ID: 1035990849

View in Genome Browser
Species Human (GRCh38)
Location 8:4488727-4488749
Sequence CTGAGGGCCCATTTGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035990849_1035990856 15 Left 1035990849 8:4488727-4488749 CCCAGCACCAAATGGGCCCTCAG 0: 1
1: 0
2: 2
3: 28
4: 257
Right 1035990856 8:4488765-4488787 CGCGTCCTGCGTATCCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035990849 Original CRISPR CTGAGGGCCCATTTGGTGCT GGG (reversed) Intronic
901038131 1:6348633-6348655 TTGAGGGCCCATTTGTTTCCTGG - Intronic
901053368 1:6437123-6437145 CTGAGGGCTCATTCCGTGCCAGG + Intronic
901249940 1:7770661-7770683 CTGAGGACCTATTCTGTGCTAGG + Intergenic
901910437 1:12453105-12453127 CCCAGGACCCAGTTGGTGCTGGG + Intronic
902480908 1:16711040-16711062 CTGAGGGCTCATTCCGTGCCAGG - Intergenic
902557638 1:17256405-17256427 CCGAGGGCTCAGGTGGTGCTGGG - Intronic
902620584 1:17648491-17648513 CTCATGGCCCAGTTGGTCCTTGG + Intronic
902831669 1:19017905-19017927 CTGAGTGCCTATTTTGTGCTGGG + Intergenic
903376445 1:22869417-22869439 ATGAGGGCCCAAGAGGTGCTGGG + Intronic
904258043 1:29269449-29269471 CTGAATGCCCACTTTGTGCTGGG + Intronic
904371080 1:30047716-30047738 CTGTGGCCCCATTGGGTTCTTGG - Intergenic
904593550 1:31628700-31628722 CTGAGGCCCCCCATGGTGCTGGG - Intronic
905675228 1:39819848-39819870 CTCAGGGCCCTCTTGGTGCTTGG + Intergenic
906747454 1:48231857-48231879 CTGAGGGCCCACATGAGGCTGGG + Intronic
907652739 1:56311346-56311368 CTGAGGGCCCTTCCAGTGCTGGG - Intergenic
907779430 1:57552287-57552309 CTCAGCACCCACTTGGTGCTAGG + Intronic
912239660 1:107892316-107892338 CTGAGTGCCCATTACGTACTAGG + Intronic
912321761 1:108720226-108720248 TTGAGGGCCCACTGTGTGCTGGG + Intronic
912368596 1:109155117-109155139 CTGAGGGCCTGTTATGTGCTAGG - Intronic
912459635 1:109822152-109822174 CTGAGGGTCCATGTGGGGGTGGG + Intergenic
914309958 1:146457921-146457943 CTGTGAGGCCATTTGGTCCTGGG - Intergenic
915625853 1:157113661-157113683 CTGAGGGGCCATTATGTGCCAGG - Intergenic
916197762 1:162240770-162240792 CTGAGCACCTATTTGGTGCTGGG + Intronic
920448812 1:206041349-206041371 CTGAAGGGCAATTTGGTGGTGGG - Intronic
920982606 1:210852398-210852420 CTGAGGGCCTACTATGTGCTAGG - Intronic
922772227 1:228192095-228192117 CTGGGGGCCCATAGGGTGCTGGG + Intergenic
922792435 1:228317695-228317717 CTGTGGGCCCTGTGGGTGCTGGG + Exonic
923675339 1:236075971-236075993 CTGAGGCCGCATTTGGTCCTGGG + Intergenic
1065298893 10:24302906-24302928 CTGAGGGACCATATGGGGGTGGG + Intronic
1065382357 10:25102990-25103012 CTGAGGTCCCCTTTGCTGCCTGG - Intergenic
1066153636 10:32651252-32651274 CTCAGGCACCATTTGGTGCTGGG + Intronic
1067187622 10:44043875-44043897 TTGTGGGCCCATTGTGTGCTGGG + Intergenic
1067207309 10:44230129-44230151 CTGTGAGCCCATCTGGTCCTGGG + Intergenic
1067343839 10:45424160-45424182 CTGGGGGCCCAAGTGGTGCTGGG + Intronic
1069776842 10:70932263-70932285 CTGAGGGCCTACTGTGTGCTCGG + Intergenic
1070159592 10:73858175-73858197 CAGATGGAGCATTTGGTGCTAGG - Intronic
1070382462 10:75893231-75893253 CTGAGGGCTCAGTGGGTGCTAGG + Intronic
1071397252 10:85236562-85236584 TTGAGTGCCCACTAGGTGCTAGG + Intergenic
1076333875 10:129692055-129692077 CTGAGCACCCACTGGGTGCTGGG - Intronic
1077181761 11:1220120-1220142 CAGAGGGCCCATTGGGAACTGGG - Intergenic
1078340220 11:10493238-10493260 CGGATGGCCCATGAGGTGCTGGG + Intronic
1078459704 11:11504833-11504855 CTGAGTGCCAATTATGTGCTGGG + Intronic
1080129245 11:28773864-28773886 ATTATGGCACATTTGGTGCTAGG + Intergenic
1080934906 11:36852935-36852957 TTGAGCACCTATTTGGTGCTTGG + Intergenic
1083620075 11:64044882-64044904 CTGAGGCCCCACTGTGTGCTGGG + Intronic
1083886670 11:65576495-65576517 GTGGGGGCCCATTTGGTCATTGG - Intronic
1084640806 11:70424568-70424590 CAGAGGGCCCAGTGGGTGATGGG + Intronic
1084900676 11:72307770-72307792 CTGAAGGGCCATTTGGTGGATGG + Intronic
1085015838 11:73173642-73173664 CCCAGGGCCCATTTAGGGCTTGG - Intergenic
1085311490 11:75519547-75519569 CTGAGTGCTCATTATGTGCTGGG + Intronic
1085318422 11:75560012-75560034 CTGAGGGCCAATGTGGGGGTGGG + Intergenic
1086254863 11:84863630-84863652 ATGGAAGCCCATTTGGTGCTAGG - Intronic
1086545153 11:87959077-87959099 CCTAGGGCCCATTTGATGATTGG - Intergenic
1087755346 11:102048932-102048954 CTGAGGGCCTATCATGTGCTAGG + Intronic
1088202155 11:107350213-107350235 CTGAGGGCCAATTACATGCTGGG + Intronic
1089188832 11:116639480-116639502 CTGAGGGCCCATTTTGTCCATGG - Intergenic
1091290991 11:134439776-134439798 CTGAGTGCCCCTTTGGTTTTAGG + Intergenic
1095876620 12:47086007-47086029 CTGAGCGCCCACTGTGTGCTAGG + Intronic
1098622048 12:72613533-72613555 TTGAGTGCCTATTTTGTGCTAGG + Intronic
1100793983 12:98160492-98160514 CTGAGGGCCCATCAGTTTCTGGG - Intergenic
1101351117 12:103930516-103930538 ATGAGGGCCCTGTGGGTGCTGGG + Exonic
1101402866 12:104403525-104403547 ATGTGGCCCCATTAGGTGCTGGG - Intergenic
1101740035 12:107493529-107493551 TTGAGGACCCATTTTGTGCTTGG + Intronic
1103042258 12:117705376-117705398 CTGAGGGCCTATTAGGAGCCTGG + Intronic
1104601474 12:130156765-130156787 CTGAGCACTTATTTGGTGCTTGG + Intergenic
1105727524 13:23179021-23179043 CTTAGGCCTAATTTGGTGCTTGG - Intergenic
1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG + Intergenic
