ID: 1036001294

View in Genome Browser
Species Human (GRCh38)
Location 8:4608028-4608050
Sequence GGAACACCCTTTTCTGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 199}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036001294_1036001301 -4 Left 1036001294 8:4608028-4608050 CCTTGCCCAGAAAAGGGTGTTCC 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1036001301 8:4608047-4608069 TTCCAGGTGAAGGCCCTGGGAGG No data
1036001294_1036001300 -7 Left 1036001294 8:4608028-4608050 CCTTGCCCAGAAAAGGGTGTTCC 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1036001300 8:4608044-4608066 GTGTTCCAGGTGAAGGCCCTGGG No data
1036001294_1036001303 2 Left 1036001294 8:4608028-4608050 CCTTGCCCAGAAAAGGGTGTTCC 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1036001303 8:4608053-4608075 GTGAAGGCCCTGGGAGGAGATGG No data
1036001294_1036001305 9 Left 1036001294 8:4608028-4608050 CCTTGCCCAGAAAAGGGTGTTCC 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1036001305 8:4608060-4608082 CCCTGGGAGGAGATGGTGCTTGG No data
1036001294_1036001299 -8 Left 1036001294 8:4608028-4608050 CCTTGCCCAGAAAAGGGTGTTCC 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1036001299 8:4608043-4608065 GGTGTTCCAGGTGAAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036001294 Original CRISPR GGAACACCCTTTTCTGGGCA AGG (reversed) Intronic
900591982 1:3464213-3464235 GGCAGACCCTTTGCTGGGCAGGG + Intronic
900721406 1:4178201-4178223 GGAACAATGTTTTGTGGGCAGGG + Intergenic
901599820 1:10414665-10414687 AGAACCACCTTTGCTGGGCATGG - Intronic
901839297 1:11943940-11943962 GGAACAGCATTGGCTGGGCACGG + Intronic
902217665 1:14944861-14944883 GCACCATCCTGTTCTGGGCAGGG + Intronic
904170180 1:28586258-28586280 GGAGCAATGTTTTCTGGGCAGGG - Intergenic
905229635 1:36507199-36507221 GCAAGAGCCATTTCTGGGCACGG + Intergenic
905789558 1:40783038-40783060 GGAGGATCCTCTTCTGGGCAGGG + Intergenic
907283394 1:53365290-53365312 CGAACGTCCTTTTCTGGGCCGGG - Intergenic
912994551 1:114520026-114520048 GGAACAGCCTTTCATGGGAAAGG + Intergenic
913015548 1:114730320-114730342 AGATCACCGTTTTCTGGGCACGG - Exonic
913164704 1:116174287-116174309 AGAACACCATTGTCTGGGGATGG + Intergenic
914394874 1:147256018-147256040 AGCACACACTTTTCTGGGCAGGG + Intronic
914996051 1:152544107-152544129 GGCACACTCTGTGCTGGGCAAGG + Intronic
921714958 1:218408256-218408278 GAAACACCCTTTCCTGGAGATGG - Intronic
922742118 1:228019933-228019955 GGAAGCCCCTTGCCTGGGCACGG + Intronic
1067702978 10:48587086-48587108 GGCTCACCCTTATCTGGGCAGGG - Intronic
1069357879 10:67608794-67608816 AAAACACCCATTTCTGGCCAGGG + Intronic
1071290487 10:84185457-84185479 AGAACACCCTTAGCAGGGCAGGG - Intergenic
1071394165 10:85205338-85205360 GTAGCACCCATTTGTGGGCATGG - Intergenic
