ID: 1035988108

View in Genome Browser
Species Human (GRCh38)
Location 8:4456909-4456931
Sequence CAGGATAAACAGTTGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 187}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035988108_1035988115 22 Left 1035988108 8:4456909-4456931 CCACCCACCAACTGTTTATCCTG 0: 1
1: 0
2: 1
3: 16
4: 187
Right 1035988115 8:4456954-4456976 ACAAGAGATTTTGATGAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035988108 Original CRISPR CAGGATAAACAGTTGGTGGG TGG (reversed) Intronic
901573429 1:10180492-10180514 CAGGATTAACACTTGGTAGCAGG - Exonic
902252415 1:15163032-15163054 CACACTAAAAAGTTGGTGGGTGG + Intronic
902403854 1:16172545-16172567 CAGGAGAAACAGTAGGGTGGAGG - Intergenic
903154695 1:21435846-21435868 CAGGTCACACAGTTGATGGGAGG - Intergenic
903503278 1:23814092-23814114 CAGGATAAGAAGTTTGTGGCAGG + Intronic
903610853 1:24611093-24611115 CAAAAAAAAAAGTTGGTGGGGGG + Intergenic
903800269 1:25961992-25962014 CAGGCTGGACAGATGGTGGGGGG + Exonic
906800756 1:48734985-48735007 CAGGTTATACAGCTAGTGGGAGG - Intronic
907829147 1:58047782-58047804 CCGGATAAACAGTTGTTGACTGG - Intronic
907898834 1:58718958-58718980 CAGGAAATACAGTTTGTAGGTGG - Intergenic
908981771 1:69967415-69967437 GGGGAGAAACAGGTGGTGGGTGG - Intronic
909056428 1:70826320-70826342 CAGGTCACACAGTTTGTGGGTGG + Intergenic
909795633 1:79732088-79732110 CAGGAAAAACAGTTGAGGGGGGG + Intergenic
911086403 1:93980952-93980974 CAGAGTAATAAGTTGGTGGGTGG - Intergenic
912152522 1:106878079-106878101 CTGGACAAACAGTTAGTGGAGGG - Intergenic
913283797 1:117209657-117209679 CAGGAGAAGCAGTGGGTGGCAGG - Intronic
914964089 1:152237704-152237726 CAGGAGAAAGAGATGGGGGGAGG - Intergenic
915946123 1:160152939-160152961 CAGGAGAAACACCTGTTGGGAGG + Intronic
915954575 1:160211286-160211308 CAGAAGAAAAAGATGGTGGGGGG + Intronic
917390397 1:174530060-174530082 CAGGATGCTCAGCTGGTGGGAGG + Intronic
918626912 1:186666462-186666484 CAAGATTAGCAATTGGTGGGAGG - Intergenic
918680881 1:187351442-187351464 CAGGATCAACATTTTTTGGGGGG - Intergenic
921124004 1:212160925-212160947 TAGGGTAAAAAGTTGGTAGGGGG - Intergenic
921477842 1:215631937-215631959 CAGTAGAAACAGGTGGTGGGAGG - Intronic
921759408 1:218895693-218895715 CAGGAATAACAAGTGGTGGGTGG + Intergenic
922937856 1:229434809-229434831 CAGGATAGACAACTGGCGGGGGG + Intergenic
924359587 1:243223549-243223571 CACCATAAGCAGTTGGAGGGCGG - Intronic
1063636172 10:7785276-7785298 CAGGTTAAACATTTGCAGGGAGG - Intronic
1064005181 10:11693680-11693702 CAGGAGGAACAGCTGGTGTGAGG - Intergenic
1065465911 10:26021698-26021720 CATGATGAACACTTGGTGGCTGG - Intronic
1066806962 10:39266633-39266655 CAGGATAAAAAGTAGATGGAAGG - Intergenic
1068949361 10:62761797-62761819 CAGGTTAAACAATTGCTGGGGGG + Intergenic
1070112527 10:73498877-73498899 CAGGATGAACAATGGGAGGGTGG + Exonic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1071795835 10:89004518-89004540 AAGTATAAACAGTGGGTTGGGGG - Intronic
