ID: 1036000387

View in Genome Browser
Species Human (GRCh38)
Location 8:4596025-4596047
Sequence CTGTGGGCAGTGTGGCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036000387_1036000394 8 Left 1036000387 8:4596025-4596047 CCTGTTTGCCACACTGCCCACAG 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1036000394 8:4596056-4596078 AACCTTGCTCCTTTCTCTCAAGG No data
1036000387_1036000395 9 Left 1036000387 8:4596025-4596047 CCTGTTTGCCACACTGCCCACAG 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1036000395 8:4596057-4596079 ACCTTGCTCCTTTCTCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036000387 Original CRISPR CTGTGGGCAGTGTGGCAAAC AGG (reversed) Intronic
900375233 1:2351211-2351233 GTGTGGGGAGTGTGGGAGACGGG - Intronic
900740409 1:4327569-4327591 CTGTGGGCAGTGTGGGGAGAAGG - Intergenic
901705320 1:11068886-11068908 CTGTGGGCAGTCTGAAAACCAGG + Intronic
902511118 1:16967555-16967577 CTCTGGGCAGGGTGGCAGAGGGG + Intronic
905407145 1:37741664-37741686 CTGTGGGCAGTGTAGCCTAGGGG - Intronic
906556889 1:46721155-46721177 AAGTGGGCAGTGTTGCAAAGAGG + Intergenic
913201723 1:116500135-116500157 TGGTGGGGACTGTGGCAAACTGG - Intergenic
917215405 1:172673046-172673068 CTGTTGGAAATGTGGCAAAGAGG - Intergenic
918182366 1:182095551-182095573 CTGGGAGCAGTGTGGGGAACTGG - Intergenic
919290643 1:195625130-195625152 CTTTGTGCCATGTGGCAAACTGG + Intergenic
921740386 1:218678063-218678085 CTGTGCACATTGTGGGAAACAGG - Intergenic
922824782 1:228510291-228510313 CTGTGGGGTTTGTGGCAAGCAGG - Intergenic
923105938 1:230853912-230853934 CTGGGGCCAGAGTGGGAAACAGG - Intronic
1063981637 10:11457402-11457424 CTGGGGGCAGTGAGGGAGACAGG - Intronic
1065394250 10:25217227-25217249 CTTTGGGTAGTTTTGCAAACTGG + Intronic
1067792449 10:49298480-49298502 CTGTGGGCAGTTTGGGGAGCAGG + Intergenic
1070238690 10:74656255-74656277 CTGTGGGCCCTGGGGGAAACTGG - Intronic
1071343755 10:84671966-84671988 CTGGAGGCAGGGAGGCAAACAGG - Intergenic
1074437078 10:113443416-113443438 CTCTGGGCAGTGTGGCTCAGAGG - Intergenic
1074689748 10:115993572-115993594 CTGTGGGCATTGGGGTAAACAGG - Intergenic
1074990748 10:118704554-118704576 CAGAGGGAAGTGTGCCAAACGGG - Intronic
1075903308 10:126060818-126060840 CTGTGGGAAGTGTGTCACTCTGG + Intronic
1076182962 10:128424923-128424945 CTGTGGGCACTATGGCCAATAGG - Intergenic
1076248227 10:128964189-128964211 CTGATGGCAGCGTGGCCAACTGG + Intergenic
1077425256 11:2473074-2473096 TTCTGGGCAGAGTGGCACACAGG + Intronic
1078181433 11:9014871-9014893 CTGTGGACAGTGTAGCACATTGG - Intergenic
1078939926 11:15991204-15991226 CTGTGGGTATCGTGGCAAAAAGG - Intronic
