ID: 1036000339

View in Genome Browser
Species Human (GRCh38)
Location 8:4595603-4595625
Sequence TTAAGTATAACCAGTGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036000335_1036000339 1 Left 1036000335 8:4595579-4595601 CCTAAACAATGTCCCTTTCCTTA 0: 1
1: 0
2: 1
3: 25
4: 272
Right 1036000339 8:4595603-4595625 TTAAGTATAACCAGTGAAGCTGG No data
1036000334_1036000339 23 Left 1036000334 8:4595557-4595579 CCATACATTCTCAGTGTTGCTTC 0: 1
1: 0
2: 0
3: 15
4: 191
Right 1036000339 8:4595603-4595625 TTAAGTATAACCAGTGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036000339 Original CRISPR TTAAGTATAACCAGTGAAGC TGG Intronic
No off target data available for this crispr