1071811426 10:89185962-89185984 CAACATAAACAGTAAGTGGGAGG - Intergenic
1072720767 10:97779735-97779757 ATGGATGAATAGTTGGTGGGAGG + Intergenic
1074125469 10:110525638-110525660 CAGGATGTTCAGGTGGTGGGAGG + Intergenic
1074271586 10:111958961-111958983 CAGGATAAATATTTGTTGTGGGG - Intergenic
1075449274 10:122537606-122537628 CAGGAGAATCACTTGATGGGAGG + Intergenic
1076547185 10:131253228-131253250 CAGGAATGACAGCTGGTGGGTGG + Intronic
1077128666 11:957715-957737 CAGGGCAAACAGTTGTTGGTAGG - Intronic
1077760510 11:5090847-5090869 CATGATAAACAGGTGATGGGAGG - Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1085258172 11:75188923-75188945 CAGGCTCAGCAGTGGGTGGGAGG - Intronic
1090330080 11:125924576-125924598 CAGGTTAGAAAGTTGCTGGGTGG - Intergenic
1093467160 12:19461110-19461132 CATGATAAAAACTTGGCGGGAGG + Intronic
1093816396 12:23553738-23553760 CAGGATGTCCAGTTGGTGGGAGG + Intronic
1095054014 12:37579370-37579392 AAGGATAAACCGGCGGTGGGGGG - Intergenic
1095940984 12:47726636-47726658 CAGGTTGAACAGTTGCTGGTGGG + Intergenic
1098752799 12:74317227-74317249 CATGATAAGCAGCTGGTGTGAGG - Intergenic
1100729329 12:97446669-97446691 CAGGCTAAATAGTTGCTAGGTGG - Intergenic
1101378332 12:104190274-104190296 CAGGATTTATAGGTGGTGGGTGG + Intergenic
1101434800 12:104655420-104655442 CAGGATAAAGGGATGCTGGGGGG - Intronic
1102782906 12:115580903-115580925 AAAGACACACAGTTGGTGGGAGG + Intergenic
1103560769 12:121792367-121792389 CAGGAGAAACAGTCAGTGGGAGG - Intronic
1104172569 12:126296415-126296437 AAGGTTACACAGCTGGTGGGTGG + Intergenic
1105600748 13:21884842-21884864 CAGGACAAACAGGAGGGGGGTGG + Intergenic
1106399531 13:29416006-29416028 CAGGAGAATCACTTGATGGGAGG - Intronic
1106879562 13:34114533-34114555 AAGGATAAAGAGTTGGTGTCTGG + Intergenic
1110955610 13:81549251-81549273 CAGGAGAAACAGTGAGAGGGGGG + Intergenic
1111930713 13:94510309-94510331 CAGGATGATCACTTGGTGGTAGG - Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1113399168 13:109975592-109975614 CAGAATTAGCAGTTGGTGGTGGG + Intergenic
1114630328 14:24155384-24155406 CAGGATGCAGAGGTGGTGGGTGG - Intronic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1116467937 14:45254596-45254618 AAGGAAAAACAGTTGGAGGTAGG + Intergenic
1117243795 14:53862842-53862864 CTGAAAAAAAAGTTGGTGGGTGG - Intergenic
1117497254 14:56318022-56318044 CAGGATGAACAGTTCCTGGTGGG - Intergenic
1125209477 15:37196628-37196650 CATGGAAAAGAGTTGGTGGGTGG + Intergenic
1125469334 15:39987137-39987159 GAGGATAAACAGTGGTTTGGGGG - Intronic
1128779778 15:70351755-70351777 CAGAAGAAACAGTAGGTGTGTGG - Intergenic
1129672483 15:77614945-77614967 CAGGAGATCCAGCTGGTGGGCGG - Exonic
1129749498 15:78051139-78051161 CATGATAAGCAGTTTGTGGCTGG - Intronic
1131120901 15:89822956-89822978 CAGGAAGAGCAGTTGGTGGCGGG + Intergenic
1132864670 16:2087472-2087494 CAAGACAACCAGTTGGGGGGGGG + Intronic
1136894289 16:33987761-33987783 CAGGACACACACTCGGTGGGTGG + Intergenic