1079616279 11:22497508-22497530 CTGTGAGTAATGTGGCAAACTGG - Intergenic
1084605428 11:70169289-70169311 GTGGGGGCAGTGTGGGGAACGGG - Intronic
1086111662 11:83205845-83205867 TAGTGGGAACTGTGGCAAACTGG - Intronic
1087059373 11:93962976-93962998 CTGTGGGCAGTGGGGCGTCCTGG + Intergenic
1087307219 11:96501481-96501503 CTGTTTGAAGTGTGGCCAACAGG + Intronic
1088142524 11:106634411-106634433 TTGGGGGCCATGTGGCAAACTGG + Intergenic
1088692298 11:112338324-112338346 CTGTGGGAAGTTTGGCAACAAGG - Intergenic
1089602777 11:119625461-119625483 CTGTGGGAAGCGGGGCAGACTGG + Intronic
1090865358 11:130695801-130695823 CTGTGGGAGGTGTTACAAACTGG + Intronic
1091723787 12:2831920-2831942 CTGTGGGGAGTCTGGAACACAGG - Intronic
1092263187 12:6963170-6963192 CTGTGCGCAGGGTGGCAGGCGGG + Intergenic
1092370933 12:7916046-7916068 CTGGGGGCAGGGCGGCGAACTGG + Intergenic
1093867222 12:24242787-24242809 CTGAGGGCAATTTGGCAAAATGG + Intergenic
1101631996 12:106504219-106504241 CTGTGGGCAGTGTGGACTTCTGG + Exonic
1103043934 12:117719580-117719602 TGGTGGGGAGTGGGGCAAACTGG - Intronic
1103145199 12:118589612-118589634 CTGTGGGGAGTGTGGTCAGCAGG + Intergenic
1104965313 12:132506355-132506377 CTGTGAGCACTGTGGCAATGGGG + Intronic
1106423790 13:29606354-29606376 CTGTGAGCAGAGTGGCAGAGAGG + Intergenic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1114191329 14:20441482-20441504 AAGTGGGAACTGTGGCAAACTGG - Intergenic
1117347580 14:54848696-54848718 CTCTGGGCTGAGTGGTAAACGGG - Intronic
1117672179 14:58119563-58119585 CTGTGGGCAGTGGTCCAAGCAGG - Intronic
1120594908 14:86421237-86421259 CTGTGGGTAGAGTAGCAAATGGG + Intergenic
1121312713 14:92943795-92943817 CTGTCTGCAGGGTGGGAAACTGG + Intronic
1121457436 14:94047416-94047438 CTGAGGGCAGTATGGAAACCAGG - Exonic
1126435421 15:48632684-48632706 CTGTGGGTAGTGGGGTATACTGG - Intronic
1129653305 15:77506665-77506687 CTGGGCGCAGTGTGGCAGGCAGG - Intergenic
1130417322 15:83705815-83705837 CTGTGGGCAGGGAGCCACACTGG + Intronic
1131673342 15:94645717-94645739 TTGTGGGCAGAGTGGCAGAGTGG + Intergenic
1131801642 15:96075312-96075334 ATGTTGGCAGTGTGGGAAAGAGG - Intergenic
1131900789 15:97085704-97085726 ATGTTGACTGTGTGGCAAACGGG + Intergenic
1132631352 16:919200-919222 GTGTGCTCAGTGTGGCCAACAGG + Intronic
1133848353 16:9478335-9478357 TGGTGGGGACTGTGGCAAACTGG - Intergenic
1134664686 16:16010375-16010397 TGGTGGGGACTGTGGCAAACTGG - Intronic
1138373975 16:56549840-56549862 GAGTGGGGACTGTGGCAAACTGG - Intergenic
1138532694 16:57643447-57643469 CTGTGGGAAGAGTGACAAAGGGG - Intronic
1139555682 16:67708444-67708466 CCCTGGGCAGTGTGTCACACTGG + Intronic
1139592240 16:67939776-67939798 CTGTGTGCAGTGAGGCAAGATGG - Exonic