1072243619 10:93521179-93521201 GGAATTCCCTTTTCTAGCCAAGG + Intronic
1072799859 10:98385411-98385433 AGAACTCCCTTCTCTGGCCAAGG + Intronic
1074223417 10:111460542-111460564 GGATCACCCTGTCCTGGGAAAGG - Intergenic
1075614640 10:123882611-123882633 TGAACACCATTTTCTGGGGAAGG - Intronic
1078101519 11:8332978-8333000 GGAACGCGCTTTTCTGGGCCTGG - Intergenic
1079231074 11:18649289-18649311 GGAACAGTGTTTTGTGGGCAGGG - Intergenic
1081574017 11:44308495-44308517 GGAAAAACCTTCTCTGGGCCAGG - Intronic
1082188593 11:49214602-49214624 AGAAGAGCCTTTTCTGGGAATGG - Intergenic
1086677929 11:89632093-89632115 AGAAGAACCTTTTCTGGGAATGG + Intergenic
1087037434 11:93769353-93769375 GGAACTTCCTTTTGTGAGCAGGG - Intronic
1088720469 11:112587833-112587855 GAAATGCCCTTTTCTGGGTAGGG - Intergenic
1088790749 11:113224166-113224188 GGAATTCCCTTTTCTAGCCAAGG + Intronic
1089461288 11:118655850-118655872 GGAAAAACCTCTTCTGGGAAGGG - Exonic
1091561659 12:1619024-1619046 GGCACACACATTTCTGGGGAAGG + Intronic
1093103096 12:15051765-15051787 GGATCACCCTTTCCTGGCAATGG + Intergenic
1093704693 12:22261417-22261439 AGTACACCCTTGGCTGGGCATGG - Intronic
1093925868 12:24907760-24907782 GGAACAATTTTTTGTGGGCAGGG - Intronic
1098383506 12:69894884-69894906 GGTTCTCCCTTGTCTGGGCAGGG + Intronic
1098432344 12:70433727-70433749 GGAACACTTTCTGCTGGGCAAGG - Exonic
1098444465 12:70551948-70551970 GGAACACCCTTTTTTCCCCATGG - Intronic
1099302648 12:80917150-80917172 GGAAAAAGCATTTCTGGGCAAGG + Intronic
1099889398 12:88572523-88572545 TAAAAACACTTTTCTGGGCAGGG + Intronic
1100696845 12:97103507-97103529 AGAACACCCTTTTCAGCGAATGG - Intergenic
1103596590 12:122027907-122027929 GCAACGCCCTTTTTTGGGGAGGG + Intronic
1103929170 12:124440147-124440169 GGCACCCGCTTTTCTGGGGAGGG + Intronic
1103945907 12:124526375-124526397 GGAACACCCTTTACTTTACAGGG - Intronic
1106355599 13:28979869-28979891 GGAGCAACCTTTTTTGGGGAGGG + Intronic
1107975742 13:45687295-45687317 TGAATACCCTTTTCTGACCAAGG - Intergenic
1108553204 13:51567245-51567267 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
1109128962 13:58556429-58556451 GGATCCCCCTTCTCTGGGAATGG + Intergenic
1112019609 13:95360238-95360260 GGAACACCCTATTCTGTCTATGG - Intergenic
1114526646 14:23370730-23370752 TGAACACCCCCTCCTGGGCAAGG + Intergenic
1116011735 14:39359459-39359481 GGAACTCCCTTTCCTAGCCAAGG - Intronic
1118731584 14:68670561-68670583 GGAAAAGCCATTGCTGGGCATGG - Intronic
1118807390 14:69250112-69250134 GCTCCAGCCTTTTCTGGGCAGGG + Intergenic
1121181111 14:91929765-91929787 GGAACACCCTTTAATTAGCAAGG - Intronic
1123822330 15:24043414-24043436 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
1126039729 15:44578334-44578356 GGAGCCTCCTTTTCTGAGCAGGG + Intronic
1126658990 15:51012719-51012741 GGTACATCCTTGGCTGGGCATGG - Intergenic
1127233658 15:57023814-57023836 GGAAGACACTTTTCTGTGGATGG + Intronic
1128323295 15:66707024-66707046 GGACCCACCTCTTCTGGGCATGG + Intronic
1130364828 15:83225472-83225494 GGAATTCCCTTTTCTAGCCAAGG - Intergenic
1130774081 15:86959402-86959424 AGAACACCCATTTCCAGGCAGGG - Intronic
1131729509 15:95264890-95264912 GGAGCACTCTGTTCTGGGCTGGG - Intergenic
1132678739 16:1131120-1131142 GCAACACCCTCTTCCTGGCATGG + Intergenic
1132727170 16:1343921-1343943 GCAACACCCTTCCCCGGGCATGG - Intronic
1133564478 16:6980513-6980535 GGAAAACACTTTTCTGTTCATGG - Intronic
1134116461 16:11552648-11552670 GGAAGACCAATTTCTGGGGACGG + Intronic
1134745420 16:16584416-16584438 AGAACAGTCTTTGCTGGGCATGG + Intergenic
1135000051 16:18769347-18769369 AGAACAGTCTTTGCTGGGCATGG - Intergenic
1139340397 16:66264529-66264551 GGAACACTCTTCCCTGGACAGGG - Intergenic
1142378550 16:89719262-89719284 GGAACACGGTTTTCTGCGCAGGG + Intronic
1142985342 17:3691784-3691806 GGAACACCCATCTGTGGGAAGGG + Exonic
1143080583 17:4378300-4378322 AAAACACTCTTTTCTGGGCCAGG + Intergenic
1146600963 17:34215658-34215680 GGAACTCCCTTTCCTAGCCAAGG - Intergenic
1151592260 17:75053211-75053233 GGAACACCGTTTGCAGTGCAGGG + Intronic
1153357612 18:4155124-4155146 GGAACACCCTTCTCTGGCATGGG - Intronic
1153790975 18:8579126-8579148 GGAATTCCCTTTTCTAGCCAAGG - Intergenic
1155313439 18:24547396-24547418 GAAAGGCCCTTTTATGGGCATGG + Intergenic
1156494067 18:37514334-37514356 GGAACACTGTTTTCTGGCCCAGG + Intronic
1157746637 18:50141707-50141729 GCAAGACCCCTTTGTGGGCAAGG + Intronic
1157999456 18:52599304-52599326 CGAAAAACCTTTTCTGTGCAGGG + Intronic
1158841310 18:61390880-61390902 GGAAAACCTTTTTCTAGGCTTGG + Intronic
1163190331 19:15672792-15672814 TGAACACCCTTGTCTTGGAAGGG + Exonic
1164111268 19:22161433-22161455 GGAATTCCCTTTCCTGGCCAAGG - Intergenic
1164236094 19:23335732-23335754 GGAATTCCCTTTCCTAGGCAAGG - Intronic
1164757507 19:30701089-30701111 GGAACATCATTTTCAGAGCATGG - Intronic
1165255587 19:34575758-34575780 GGAAAGCCCTTGTCTGAGCAGGG + Intergenic
1165316187 19:35056749-35056771 GGATCACCCCTCACTGGGCATGG + Intronic
1165638412 19:37363442-37363464 GGAAAAGCCTTTTATGTGCAGGG + Exonic
1166443020 19:42832646-42832668 GGAATCCCCTTTTCTGGCCCAGG + Intronic
1166617761 19:44266260-44266282 GGTACAGCTTTCTCTGGGCAAGG - Exonic
928416218 2:31094272-31094294 GGAACAATGTTTTGTGGGCAGGG - Intronic
928612507 2:33004380-33004402 GGAATCCCCTTATATGGGCATGG + Intronic
930543689 2:52740477-52740499 GGAACAGACTTTTTTGGGAAAGG + Intergenic
931484005 2:62671848-62671870 GGAAAACCCTGTTAGGGGCATGG + Intergenic
932445375 2:71777711-71777733 AAAACCACCTTTTCTGGGCAAGG - Intergenic
936171484 2:110180777-110180799 GAAACATGGTTTTCTGGGCAGGG - Intronic
