ID: 1035997117

View in Genome Browser
Species Human (GRCh38)
Location 8:4560557-4560579
Sequence TGTGAGCTAAAACACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1035997115_1035997117 -1 Left 1035997115 8:4560535-4560557 CCTCTGCTACCTGTAGATACAGT 0: 1
1: 0
2: 0
3: 7
4: 126
Right 1035997117 8:4560557-4560579 TGTGAGCTAAAACACTGTGCTGG No data
1035997116_1035997117 -10 Left 1035997116 8:4560544-4560566 CCTGTAGATACAGTGTGAGCTAA 0: 1
1: 0
2: 0
3: 5
4: 98
Right 1035997117 8:4560557-4560579 TGTGAGCTAAAACACTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035997117 Original CRISPR TGTGAGCTAAAACACTGTGC TGG Intronic
No off target data available for this crispr