1139653212 16:68372917-68372939 CAGAGGGCAGTGTGGCCAGCAGG + Intronic
1140746570 16:77985837-77985859 ATGTGGGCCGAGTGGCAAAGAGG + Intergenic
1140932171 16:79637834-79637856 CTGTGTGCAGTTTGGGAAAAGGG + Intergenic
1141875910 16:86824459-86824481 CTGTGGGACGTGTGGAAACCAGG + Intergenic
1142120605 16:88384744-88384766 CTCTGGGCAGTGTGCAAACCAGG + Intergenic
1142730186 17:1849120-1849142 CTGTTGGCAGGGAGGTAAACTGG - Intronic
1144050962 17:11496803-11496825 TGGTGGGCACTGTGGCAAACTGG + Intronic
1145245406 17:21265907-21265929 CAGTGTGGAGTGTGGCAAAGTGG + Intergenic
1145272322 17:21411340-21411362 CTGTAGGCACTGTGGCCAGCAGG + Intronic
1145310528 17:21698805-21698827 CTGTAGGCACTGTGGCCAGCAGG + Intronic
1147262819 17:39218435-39218457 CCGTGGGGACTGTGGCAAACTGG + Intronic
1154475611 18:14753466-14753488 AGGTGGGCACAGTGGCAAACTGG - Intronic
1155737435 18:29241086-29241108 CTGTGGGTAGTGTGAAAAATAGG + Intergenic
1156489624 18:37488503-37488525 CTGTGGGCACTGAGGCACACTGG + Intronic
1156508209 18:37612581-37612603 GTGTGTGCAGTGTGGTAAATTGG + Intergenic
1157270657 18:46273421-46273443 AAATGGGGAGTGTGGCAAACTGG + Intergenic
1158143943 18:54289385-54289407 CTTTGGGCAGTATGGGAAAATGG - Intronic
1158652535 18:59300755-59300777 CTGTGGGCAGTCTTGCACATGGG + Intronic
1160332634 18:78009347-78009369 GTGTGGGAAGTCTGGCAAGCTGG - Intergenic
1163587175 19:18170294-18170316 CCGTGGGCAGTGTCGCAACTTGG - Exonic
1163711853 19:18851816-18851838 CTGTGGACAGTGTGTCAGGCTGG + Intronic
1165221147 19:34317621-34317643 CTGAAGGCAGTGGGGCACACAGG + Intronic
1166302293 19:41918110-41918132 ATGTGGGCAGTGTGGGAATGGGG - Intronic
1166960043 19:46491809-46491831 CTCTGGGCAGTGGGGCAGGCGGG - Exonic
1167198624 19:48048426-48048448 TTGTAGGCAGTGTTGCACACTGG + Intronic
929406642 2:41650034-41650056 TGGTGGGAACTGTGGCAAACTGG + Intergenic
929576170 2:43054264-43054286 CTGGGGGCAGCGTAGCAAAGTGG - Intergenic
933290180 2:80429454-80429476 CTGGGGGCAGTGTGGCACAGTGG - Intronic
933566726 2:83959329-83959351 CTGTGGCCTGTGTGGCCTACAGG - Intergenic
933777964 2:85783149-85783171 ATTTGGTCAGTGTGGCAAAGTGG - Intronic
934657768 2:96124944-96124966 GTGTGGGCTGTGAGGCTAACAGG - Intronic
934896291 2:98122960-98122982 CTGTGGGCAGAGGGGCACAGCGG - Intronic
935023675 2:99256037-99256059 CTGTGTGCAGTCTGAGAAACTGG - Intronic
935671707 2:105561808-105561830 CTGGGGGCAGTATTGCAAACTGG + Intergenic
935810898 2:106796164-106796186 CTTTGGGCAGTGGGGAAAAAGGG - Intergenic
936974885 2:118208935-118208957 CAGTGGGGACTGTAGCAAACTGG + Intergenic
937752257 2:125490392-125490414 CTGTGGCCAGAGGGGAAAACTGG - Intergenic
940072226 2:149701594-149701616 CTGTTAGCAGTGTTGAAAACAGG + Intergenic