936866319 2:117079095-117079117 GGAACCCTCTATTCTGGGGATGG + Intergenic
936993214 2:118387495-118387517 GGTACCCCCTTCTCTCGGCAGGG + Intergenic
937400948 2:121583074-121583096 GAAACACCTTTGGCTGGGCACGG - Intronic
937693509 2:124781967-124781989 GGAGCACACTCCTCTGGGCAAGG - Intronic
938953313 2:136277145-136277167 AGAACACCTTTTTCTGGGGGTGG - Intergenic
940602057 2:155875186-155875208 GGAACTCCCTTTCCTAGCCAAGG + Intergenic
940898985 2:159108947-159108969 GGGAGCCCCTTTTCTGGACAAGG + Intronic
942753543 2:179314709-179314731 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
943466044 2:188230547-188230569 GGAACAATGTTTTGTGGGCAGGG + Intergenic
943628433 2:190223988-190224010 GGAATTCCCTTTCCTGGCCAAGG + Intronic
945630723 2:212272463-212272485 GGAACCCCCTTCTCTGGGCCTGG - Intronic
947630602 2:231650231-231650253 GAATCACCCTTGGCTGGGCATGG - Intergenic
948388576 2:237596740-237596762 GGGACACCCCATTCTGGCCAAGG + Intronic
1170026336 20:11892276-11892298 GGAAAGCCCTTGGCTGGGCAGGG - Intronic
1170411945 20:16101667-16101689 GGAACTGACTTTTCTGGGCTGGG + Intergenic
1172129045 20:32643747-32643769 TGAACACCCTTTTCTGCCCAAGG + Intergenic
1172407564 20:34701019-34701041 AGAGCCCCCTTTTCTGGGCTTGG + Intronic
1173648534 20:44648750-44648772 GGAACACACTTTGCTTAGCAAGG - Intronic
1174694466 20:52543161-52543183 GGAATTCCCTTTCCTAGGCAAGG + Intergenic
1175387108 20:58604517-58604539 AGAGCAGCCCTTTCTGGGCAGGG - Intergenic
1175458212 20:59131076-59131098 GAAACACTCTTTTGTGGGCAAGG + Intergenic
1176869140 21:14072673-14072695 GGCAGCCCCTTTGCTGGGCATGG - Intergenic
1176982278 21:15397198-15397220 TGATCACCCTTTTCTGGCTAAGG - Intergenic
1179048119 21:37864998-37865020 AGAACATCTTTTTCTGGGCCAGG - Intronic
1179290302 21:40012624-40012646 GGAACACCGATTTGCGGGCAGGG - Exonic
1179972473 21:44843953-44843975 GGAAAACCCTTGGCCGGGCACGG + Intergenic
1182385864 22:29940333-29940355 GGAACAAATTTTTGTGGGCAGGG - Intronic
949532053 3:4965956-4965978 GGAACTCCCTTTCCTAGCCAAGG + Intergenic
950517294 3:13475732-13475754 GGAACGTCCCTTTCTGGGGAGGG + Intergenic
951684454 3:25328757-25328779 GGAACTCCCTTTCCTAGCCAAGG + Intronic
951696805 3:25453594-25453616 GGACCACACTTTGCTGAGCAAGG + Intronic
953315790 3:41925305-41925327 GGAACTCCCTCTTCTAGCCAAGG + Intronic
953875862 3:46666580-46666602 GGAGCACCCTTTGCTGTGAAGGG - Intergenic
954492734 3:50922462-50922484 GGAATTCCCTTTCCTGGCCAAGG - Intronic
955417462 3:58705801-58705823 TGAATTCTCTTTTCTGGGCAGGG + Intergenic
959695452 3:109244941-109244963 GAAAAATCCTTGTCTGGGCATGG + Intergenic
964500189 3:157340256-157340278 GGAATTCCCTTTCCTAGGCAAGG + Intronic
965728352 3:171744320-171744342 GGAATCTCCTTTTCTTGGCACGG - Intronic
966437359 3:179903758-179903780 GGAGCACACTTTACTGGGAAAGG - Intronic