1107899286 13:44996010-44996032 CTGAGTACCCACTTTGTGCTGGG - Intronic
1109175944 13:59155851-59155873 CTGAGGGCCCACTCTGTGCCAGG + Intergenic
1109722148 13:66288845-66288867 CTGAGGGCCCATTAGTTAATTGG - Intergenic
1111952857 13:94723782-94723804 TTGAGTGCCTATTTGGTGCCAGG - Intergenic
1114135231 14:19840495-19840517 CTCAGGTCCCAAGTGGTGCTTGG + Intergenic
1115993550 14:39173412-39173434 CTGAGGGCCCACTATGTGCCAGG - Intergenic
1116696189 14:48181618-48181640 CTGAGTGCCTATTTTGAGCTAGG - Intergenic
1116772514 14:49143800-49143822 CTGAGGTCCCATTTTGTTCCTGG - Intergenic
1119450912 14:74709523-74709545 TTGAGGGCCCATTCTGTCCTGGG - Intronic
1121178756 14:91911436-91911458 CTGAGGGCCAATTCTGTGCCTGG - Intronic
1121309081 14:92925206-92925228 CTGAGGACCTATTATGTGCTAGG - Intronic
1121762069 14:96454271-96454293 CTGAGGGCCCATATTTTGCAAGG - Intronic
1122211187 14:100175188-100175210 CTGAGGGCCCACTGTGTGCCAGG - Intergenic
1122261237 14:100524312-100524334 CTGAGTGCCCGTTAGGTGCTGGG - Intronic
1122282760 14:100633843-100633865 CTGAGTGCCCATTTGGGGCAAGG + Intergenic
1122287031 14:100658351-100658373 CTGAGGGGCCACATGGTGCTGGG + Intergenic
1122595464 14:102887349-102887371 AAGAGGGCCCATGTGGGGCTAGG + Intronic
1202916358 14_GL000194v1_random:176568-176590 CTCAGGGCCAATTTGGGGCATGG + Intergenic
1124491017 15:30155576-30155598 CTGAGTGCCCACTGTGTGCTTGG - Intergenic
1124554171 15:30709794-30709816 CTGAGGGCCTATTCTGTGCCAGG - Intronic
1124677074 15:31695877-31695899 CTGAGGGCCTATTCTGTGCCAGG + Intronic
1124752520 15:32382755-32382777 CTGAGTGCCCACTGTGTGCTTGG + Intergenic
1127517263 15:59708502-59708524 CTGGGGTCCCATATGGGGCTTGG + Intergenic
1128702452 15:69814132-69814154 CTAAGTGCCCATCTGGTGCCGGG - Intergenic
1130334508 15:82947811-82947833 CTGGAGGCCTATTTGGTGCCAGG + Intronic
1132995582 16:2820788-2820810 CTGAGGGCCTCTGTTGTGCTGGG + Intronic
1133171987 16:3987315-3987337 CTGAGCGTACATTTGGTGCCTGG + Intronic
1138449457 16:57084704-57084726 TGACGGGCCCATTTGGTGCTAGG - Intergenic
1139802941 16:69538777-69538799 ATGAGGGCCCATTTGGGTCATGG - Intergenic
1140808862 16:78558021-78558043 CTGAGGGCCGACTATGTGCTTGG - Intronic
1140914321 16:79481120-79481142 CTGACAGCCCATGTGTTGCTTGG + Intergenic
1141208063 16:81949270-81949292 CTGAGGGCCCACTTGGTTGCAGG + Intronic
1141242401 16:82275715-82275737 TTGGGGGTCCATTGGGTGCTGGG + Intergenic
1141242418 16:82275817-82275839 TTGGGGGTCCATTGGGTGCTGGG + Intergenic
1141242435 16:82275919-82275941 TTGGGGGTCCATTGGGTGCTGGG + Intergenic
1141242450 16:82276021-82276043 TTGGGGGTCCATTGGGTGCTGGG + Intergenic