940922829 2:159328631-159328653 TCATGGGCACTGTGGCAAACAGG - Intronic
941369548 2:164647189-164647211 CAGTAGGAAGTGTGGCAAACTGG - Intergenic
941857023 2:170241681-170241703 CTGTGGGTAGTGGGGCAGATGGG + Intronic
941983205 2:171482956-171482978 TTGTGGGCAGTGTAACAAACAGG + Exonic
944106679 2:196086454-196086476 CTGTGGGCAGTGTTGATAATTGG + Intergenic
948901514 2:240958880-240958902 CTTGGGGCAGTGTGGCCAGCAGG - Intronic
948909791 2:240997311-240997333 CTGTTTGCAGAGAGGCAAACTGG - Intergenic
1169207661 20:3749297-3749319 CTGTGGGCAGAGATGCAAGCAGG + Exonic
1169805922 20:9559012-9559034 GTGAGGGCAGTGTGGGAAAATGG - Intronic
1170166489 20:13364874-13364896 CTGTAGCCAGAGTGGCAAACAGG - Intergenic
1171076264 20:22127398-22127420 CTGTGGGCCGTGGGACACACTGG - Intergenic
1172449757 20:35013705-35013727 CTGTGGGCAGTGTGGAGAGGTGG + Intronic
1173623397 20:44453696-44453718 TGGTGGGGACTGTGGCAAACGGG + Intronic
1173959574 20:47060655-47060677 TGGTGGGGACTGTGGCAAACTGG - Intronic
1174046850 20:47739932-47739954 CACGGGGGAGTGTGGCAAACTGG - Intronic
1174196798 20:48778012-48778034 GGGTGGGGACTGTGGCAAACTGG + Intronic
1174428049 20:50447334-50447356 TGGTGGGGACTGTGGCAAACGGG - Intergenic
1174540609 20:51286317-51286339 TGGTGGGGACTGTGGCAAACTGG - Intergenic
1175050468 20:56151041-56151063 TAGTGGGGAGTGTGGCAAAGTGG - Intergenic
1175845042 20:62053739-62053761 CTGGGGGCAGGGTGGGATACGGG - Intronic
1176211545 20:63925543-63925565 CAGAGGAAAGTGTGGCAAACAGG + Intronic
1179716095 21:43289365-43289387 CCCTGGGCAGTGTGGCAAGGTGG + Intergenic
1180128111 21:45805539-45805561 TTGTGGGCAGTGTGGCAGAACGG + Intronic
1181196562 22:21191266-21191288 CTGTTTGCAGTATGGCAAAATGG + Intergenic
1181212966 22:21301858-21301880 CTGTTCGCAGTATGGCAAAATGG - Intergenic
1182064873 22:27423568-27423590 TGGTGGGGACTGTGGCAAACTGG + Intergenic
1182672269 22:32006180-32006202 TGGTGGGGACTGTGGCAAACTGG + Intergenic
1182896661 22:33864585-33864607 CTGGGGATAGTGTGGTAAACAGG - Intronic
1183313031 22:37121722-37121744 CTTGGGGCAGTGTGGCATAGTGG - Intergenic
1184431819 22:44445454-44445476 CTGGAGCCAGTGTGACAAACGGG - Intergenic
1184836089 22:47021893-47021915 CAGTGGGCGGGGTGGCAAGCGGG - Intronic
1184974377 22:48050827-48050849 CAGTGGACAGTGTGGCTAAGTGG + Intergenic
1185414217 22:50700963-50700985 CTCTGCGCAGTGTGGCCAGCAGG - Intergenic
950107523 3:10397688-10397710 GTGGGGGCAGAGTGGCAGACAGG + Intronic
950418005 3:12879618-12879640 CTGTGGCCAGTGTGGAAACTGGG - Intergenic
950866479 3:16193712-16193734 CTGCGGGCAGAGTGACAACCAGG - Intronic
955233454 3:57119892-57119914 TGGTGGACAGTATGGCAAACTGG - Intronic