968130971 3:196192604-196192626 GGAAGGCCCTGGTCTGGGCATGG - Intergenic
969713519 4:8857826-8857848 GGAGCGCACTTCTCTGGGCAGGG - Intronic
970382928 4:15526075-15526097 GGAATCCCCTCTTCTGGGCTGGG + Intronic
972196147 4:36656228-36656250 GGATTTCCCTTTTCTGGCCAAGG + Intergenic
974356389 4:60818255-60818277 GGAACTTCCTTTTATGGGGATGG - Intergenic
976263055 4:83164273-83164295 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
977164306 4:93677007-93677029 GGAATTCCCTTTCCTGGTCAAGG + Intronic
978694834 4:111565358-111565380 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
979382079 4:120019095-120019117 GCAACAGGCTTGTCTGGGCAGGG - Intergenic
983292004 4:165819112-165819134 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
984233927 4:177133647-177133669 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
984739490 4:183146560-183146582 GGAACTTCCTTTTCTGGGACAGG + Intronic
985034241 4:185821885-185821907 CGAACACCTTCTTCTGTGCAAGG + Intronic
986750220 5:10780153-10780175 GGAATTCCCTTTCCTAGGCAAGG + Intergenic
988736750 5:34030217-34030239 TCAACACCCATTTCTGGGAATGG + Intronic
989649679 5:43673191-43673213 GGAATACCCTTTCCTAGCCAAGG - Intronic
989819213 5:45774908-45774930 GTAATAAACTTTTCTGGGCAGGG + Intergenic
990363865 5:55049297-55049319 GGAACACGCTCTTCTGGCCAAGG - Intergenic
996360152 5:122636693-122636715 GGAATTCCCTTTTCTAGCCAAGG - Intergenic
996625714 5:125568190-125568212 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
996812535 5:127533796-127533818 AGAACACCATTTTCAGGACATGG + Intronic
998541988 5:142991370-142991392 GGAATTCCCTTTCCTGGCCAAGG - Intronic
998602154 5:143595758-143595780 CTAGCCCCCTTTTCTGGGCAGGG + Intergenic
999748039 5:154607189-154607211 GGAATCCCCTTTTCCTGGCAGGG - Intergenic
1002058716 5:176613588-176613610 CGCACACCCTTTTCTGACCACGG + Intergenic
1002440641 5:179262633-179262655 GGAACACCCTTCCCAGGGCTGGG + Intronic
1003973267 6:11319266-11319288 CCAACGCCCTTTTCTGGGAATGG + Intronic
1006370437 6:33640781-33640803 GGCACACCCACTTCTGGCCAGGG + Intronic
1007819967 6:44554001-44554023 AGAAGACCCTTTTCTGGTCATGG + Intergenic
1008068138 6:47072374-47072396 TGAACACCCTTTGCTGGAGAGGG + Intergenic
1008589978 6:52984378-52984400 CAAACACCCTTTTCTGTCCAAGG - Intronic
1009777175 6:68219211-68219233 GGAACTCCCTCTTCTAGCCATGG - Intergenic
1010484246 6:76390743-76390765 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
1010912621 6:81578773-81578795 GGAATTCCCTTTTCTAGCCAAGG + Intronic
1011251570 6:85377418-85377440 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
1012129362 6:95471634-95471656 GGAATACCCTTTCCTAGCCAAGG + Intergenic
1015050056 6:128829683-128829705 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