1138549478 16:57739786-57739808 CAGTATAATCAGATGGTGGTGGG - Intronic
1139723694 16:68878390-68878412 CAAAATAAAAAGTTGGGGGGAGG - Intronic
1140192533 16:72830053-72830075 CTGGGTAAACAGTTGGTATGAGG + Intronic
1140226902 16:73085349-73085371 CAGGAGAATCACTTGCTGGGAGG - Intergenic
1141045979 16:80716474-80716496 CTGGATGAACAATGGGTGGGTGG + Intronic
1141455601 16:84139642-84139664 AAGGATAAACAGTGGGAGGAAGG + Intronic
1142244761 16:88964981-88965003 ATGGATAAATAGATGGTGGGTGG - Intronic
1142624613 17:1183792-1183814 CTGAATACACAGTGGGTGGGAGG + Intronic
1142941048 17:3380024-3380046 CAGGCTAATCAATTAGTGGGTGG + Intergenic
1143040692 17:4034035-4034057 CAGGCTAAAGAGCAGGTGGGTGG + Exonic
1146639431 17:34528848-34528870 CATGTTAAACACTTGGTGTGGGG - Intergenic
1146786679 17:35727319-35727341 TAGGAAAAACACTTGGTGAGAGG + Intronic
1147321100 17:39646689-39646711 CAGGACAAACAGGAGGTGGCTGG - Intronic
1148825194 17:50387945-50387967 CATGAAGAACAGTTAGTGGGCGG - Intronic
1149688047 17:58549781-58549803 CAGGGTAAGCTGTTGGTGGAAGG + Intergenic
1151003213 17:70402156-70402178 CAGGATGACCGGCTGGTGGGAGG - Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151819833 17:76491419-76491441 CAGGGCAATCAGTTGGGGGGGGG + Intronic
1156008279 18:32469564-32469586 CAGAATAAACAGTTGGAGGAAGG + Intronic
1161058046 19:2200447-2200469 CAGGACAAACAGGTGGCGGTGGG - Intronic
1161287677 19:3477303-3477325 GATGATAGACAGATGGTGGGTGG + Intronic
1163618111 19:18341366-18341388 GAGGAGAAACAGTTGGTTTGGGG - Intronic
926634494 2:15165439-15165461 TGGGGTAGACAGTTGGTGGGAGG + Intergenic
926706226 2:15839667-15839689 CAGGATAAACAAATGGTGCATGG + Intergenic
928795028 2:35007773-35007795 CAGGATAAACAGGTGAAAGGAGG + Intergenic
931415825 2:62079305-62079327 CAGGATAAAAAGATCATGGGGGG + Intronic
933601346 2:84334555-84334577 CAGGGGAAAGAGTTGGTGGGGGG + Intergenic
935064880 2:99638756-99638778 CAGGAAAAACAGGCGGTGGGGGG - Intronic
935617730 2:105103133-105103155 CAGGAAGAAAAGTTGATGGGAGG + Intergenic
940802184 2:158145096-158145118 TAGGAGTAACAGGTGGTGGGCGG - Intergenic
941182217 2:162273310-162273332 CATGATAAAATGTTGGTTGGGGG - Intronic
944821435 2:203436175-203436197 CAGGATATGCCTTTGGTGGGTGG + Exonic
1172402523 20:34662070-34662092 TTGGAAAAACAGTTGGCGGGGGG - Intronic
1173834349 20:46115492-46115514 CATGACAAAGAGTTGGTGGCAGG - Intergenic
1175211766 20:57362683-57362705 CAGGATGAACTGGTGCTGGGTGG + Intronic
1175218213 20:57402544-57402566 CAGGGGACACACTTGGTGGGTGG + Intronic
1175743402 20:61436267-61436289 CAGGATACCCAGTTGGTGTCTGG - Intronic
1178378240 21:32086114-32086136 GAGGATAAACAGCAGGTGGGAGG - Intergenic
1181430559 22:22879120-22879142 CTGGATTAACATTTGATGGGTGG + Intronic
1181531509 22:23520124-23520146 GAAGATGAACACTTGGTGGGAGG - Intergenic
1182907466 22:33950437-33950459 CAGGATCACCAGTGGATGGGGGG + Intergenic
1183554799 22:38516781-38516803 CAGGTTAAACAGTTGAGGAGTGG + Intergenic
950034755 3:9877328-9877350 CAGGATTAGCAGGTGATGGGGGG - Intronic