955802027 3:62696370-62696392 GTATTGACAGTGTGGCAAACTGG - Intronic
956186692 3:66569576-66569598 CCATGGGGACTGTGGCAAACTGG - Intergenic
956470024 3:69556741-69556763 TGGTGGGAACTGTGGCAAACTGG + Intergenic
960281143 3:115783116-115783138 AGGTGGGTACTGTGGCAAACTGG + Intergenic
961087006 3:124076750-124076772 TGGTGGGGACTGTGGCAAACTGG + Intergenic
961380981 3:126496413-126496435 CTGTGGGCCGTGAGGAACACAGG + Intronic
961469484 3:127102264-127102286 TGGTGGGGACTGTGGCAAACTGG + Intergenic
961650525 3:128414589-128414611 CTGGGGACAGTGTGGGTAACTGG - Intergenic
961920369 3:130418893-130418915 CTAGGGCCAGTGGGGCAAACTGG + Exonic
965663636 3:171068396-171068418 TTGAGGGCAGTGTGGTACACTGG - Intronic
966388749 3:179429321-179429343 CTGTGGGCACTGGGGAACACCGG + Intronic
968885486 4:3328893-3328915 CTGTGAGCAGAGTGGCCATCTGG + Intronic
969252819 4:5980990-5981012 TTGTGGGAAGTGTGGCAAAATGG + Intronic
969267958 4:6077931-6077953 TGGTGGGGACTGTGGCAAACTGG - Intronic
970838663 4:20441165-20441187 ATGTGGTCAGTGTGGCAAAAGGG + Intronic
971343042 4:25788140-25788162 CTGTGGGCGGGCTGGCAAACAGG - Intronic
971576368 4:28280334-28280356 CTGTGGGCTGTGTGGGAACTGGG + Intergenic
972721314 4:41701736-41701758 CAGTGTGGAGTATGGCAAACTGG + Intergenic
976647320 4:87399828-87399850 CTGTGGGCATTGTGGACAGCAGG + Intergenic
978944017 4:114472546-114472568 CTGTCCTCAGTGTGGCAAATGGG - Intergenic
979225921 4:118284288-118284310 CTGGGGGCAGTTTGCCTAACAGG - Intronic
980581292 4:134755835-134755857 CTGTTGGCCATGTGGTAAACAGG - Intergenic
987303206 5:16616050-16616072 GTGTGCACAGTGTGGAAAACAGG - Intronic
990364040 5:55051160-55051182 CGGTGGGGACTGTGGCAAACTGG + Intergenic
990703452 5:58500404-58500426 CTGTGGGCAGATTGGGATACTGG + Intergenic
994406584 5:99352764-99352786 CTGTGGGCACTGTGGACAGCAGG - Intergenic
995253427 5:110019237-110019259 CTGTGGTGACTGTGGCATACTGG - Intergenic
996417498 5:123226287-123226309 CCGTGGGCAGTGTCGCAACTTGG - Intergenic
997283811 5:132664478-132664500 TTGTGGACTGTGTGGCCAACAGG - Intergenic
997643193 5:135463241-135463263 CTGGGGGAACTGAGGCAAACTGG - Intergenic
1001089664 5:168727892-168727914 CTGTGGACAGTGTGGCTATGGGG + Intronic
1002086320 5:176777789-176777811 CGGTGGGGACTCTGGCAAACTGG + Intergenic
1005994786 6:30924501-30924523 CTGGGGGCAGGGGGGCAACCAGG - Exonic
1009354126 6:62719540-62719562 CTGTGGGCAGTGGGACAAATGGG - Intergenic
1009996552 6:70901649-70901671 ATGGGGACACTGTGGCAAACGGG - Intronic
1012438001 6:99235392-99235414 CTGAGGGCAGGGCGGCAAAGTGG - Intergenic
1017005772 6:150027291-150027313 CTGGGGGCAGTGTGGGACTCAGG - Intergenic
1017044412 6:150333964-150333986 CTGCGTGCAGTGTTGCACACAGG - Intergenic