1015205349 6:130631869-130631891 GAAAGACTCTTTTCTGGGCTGGG + Intergenic
1017019537 6:150129253-150129275 GAAATACCCTTGGCTGGGCATGG + Intergenic
1019268914 7:134920-134942 GGAAGACCCCTTTGTGGGAATGG - Intergenic
1024147168 7:46529464-46529486 GGTACACCCTTTTCTGCCTATGG + Intergenic
1024190579 7:47003030-47003052 GGAAAACTCTTGGCTGGGCATGG - Intergenic
1029621563 7:101693106-101693128 AGAACATCCTTGGCTGGGCACGG + Intergenic
1030589210 7:111459792-111459814 GGAACTCCCTCTTCAGTGCAGGG + Intronic
1030817482 7:114055154-114055176 GGAATTCCCTTTTCTAGCCAAGG + Intronic
1032508948 7:132456584-132456606 GTCACACACTTATCTGGGCATGG - Intronic
1033423919 7:141226208-141226230 GGAACACCCTCTTGGGGGGAGGG + Intronic
1036001294 8:4608028-4608050 GGAACACCCTTTTCTGGGCAAGG - Intronic
1036251098 8:7163276-7163298 GGAAAAGCCTTCTCTGGGCTGGG + Intergenic
1036366390 8:8124184-8124206 GGAAAAGCCTTCTCTGGGCTGGG - Intergenic
1036553397 8:9835557-9835579 TGCCCAGCCTTTTCTGGGCATGG - Intergenic
1038302451 8:26366079-26366101 GGAAAACTCCATTCTGGGCATGG - Intronic
1040476479 8:47782514-47782536 GGAACACCCTTTCCTGGTGAAGG - Exonic
1041750437 8:61254827-61254849 GGAATTCCCTTTTCTAGCCAAGG - Intronic
1041962901 8:63639878-63639900 TGAAGACCCTCTTCTGGGCCTGG + Intergenic
1041997673 8:64083876-64083898 GGAATTCCCTTTTCTAGCCATGG + Intergenic
1042173827 8:66019231-66019253 GGAATACCCTGTTCTAAGCAAGG + Intergenic
1043366392 8:79537678-79537700 GGAACTCCCTCTTCTAGACAAGG - Intergenic
1044548257 8:93483461-93483483 GGAATTCCCTTTCCTAGGCAAGG + Intergenic
1047653259 8:126947618-126947640 GAAACAACTTTTTCTGTGCAGGG + Intergenic
1048231289 8:132644566-132644588 GGAATTCCCTTTCCTAGGCAAGG + Intronic
1052027322 9:23588088-23588110 GGAGCACCCTCTGGTGGGCAGGG + Intergenic
1053234244 9:36438226-36438248 GCAACACCCTTGGCTGGACATGG - Intronic
1055338720 9:75259591-75259613 GGAATTCCCTTTTCTAGCCAAGG - Intergenic
1058746320 9:107994664-107994686 GGTTCACCCTTTGCTGGGGAGGG - Intergenic
1059149747 9:111938741-111938763 GGACCACCTTTTCCTGGGCTTGG - Intergenic
1190554814 X:51623351-51623373 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
1191016130 X:55811955-55811977 GGAATTCCCTTTTCTCGCCAGGG - Intergenic
1191175941 X:57501967-57501989 GGAATTCCCTTTTCTAGCCAAGG + Intergenic
1192097184 X:68224955-68224977 GGAATTCCCTTTCCTGGCCAAGG + Intronic
1192949163 X:75998042-75998064 GGATTTCCCTTTTCTAGGCAAGG - Intergenic
1195856237 X:109335728-109335750 GGAATTCCCTTTCCTAGGCAAGG - Intergenic
1198335831 X:135665446-135665468 GGAACTCCCTTTCCTAGCCAAGG - Intergenic
1198757249 X:139994923-139994945 GGAGTTCCCTTTTCTGGTCAAGG - Intergenic
1201915053 Y:19172704-19172726 GGAATACCCTTTCCTAGCCAAGG + Intergenic
1201991383 Y:20031162-20031184 GGAATTCCCTTTCCTGGTCAAGG + Intergenic