12:90609647-90609669 CTGGGTACACTCATGCATTCAGG - Intergenic
1102381160 12:112468009-112468031 CTGTTTAGACTCCTGCAGTCAGG + Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1110329223 13:74251854-74251876 CTGTCTTAAGTCATGCAGCCTGG - Intergenic
1115645204 14:35364445-35364467 CAGTCTAGACTGGTGCAGTCAGG - Intergenic
1115648376 14:35385564-35385586 CTGTCTAGACCCATCCAGGCAGG + Intergenic
1121574239 14:94970257-94970279 CTGTCCAGATACAGGCAGTCGGG + Intergenic
1123102681 14:105816295-105816317 CAGTCTGGCCCCATGCAGTCTGG + Intergenic
1127365268 15:58283852-58283874 CTGTAGGGACCCATGCAGTCAGG + Intronic
1135685704 16:24496877-24496899 CTCTCTAGAGTTATGCAGTGCGG + Intergenic
1136625616 16:31460051-31460073 CTCTCTAGACCCGGGCAGTCTGG + Intronic
1137241861 16:46662209-46662231 CTGTCTGCTATCATGCAGTCAGG + Intronic
1138265872 16:55659048-55659070 CTGTCTAGAGACAAGCAGTCTGG - Intronic
1140786917 16:78351388-78351410 CTGGCTAAACCAATGCAGTCGGG - Intronic
1142275639 16:89117511-89117533 CTGTCTACACCCAGGGAGTCAGG + Intronic
1147359076 17:39920148-39920170 CTGACTATACTCTTGCAGGCTGG + Intergenic
1147657516 17:42099037-42099059 GTGGCTAGACTCACGGAGTCAGG - Intergenic
1149397043 17:56255437-56255459 CTCTTTAGACTCAGGCAGTGTGG + Intronic
1156600750 18:38603107-38603129 ATGTCTTGGCTAATGCAGTCAGG + Intergenic
1157698310 18:49742777-49742799 CTGACTAGACAAAAGCAGTCAGG + Intergenic
1158383185 18:56958633-56958655 CTGTAAAGACTCCTGGAGTCTGG - Intronic
1165490052 19:36118111-36118133 CTCTCTAGAGTCATGTAGACTGG - Intronic
926424818 2:12731242-12731264 CTGGCTTGACTCATGCCTTCTGG - Intronic
929755260 2:44758908-44758930 CTGAGTAAACTCATGCTGTCTGG - Intronic
931160556 2:59685756-59685778 CTTTCCAGACTCTTGCAGCCTGG + Intergenic
936335616 2:111586556-111586578 CTGTCTAGGATCCTGCTGTCAGG + Intergenic
939048175 2:137274525-137274547 CTGTCCTGACTTATGCAGCCTGG + Intronic
946533670 2:220603710-220603732 TTGTCTTGTCTCATGCATTCAGG + Intergenic
947482010 2:230509496-230509518 CAGTCAAGGCTGATGCAGTCTGG + Intronic
1174777560 20:53359255-53359277 CTGTCTAGGGTCAGGCAGACTGG + Intronic
1177064025 21:16406894-16406916 TTTTATAGACTCATGCAGTGGGG + Intergenic
1180904323 22:19398031-19398053 CTGGCTAGCCTCATGCAGCGTGG - Exonic
950450088 3:13060546-13060568 CTCTCTGGACTCATGCTGTCTGG + Intronic
951746916 3:25988515-25988537 CTCTCCAGACTCATGGAGTATGG - Intergenic
955080233 3:55651323-55651345 CTCTCTGGACTCATACAATCAGG + Intronic
961021776 3:123513609-123513631 CTCTCCAGACTCCTTCAGTCTGG - Intronic
962400851 3:135057537-135057559 CTCTATAGAGTCAGGCAGTCTGG + Intronic
970025002 4:11614460-11614482 AGGTCTAGACTCATGAACTCTGG + Intergenic
972715093 4:41637790-41637812 GTGTGTACACTCATGCATTCTGG + Intronic
976348149 4:84029104-84029126 CTCTCTATACTTACGCAGTCTGG - Intergenic
978562303 4:110046069-110046091 CTGTCTAGACATATTCAGGCAGG - Exonic
982418983 4:155171609-155171631 CTGCCTGGACTCAAGCAGTGTGG - Intergenic
987047874 5:14124452-14124474 CTCTCTAGCCTGCTGCAGTCTGG - Intergenic
988658584 5:33239334-33239356 GTGCCGAGACTCATGCAGCCAGG - Intergenic
993690587 5:90995422-90995444 CTCTCTAGACTCATATAGCCTGG - Intronic
994122465 5:96131955-96131977 CTTTCTAGACTTATCCAGTTGGG - Intergenic
996511264 5:124318782-124318804 GTGTCTCAACTCAAGCAGTCAGG + Intergenic
996531142 5:124528415-124528437 CTGTCTAGGCTGGTGCATTCAGG - Intergenic
1007233136 6:40365268-40365290 GTGTTTAGATTCATGCAGTGTGG - Intergenic
1008808751 6:55466048-55466070 TTGTCTAGAATCTTACAGTCTGG - Intronic
1014391935 6:120873952-120873974 CTGTGTAAACTCATGCTTTCTGG + Intergenic
1016794010 6:148098250-148098272 CTCTCTAGTCTCCTTCAGTCTGG - Intergenic
1022395029 7:29979972-29979994 CAGGCTAGACCTATGCAGTCAGG + Intronic
1023935708 7:44738310-44738332 CTGTATAAACACATGCAGTGGGG + Intergenic
1028930047 7:96403013-96403035 CTGTCCCAGCTCATGCAGTCAGG - Intergenic
1035980667 8:4367264-4367286 CTGTCTAGACTCATGCAGTCTGG - Intronic
1037708934 8:21340048-21340070 CTCTCTAGAATCCTTCAGTCTGG - Intergenic
1046524188 8:115363052-115363074 CAGTTTAGACTGATGCAGTGTGG - Intergenic
1046672905 8:117077094-117077116 CTGTTTACACTCATGCAAACTGG + Intronic
1048572692 8:135668639-135668661 CTGCCCCGACTCATGCAGACAGG + Intergenic
1052213423 9:25935154-25935176 TTGTCAAGGCTCATGGAGTCTGG + Intergenic
1185516485 X:702720-702742 CTTTCCAGATTCCTGCAGTCAGG + Intergenic
1188153159 X:26704391-26704413 TTGACTAGACTCATGTAGGCCGG - Intergenic
1192896607 X:75448998-75449020 ATGTCTCAGCTCATGCAGTCAGG - Intronic
1193442413 X:81558921-81558943 CTGTAAAGACACATGCAGACTGG + Intergenic
1194463361 X:94200354-94200376 CTATCTCAACTCATGCAATCAGG + Intergenic
1195556030 X:106225347-106225369 CTTTATATAATCATGCAGTCAGG - Intergenic
1195844038 X:109207367-109207389 CCGTCTAGAATCATGAAGACAGG - Intergenic
1196246922 X:113411357-113411379 TTGTGTAAACTCATGCATTCAGG + Intergenic
1198021121 X:132658893-132658915 CTGGCTAGGCCCATGCAGTATGG - Intronic
1200304840 X:155013860-155013882 CTCTCTACACTCATGCACTGAGG - Intronic
1201417999 Y:13767221-13767243 CTGTTTAGACTCATGTAGTCTGG - Intergenic