1141242468 16:82276123-82276145 TTGGGGGTCCATTGGGTGCTGGG + Intergenic
1141242501 16:82276327-82276349 TTGGGGGTCCATTGGGTGCTGGG + Intergenic
1141242533 16:82276531-82276553 TTGGGGGTCCATTGGGTGCTGGG + Intergenic
1142144310 16:88486445-88486467 CTGAGTGCACAGTGGGTGCTGGG + Intronic
1142431942 16:90033684-90033706 CTGAGTGTCCATTAGCTGCTAGG + Intronic
1142474140 17:179968-179990 CTGGTGGCACATTTGATGCTTGG + Intronic
1143486730 17:7259395-7259417 CTGAAGCACCATTTGGTACTGGG - Intronic
1144814939 17:18027441-18027463 CTGAGTGCCCAGTCAGTGCTGGG + Intronic
1145270535 17:21402372-21402394 CTGGGGGCCCACATGCTGCTGGG - Intronic
1145308744 17:21689768-21689790 CTGGGGGCCCACATGCTGCTGGG - Intergenic
1145786102 17:27594823-27594845 CTGACTGCCTATTTTGTGCTTGG - Intronic
1146621474 17:34401845-34401867 CTGAGTGCCCAGTGGGTGCCAGG - Intergenic
1147671138 17:42177594-42177616 CTGGGGGCCCAGTGGGGGCTGGG + Intronic
1149588813 17:57812046-57812068 CTTAGGGGCGACTTGGTGCTAGG + Intergenic
1153497239 18:5711923-5711945 CTGAGGGCTCATTGGATGCGAGG - Intergenic
1154459357 18:14564453-14564475 CTCAGGTCCCAAGTGGTGCTTGG + Intergenic
1155312939 18:24542303-24542325 CTGAGGACCCACTTGGTTCAAGG + Intergenic
1155518988 18:26650440-26650462 CTGAGTGCTTATTTTGTGCTAGG + Intronic
1156627583 18:38927794-38927816 TTGAGTGCCTATTTCGTGCTAGG + Intergenic
1157599265 18:48884217-48884239 TTGAGTGCCTATTTGGTGCCAGG + Intergenic
1157718828 18:49907878-49907900 CTGAAGGCCCAGTGGGTGCATGG - Intronic
1158006646 18:52680110-52680132 CTGGGTGCCCATTGGGTTCTTGG + Intronic
1160152034 18:76402501-76402523 CTGAGGGGCCACTTGGTCCATGG - Intronic
1163406502 19:17126264-17126286 CTGTGGACCCATTTTGTCCTGGG + Intronic
1163631591 19:18420337-18420359 CTGAGGGCCCCTTTTGTTCTGGG + Intronic
1164964962 19:32474933-32474955 CTGAGGGTCTATTACGTGCTGGG - Intronic
1164972916 19:32547797-32547819 CTGAAGGCCCATCTGGGGCTGGG - Intergenic
1165922649 19:39308348-39308370 CTGAGGGCCCATTTCTTGGGCGG - Exonic
1167143498 19:47668203-47668225 CTGCGGGCCCACTATGTGCTGGG - Intronic
1167302276 19:48685110-48685132 CTGAGGTCCTACTTGGGGCTAGG - Intergenic
1167498261 19:49831471-49831493 CTGAGGGTCCATTGGGCACTTGG + Intronic
1168494067 19:56835891-56835913 CAGAGGGCACAAATGGTGCTGGG + Intronic
1168709667 19:58491783-58491805 CTTAGGGCCCATCTGGTGCTGGG - Intronic
1202714945 1_KI270714v1_random:36945-36967 CTGAGGGCTCATTCCGTGCCAGG - Intergenic
925213810 2:2074886-2074908 CTGAGGGCTTATTTTGTGATAGG + Intronic
925713911 2:6767814-6767836 CTGATGCCCCAAGTGGTGCTTGG + Intergenic
928424081 2:31163716-31163738 CTGAGGGGCCATATTGTGATGGG - Intergenic
