ID: 1035998403

View in Genome Browser
Species Human (GRCh38)
Location 8:4574419-4574441
Sequence GAGGGTAAGCAGAAGAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2462
Summary {0: 1, 1: 10, 2: 247, 3: 727, 4: 1477}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1035998403 Original CRISPR GAGGGTAAGCAGAAGAAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr