ID: 1036000287

View in Genome Browser
Species Human (GRCh38)
Location 8:4594882-4594904
Sequence CTCTGTAAAAGGAATGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036000284_1036000287 12 Left 1036000284 8:4594847-4594869 CCTTAGTAAATCTTCATCATGCT 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1036000287 8:4594882-4594904 CTCTGTAAAAGGAATGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036000287 Original CRISPR CTCTGTAAAAGGAATGTGGA TGG Intronic
No off target data available for this crispr