929932842 2:46272213-46272235 CTGAGCAGCCACTTGGTGCTGGG - Intergenic
931632298 2:64312118-64312140 CTCAGGGCCCATTGAGTGATAGG + Intergenic
932264666 2:70357367-70357389 CTGAGGGCACATTTTGCACTAGG + Intergenic
936227205 2:110666957-110666979 CAGAGGACTCATTTTGTGCTGGG - Intronic
940164932 2:150760602-150760624 CTGAGTATCCATTTTGTGCTAGG + Intergenic
944924997 2:204455419-204455441 CTGAGAGCCCACTATGTGCTGGG - Intergenic
945922149 2:215765983-215766005 CTGAGGGCCCAGTGGGAGCTAGG + Intergenic
948132331 2:235609803-235609825 CTGTGGGCATATTTGGCGCTTGG + Intronic
948601304 2:239108893-239108915 CTGCCGGCCCAGTTGGTTCTGGG - Intronic
1172429981 20:34882182-34882204 CTGATTGCCTATTTTGTGCTAGG + Intronic
1172592159 20:36125500-36125522 CTGAGCGCTCAGTAGGTGCTAGG - Intronic
1173538318 20:43832451-43832473 CTGAGTTCCCATTTGCTGCCTGG + Intergenic
1173990424 20:47298228-47298250 TTGAGTGCCTATTAGGTGCTGGG - Intronic
1174050233 20:47762661-47762683 CTGAGGGCCTTTTTGGCCCTGGG + Intronic
1174687143 20:52466896-52466918 TTGAGCGCCCATTTTGTGTTAGG + Intergenic
1175194560 20:57233977-57233999 CTGAGGGATGATTTTGTGCTGGG + Intronic
1175538774 20:59735028-59735050 CTGAGGGACAAAGTGGTGCTAGG - Intronic
1176635711 21:9191214-9191236 CTCAGGGCCAATTTGGGGCATGG + Intergenic
1176814787 21:13588885-13588907 CTCAGGTCCCAAGTGGTGCTTGG - Intergenic
1177567380 21:22843087-22843109 CTAAGGGCCCACCTGCTGCTGGG - Intergenic
1178507204 21:33171713-33171735 CTGAGGGCCCCTGGGGTGCAGGG + Intergenic
1180800014 22:18627329-18627351 AGGAGGGCCCCTGTGGTGCTGGG + Intergenic
1181221701 22:21367937-21367959 AGGAGGGCCCCTGTGGTGCTGGG - Intergenic
1181871890 22:25905985-25906007 CTGGGGGACCACTTAGTGCTCGG + Intronic
1182025140 22:27112039-27112061 CTGAAGGCTCATTCTGTGCTGGG - Intergenic
1183045469 22:35216111-35216133 CTGTGGGCAGATTTGGTGTTTGG + Intergenic
1183251984 22:36736857-36736879 TTGAGTGCCCTTTTGGTGCCAGG - Intergenic
1183364866 22:37401555-37401577 CTGAGGGCCCACTGTGTGATTGG - Intronic
1183669513 22:39264266-39264288 CTGAGGGCCCACTGTGTGCTGGG + Intergenic
1183706587 22:39478320-39478342 CTGAGTGCCCACTGGGTGTTGGG + Intronic
1183935099 22:41257432-41257454 TTGAGTCCCCATTTAGTGCTTGG - Intronic
1184390216 22:44199473-44199495 CTGAGGGCCTGTTTAGTGCCAGG + Intronic
1185293490 22:50040905-50040927 CTGAGGGCCCAGTTCTTCCTGGG - Intronic
949507093 3:4738485-4738507 CAGAGGCCCCATTCGGTTCTGGG + Intronic
949869853 3:8579307-8579329 CTGATGAGTCATTTGGTGCTGGG - Intergenic
950062631 3:10084675-10084697 CTGAGGGCCTATTAGGTGTCAGG - Intronic