950436882 3:12985497-12985519 CAGGGCAAACGGTTGGCGGGGGG - Intronic
951050132 3:18084753-18084775 CAGGGTAAAATGTTGGAGGGAGG + Intronic
951075118 3:18381519-18381541 CAGGTTAAACAATTTGTTGGTGG + Intronic
951488804 3:23245885-23245907 CAGGTCAAATAATTGGTGGGAGG - Intronic
952843502 3:37667816-37667838 CAGGAGAAACACCTGGTGGGAGG + Intronic
956603606 3:71049629-71049651 CAGGAAAAAAAGGGGGTGGGGGG + Intronic
959767438 3:110048382-110048404 CAGGAGAGGCACTTGGTGGGAGG + Intergenic
960999926 3:123367357-123367379 CAGGAGAAGCAGTTTGTGGGTGG - Intronic
961753440 3:129111568-129111590 CAGGATCAACATCTGATGGGAGG - Intronic
962386135 3:134934063-134934085 AAAGATAAAGAGTGGGTGGGAGG - Intronic
962414941 3:135173472-135173494 CTGGAAAAGCAGTGGGTGGGAGG - Intronic
962625390 3:137220796-137220818 CATGAGAAACAGTTGGCAGGAGG + Intergenic
966439273 3:179925993-179926015 CAGGAGAAACATTTGGAGGGGGG - Intronic
967289370 3:187904138-187904160 CAACATATACAGTTGGTGGTGGG + Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
970406094 4:15765796-15765818 CAGGATAAAGACTTGGGGGAAGG - Intergenic
971181404 4:24331409-24331431 CAGGATAAGGAGATGGTGAGTGG - Intergenic
971889995 4:32507705-32507727 CAGGGTAGGCACTTGGTGGGAGG - Intergenic
975215426 4:71748320-71748342 CAAGAAAGACAGGTGGTGGGGGG + Intronic
982743940 4:159086830-159086852 CTGGAAAAACAGCTGGTGTGTGG + Intergenic
983024903 4:162724518-162724540 CAGGGTAAACAGATGGGGGCTGG - Intergenic
983920379 4:173337584-173337606 CAACATAGAAAGTTGGTGGGAGG - Intergenic
983946703 4:173594110-173594132 CAGGAGAAAGAGTTGGGGGTGGG + Intergenic
985804227 5:2029382-2029404 AAGAATAAAAAGTGGGTGGGGGG - Intergenic
987308550 5:16661022-16661044 TAGGATAGACACATGGTGGGAGG + Intergenic
990499952 5:56386133-56386155 CAGTACAATCAGTTGGTGAGTGG + Intergenic
990621167 5:57560408-57560430 CAGGATAATCACTTATTGGGTGG + Intergenic
990781028 5:59363553-59363575 CAGGAAAAACAATTGGTGTCAGG + Intronic
996197835 5:120631805-120631827 CAGGATTCTCAGGTGGTGGGTGG - Intronic
996533590 5:124552147-124552169 CAGGAAATACAGTTGGTGCTGGG - Intergenic
997460712 5:134050464-134050486 CAGAGGAAACAGTTGCTGGGGGG - Intergenic
998390549 5:141784461-141784483 TAGGATAGACAGGTGCTGGGAGG - Intergenic
998569885 5:143247578-143247600 CTAGATAGACAGTAGGTGGGTGG + Intergenic
998585051 5:143418706-143418728 AAGGGTAAACAGTTGGTGCTGGG + Intronic
999092745 5:148951938-148951960 CAGGTTACCCAGCTGGTGGGTGG - Intronic
999510866 5:152250475-152250497 CAGGGTAAGCGGGTGGTGGGAGG - Intergenic
1000948374 5:167450004-167450026 TAAGGTATACAGTTGGTGGGTGG + Intronic
1001462867 5:171933692-171933714 CAGGATAAGCAGGTGATGGTGGG - Intronic
1001702687 5:173718781-173718803 CATGACAAAGAGTTGGTGGGTGG + Intergenic
1003311069 6:4970438-4970460 GAGGATAAACAGTTTGAGAGAGG + Intergenic
1004189070 6:13448383-13448405 GAGGATAAACAATTGGGAGGAGG - Intronic
1004950716 6:20668107-20668129 CAGGATACACAATTGGAGGAAGG - Intronic
1008805131 6:55417534-55417556 TGGGATCAACAGTGGGTGGGAGG + Intergenic
1011763623 6:90594900-90594922 GAGGATAAAGAGATGATGGGAGG + Intergenic
1012159037 6:95859764-95859786 AAGGATAAACAGGTGGCTGGTGG + Intergenic
1013352622 6:109319189-109319211 CAAGATAAATAGTAGGTAGGTGG - Intergenic
1016250364 6:142034078-142034100 CAGGTTAAAGTGTTGGTGAGTGG + Intergenic
1016373446 6:143397239-143397261 CAGGAGAAACATTTTCTGGGAGG - Intergenic
1017972305 6:159323444-159323466 CATGGTAGACAGTTGGTGAGGGG + Intergenic
1018946721 6:168352406-168352428 CAGGAGAAAGAGGTGGGGGGAGG + Intergenic
1020250711 7:6466210-6466232 CAGGAAGAACAGGTAGTGGGTGG + Exonic
1022487464 7:30790839-30790861 CAGGTGACACAGTTGGTAGGTGG + Intronic
1030957235 7:115869132-115869154 AATAATAAACAGTTGTTGGGTGG + Intergenic
1031634996 7:124091795-124091817 CAGGATAATCTGAAGGTGGGAGG - Intergenic
1032503288 7:132416198-132416220 CAGGATAACCAGCTGGAGGAAGG + Intronic
1033798249 7:144872825-144872847 CAGGAAACACTGGTGGTGGGTGG - Intergenic
1034485880 7:151362069-151362091 CAGGATAAAAAGATTGAGGGAGG - Intronic
1035235490 7:157495092-157495114 CAGGACAGACTGCTGGTGGGAGG + Intergenic
1035725938 8:1824659-1824681 CAGGGTAAACAGGTGGGGTGCGG - Intronic
1035909709 8:3552545-3552567 CAAGATAAACATAAGGTGGGGGG + Intronic
1035988108 8:4456909-4456931 CAGGATAAACAGTTGGTGGGTGG - Intronic
1037273519 8:17155736-17155758 AAGAATAAATAGTTGGTGGAAGG + Intergenic
1038301133 8:26350154-26350176 CAGGAGAATCACTTGATGGGAGG - Intronic
1039729209 8:40256157-40256179 CAGGTAAAACAGGTTGTGGGAGG + Intergenic
1047219680 8:122909607-122909629 CAGGAGGAACAGGTTGTGGGGGG - Intronic
1047545429 8:125811799-125811821 AAGGACAAGCAGTTGTTGGGAGG - Intergenic
1048396541 8:134019513-134019535 CAAGGGAAAGAGTTGGTGGGAGG + Intergenic
1048451820 8:134540239-134540261 GAGGACAGACAGTAGGTGGGAGG + Intronic
1049420646 8:142515074-142515096 CAGGAGAAGCCATTGGTGGGAGG + Intronic
1050434031 9:5590510-5590532 CAGGAACAACAGTTTGTGGATGG + Intergenic
1051608783 9:18941962-18941984 GAGGAGAAACAGTTCGGGGGAGG - Intronic
1052094595 9:24369234-24369256 GGTGATGAACAGTTGGTGGGGGG + Intergenic
1057887397 9:98840263-98840285 GTGGATAAAAAGGTGGTGGGGGG - Intronic
1057942352 9:99296381-99296403 CATGTCAAACAGTCGGTGGGCGG - Intergenic
1060178691 9:121516659-121516681 CAGGACCAAGAGATGGTGGGGGG - Intergenic
1061165512 9:128919908-128919930 CAGAATGAACAGTTAGTGGGAGG + Intergenic
1061673035 9:132199920-132199942 CAGTCTAAACAGTTTTTGGGAGG - Intronic
1186478255 X:9875950-9875972 CAGGAGAACTGGTTGGTGGGAGG + Intronic
1189843109 X:45103341-45103363 CAGGAAAAAGAGTTGGGGGAAGG - Intronic
1190212660 X:48460408-48460430 CAGGGTAGTCAGTTGGAGGGAGG - Intronic
1191133402 X:57038741-57038763 CAGGATAAAAAATTTGTGGTTGG + Intergenic
1191263421 X:58355068-58355090 CAGGATAAAAAGTAGGTGGAAGG + Intergenic
1191945559 X:66531024-66531046 CAGGATAAACAGTTGGTTTGAGG + Intergenic
1193216504 X:78870597-78870619 CAGGAAAAACATTTTGTGGAGGG + Intergenic