1017756923 6:157537594-157537616 CTCAGGGCAGTGTAGCAAACAGG - Intronic
1019667353 7:2258527-2258549 CTGTGAGCCGTGTGCAAAACGGG + Intronic
1020079735 7:5281118-5281140 CAGTGCGCAGTGAGGCATACAGG - Intronic
1023186900 7:37541679-37541701 CTGTGGCCACTGAGGCACACTGG - Intergenic
1026446198 7:70486988-70487010 CTGTAGGCATGGTGGTAAACTGG + Intronic
1027876186 7:83772125-83772147 ATGTGGGCACCGTGGCAAACTGG - Intergenic
1028253081 7:88558807-88558829 CTGTGCACAGTCTGGCAACCTGG + Intergenic
1028815886 7:95144145-95144167 CTGGGGGGAGTGGGGCAAATGGG - Intronic
1032336349 7:131028469-131028491 CTGAGGGCAGTGTGGAAGCCAGG - Intergenic
1034890015 7:154831302-154831324 CTGTGGCCTGTGTGGTCAACCGG - Intronic
1035907937 8:3534329-3534351 CTGAGAGGAGTGTGGAAAACAGG - Intronic
1036000387 8:4596025-4596047 CTGTGGGCAGTGTGGCAAACAGG - Intronic
1038429161 8:27485941-27485963 CTGAGGAAAGTGTGCCAAACAGG + Intergenic
1041183424 8:55272570-55272592 CTGGGGGCAGGCTGGCAGACAGG - Intronic
1042106630 8:65334383-65334405 GTGGGGGCTGTGTGGCAAATTGG - Intergenic
1043362410 8:79490271-79490293 CTGTGGGCAGTGGGGGAGAAAGG + Intergenic
1044747885 8:95388859-95388881 CTGGGGACATAGTGGCAAACAGG + Intergenic
1047289965 8:123521200-123521222 CTGGGGGTAGAGTGGGAAACAGG - Intronic
1047536145 8:125721550-125721572 CTTGGGGCAGCCTGGCAAACTGG + Intergenic
1048963599 8:139599441-139599463 CTGGGTGCAGTGTGTCAAGCAGG + Intergenic
1049089037 8:140500361-140500383 GTGTGGGCAGTGGGACCAACTGG - Intergenic
1051243058 9:15080552-15080574 CTGTGGGCAGTGAGGCATAAAGG - Intergenic
1053271073 9:36749901-36749923 CTGTGGGGTGAGCGGCAAACAGG - Intergenic
1053431211 9:38042943-38042965 TTGTGGGCGGTCTGGCAGACCGG - Intronic
1055891390 9:81127934-81127956 CTGAAGGCAGTGCTGCAAACTGG + Intergenic
1058290597 9:103236222-103236244 CTGTGGGCAATGTAGCAGAGAGG + Intergenic
1059936001 9:119311498-119311520 TTGTGGGGAGTGTAGCAAAGAGG - Intronic
1061294466 9:129669444-129669466 CTGTGGGCAGAGTGGAAACGGGG + Intronic
1061621599 9:131814425-131814447 CTGGGGGCAGTGGGGCCACCTGG + Intergenic
1061670748 9:132186871-132186893 CTGTTGGGAGTGTGGCACAAAGG + Intronic
1062191421 9:135249744-135249766 CAGTGGGTCATGTGGCAAACAGG - Intergenic
1185767064 X:2733902-2733924 CTGTGATCAGTGTTCCAAACAGG + Intronic
1186648455 X:11533066-11533088 CAGAGGGCAGTGTGACAGACAGG + Intronic
1191692679 X:63957175-63957197 ATGTGGGCTGGGTGGCAAAAGGG + Intergenic
1195125349 X:101803416-101803438 CTTTGGACCTTGTGGCAAACTGG - Intergenic
1196023993 X:111020842-111020864 CTGTGGGCTCTGTGGGAAAGGGG + Intronic
1199671167 X:150149454-150149476 ATGTGGTCAGTGTGGCAGAAAGG + Intergenic