950455598 3:13091048-13091070 CTGATGACCCATTCTGTGCTCGG + Intergenic
950789493 3:15461262-15461284 CTGTGGGACCAGATGGTGCTGGG - Intronic
951787835 3:26442629-26442651 CTGAGGGACAATTTGCTTCTTGG + Intergenic
953896363 3:46806243-46806265 CTGAGTGCCCATTTTGTGAGGGG + Intronic
954147943 3:48643507-48643529 CTGAAGGCCCACCTGGTTCTGGG + Intronic
956404025 3:68909423-68909445 CTGAGGGACTACTTGGTGCCAGG - Intronic
957252510 3:77791995-77792017 CTGAGGGCTCGTTTGGTTCCAGG + Intergenic
959708830 3:109364137-109364159 TTGAGGGCCCGTTTGGTGCTTGG + Intergenic
960671461 3:120158639-120158661 CTGAGGGCCCACTATGTGCCAGG - Intergenic
961504449 3:127360929-127360951 CTGAGGGCCCTCATGGTGCCTGG - Intergenic
961644383 3:128384856-128384878 CTGAGGGCCAAAGTGGTGCAGGG + Intronic
965850834 3:173020729-173020751 CTGGGTCCCCATTTGGTGATAGG - Intronic
969105637 4:4805281-4805303 CTGTGTGCCCATTTTGTGCTAGG + Intergenic
969463617 4:7342161-7342183 CTGAGTGCCCACTGGGTGCCAGG + Intronic
969946775 4:10791275-10791297 CTGAGTGTCCTTTTTGTGCTAGG + Intergenic
971001038 4:22322753-22322775 TTGATGGCCCATTGGATGCTGGG - Intergenic
971227529 4:24768894-24768916 CTGATGGCCACTTTGGGGCTGGG - Intergenic
971419102 4:26459599-26459621 CTGAAGGCCCACTTTGTGCCAGG + Intergenic
973580398 4:52338953-52338975 CTGAGGCCCCAGTTGTTCCTGGG - Intergenic
974805867 4:66879911-66879933 CTGAGGGCCTATTATGTGCCAGG + Intergenic
975592701 4:76016672-76016694 CTCTGGGCCCATCTGGTGCCTGG - Intronic
976521995 4:86039434-86039456 GTGAGGGTCTCTTTGGTGCTGGG - Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
980885917 4:138762072-138762094 AAGAGAGCCCATATGGTGCTTGG - Intergenic
981689688 4:147493897-147493919 CTGAGGGCACATTTGATTTTAGG - Intronic
982755273 4:159210839-159210861 TTGAGGGCACATTTGCTCCTAGG + Intronic
984769088 4:183422157-183422179 CTGTGGGCCCCTGAGGTGCTGGG - Intergenic
985795007 5:1955800-1955822 CTGTGGGGTCATTTGGTGCGTGG + Intergenic
985795029 5:1955906-1955928 CTGCGGGGTCATTTGGTGCGTGG + Intergenic
985795039 5:1955960-1955982 CTGCGGGGTCATTTGGTGCATGG + Intergenic
985795051 5:1956014-1956036 CTGTGGGGTCATTTGGTGCGTGG + Intergenic
985795074 5:1956121-1956143 CTGTGGGGTCATTTGGTGCGTGG + Intergenic
985795086 5:1956174-1956196 CTGTGGGGTCATTTGGTGCGTGG + Intergenic
985795132 5:1956388-1956410 CTGCGGGGTCATTTGGTGCGTGG + Intergenic
985795144 5:1956442-1956464 CTGTGGGGTCATTTGGTGCGTGG + Intergenic
985795167 5:1956549-1956571 CTGTGGGGTCATTTGGTGCGTGG + Intergenic
985795179 5:1956602-1956624 CTGTGGGGTCATTTGGTGCGTGG + Intergenic
990477960 5:56180058-56180080 GTGAGGGCCTTTTTGGTGGTGGG + Intronic
991517981 5:67460669-67460691 CTGAGGGCTCATTTGATTATGGG - Intergenic
992113725 5:73519827-73519849 CTGAGACCCCATCTGGTGCAAGG + Intergenic
992198943 5:74365624-74365646 CTTATGGCCCACTTGGTGCTGGG - Intergenic
993434584 5:87876076-87876098 TTGAGGGCCTATTATGTGCTAGG - Intergenic
994127704 5:96187706-96187728 CTGAGTGCCCACTTTGTGCAAGG - Intergenic
995130463 5:108624516-108624538 CTGATTGCCCACTTGGTGGTGGG + Intergenic
998467978 5:142361112-142361134 CTGAGTGCCCATTTGTTGTGGGG + Intergenic
1001281377 5:170388845-170388867 CTGGGGGCTGATTTGGGGCTAGG - Intronic
1001316495 5:170644669-170644691 CTGATGGCCCATTTGTTTCAAGG - Intronic
1001931543 5:175676555-175676577 CTGACGGCCCATTATGTGCTAGG - Intronic
1002512078 5:179727171-179727193 TTGAGTGCCCATTTTGTGCCAGG + Intronic
1004553884 6:16676502-16676524 CTGAGTGCCTACTTTGTGCTAGG + Intronic
1004700915 6:18078698-18078720 CTGAGGGCCTACTTTGTGCCAGG + Intergenic
1005795113 6:29351819-29351841 CTGTGAGTCCATCTGGTGCTGGG + Intergenic
1005868263 6:29953951-29953973 CTGAGGGCTCAAATGGGGCTGGG - Intergenic
1006706420 6:36024817-36024839 TCGAGGGCCTATTTGGTGCCAGG + Exonic
1006948032 6:37798504-37798526 ATGAGGCTCCATTTGGAGCTGGG + Intergenic
1007316579 6:40994058-40994080 CTGAAGTCCCATTTAGTGCTAGG - Intergenic
1009468111 6:63999030-63999052 CTGAGGGCACAATTAGTGTTTGG + Intronic
1010385371 6:75273921-75273943 CTGAGTCCCTATTAGGTGCTAGG + Intronic
1013355039 6:109339250-109339272 CTGATGGCCCATTTTAGGCTTGG - Intergenic
1019226045 6:170510306-170510328 CTATGGGCCTATTTGGTTCTGGG + Intergenic
1020076822 7:5263774-5263796 CTGAGGGACCCTTTGGTGGCTGG - Intergenic
1020441216 7:8218783-8218805 CTGAGTGCTCATTTGAAGCTGGG + Intronic
1022326991 7:29341432-29341454 CAGAGAGCCCATTTGTTGCCAGG + Intronic
1026772873 7:73213261-73213283 ATGAGGGCCCATGTCGTGCCTGG + Intergenic
1026859143 7:73773770-73773792 CAGAGGGCCCAGCTGGTGCTGGG + Intergenic
1027013736 7:74766657-74766679 ATGAGGGCCCATGTCGTGCCTGG + Intergenic
1027074302 7:75179375-75179397 ATGAGGGCCCATGTCGTGCCTGG - Intergenic
1029419867 7:100466964-100466986 CGGAGGGCCCATTGGGCGCAGGG + Exonic
1033230378 7:139592995-139593017 CTGAGCCCCCTCTTGGTGCTGGG - Intronic
1035990849 8:4488727-4488749 CTGAGGGCCCATTTGGTGCTGGG - Intronic
1036095181 8:5716269-5716291 CTGAGTGCTTATTTTGTGCTAGG + Intergenic
1036938602 8:13030052-13030074 CTGAGGGCCAATCTGATGCTCGG - Intronic
1037238296 8:16747832-16747854 CTGTGGGCACATATGATGCTTGG - Intergenic
1039755030 8:40513510-40513532 CTCAGGGCCAATTTTTTGCTGGG + Intergenic
1039923116 8:41906830-41906852 CTCAGAGCCCAGTTGGTGCCTGG - Intergenic
1040587154 8:48755113-48755135 CTAAGGGCCAATTTGGTCCTGGG - Intergenic
1047451811 8:124972039-124972061 CTGAGGGACTATTTGGGGATGGG + Intergenic
1048875677 8:138835454-138835476 CTGAGGTCCCCTGTGGTGCATGG + Intronic
1049536190 8:143183556-143183578 CTGAGGGCTCACCTGGGGCTCGG + Intergenic
1049707016 8:144047692-144047714 CTGAGGGCAGATGGGGTGCTGGG + Intergenic
1049991546 9:996257-996279 CTGAGGCCCCACTTGCTCCTTGG - Intergenic
1050280941 9:4049378-4049400 TTGATGGCCCATTTCATGCTAGG - Intronic
1050336754 9:4596976-4596998 CTGAGTGCTCATTTTGTGCCAGG + Intronic
1051648987 9:19301406-19301428 CTGAGGGCCTACTCTGTGCTAGG - Intronic
1052286413 9:26790823-26790845 CTGAGGGCCTACATAGTGCTGGG + Intergenic
1053621207 9:39820574-39820596 CTGAGAGCCAATTTTATGCTAGG + Intergenic
1053802732 9:41774556-41774578 TTGAGAGCCCGTTTTGTGCTGGG + Intergenic
1054462254 9:65471664-65471686 TTGAGAGCTCATTTTGTGCTGGG - Intergenic
1056575101 9:87850373-87850395 CTGAGGGTCCAGCTGCTGCTGGG - Intergenic
1056802386 9:89701594-89701616 GTGAGGGACCATGTGGGGCTGGG + Intergenic
1057457511 9:95227880-95227902 CTGAGGGCCTGTATGGTACTAGG - Intronic
1057725947 9:97568245-97568267 CTGAGGGCCTATTATATGCTGGG + Intronic
1057911397 9:99022850-99022872 CTGAGGGCTCTCTGGGTGCTCGG + Intronic
1059437595 9:114285887-114285909 CTTAGGGCAGATTTGGTGTTAGG - Intronic
1059564286 9:115367472-115367494 CTCAGGGCCCATTGAGTGCTAGG + Intronic
1060175883 9:121497484-121497506 CTGAGTGCCCATATGTTTCTTGG + Intergenic
1060885689 9:127150446-127150468 AAGAAGGCCCATTTGGAGCTTGG - Intronic
1061600968 9:131669758-131669780 CTGAGGGCCCTTGAGGTTCTGGG + Intronic
1062518474 9:136947585-136947607 CTGAAGGCCCACTGTGTGCTGGG + Intronic
1203532572 Un_GL000213v1:160550-160572 CTCAGGTCCCAAGTGGTGCTTGG + Intergenic
1188146729 X:26623169-26623191 CTGAGTGCTGATTTTGTGCTGGG - Intergenic
1188474184 X:30572889-30572911 CAGGGGGCCAATTTGGTCCTGGG + Intronic
1188696896 X:33204690-33204712 TTGAGTGCCCATTTTGTGCCAGG - Intronic
1189572149 X:42309535-42309557 CTGTGAGCCCATCTGGTGCTGGG - Intergenic
1190278788 X:48916220-48916242 TTGAGAGCTCATTTTGTGCTAGG - Intronic
1191672438 X:63760738-63760760 CTTTGGGCCCACATGGTGCTAGG + Intronic
1191915743 X:66199546-66199568 CTGAGCGCCTAATTGGTACTAGG + Intronic
1194157808 X:90415171-90415193 CTCTGGGCCCATTAGGTGCTGGG - Intergenic
1198019538 X:132644648-132644670 CTGAGTTCCCATAAGGTGCTGGG - Intronic
1199778664 X:151038221-151038243 CTAAGGGCCCATTTGGTGTCTGG + Intergenic
1199969001 X:152844786-152844808 GTGAGTGCCCACTTTGTGCTGGG + Intronic
1200504139 Y:3992140-3992162 CTCTGGTCCCATTAGGTGCTGGG - Intergenic