ID: 1036001296

View in Genome Browser
Species Human (GRCh38)
Location 8:4608033-4608055
Sequence CACCTGGAACACCCTTTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036001296_1036001307 27 Left 1036001296 8:4608033-4608055 CCCAGAAAAGGGTGTTCCAGGTG 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1036001307 8:4608083-4608105 TGTATTCGAAACCAACAACAAGG No data
1036001296_1036001305 4 Left 1036001296 8:4608033-4608055 CCCAGAAAAGGGTGTTCCAGGTG 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1036001305 8:4608060-4608082 CCCTGGGAGGAGATGGTGCTTGG No data
1036001296_1036001303 -3 Left 1036001296 8:4608033-4608055 CCCAGAAAAGGGTGTTCCAGGTG 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1036001303 8:4608053-4608075 GTGAAGGCCCTGGGAGGAGATGG No data
1036001296_1036001301 -9 Left 1036001296 8:4608033-4608055 CCCAGAAAAGGGTGTTCCAGGTG 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1036001301 8:4608047-4608069 TTCCAGGTGAAGGCCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036001296 Original CRISPR CACCTGGAACACCCTTTTCT GGG (reversed) Intronic
900751383 1:4400076-4400098 CCCCAGGAACTGCCTTTTCTTGG + Intergenic
902679914 1:18036073-18036095 TGCCTGGAACTCCCTTTCCTGGG - Intergenic
905395206 1:37662348-37662370 CACCTGGGACCCCCTTGCCTGGG + Intergenic
906286507 1:44591305-44591327 CACCTTGCACACCATTGTCTTGG - Intronic
907718212 1:56947550-56947572 ACCCTGGCACTCCCTTTTCTAGG + Intronic
915222392 1:154385434-154385456 CTTCTGGAGAACCCTTTTCTCGG + Intergenic
916887533 1:169084682-169084704 CACCAGGAAGACCATCTTCTGGG + Intergenic
922927765 1:229364627-229364649 CCCCTGGAACCCCCTTGTCCTGG + Intergenic
1070388314 10:75947003-75947025 CATCTGGAACTCAGTTTTCTAGG + Intronic
1074575411 10:114664287-114664309 CACCTGGCCCATCCTTTTGTAGG - Intronic
1074745480 10:116528139-116528161 CTCCTGAAAGACCATTTTCTTGG - Intergenic
1075622347 10:123937118-123937140 CACCTGGACTCCCCTTTACTTGG - Intronic
1076560454 10:131359946-131359968 CACCTGGAGGACACTTGTCTTGG - Intergenic
1077943018 11:6863787-6863809 GACCTGGAACCCACTCTTCTAGG - Intergenic
1078109548 11:8381646-8381668 CAGCTGGAACACCCTGTCCCTGG + Intergenic
1081690002 11:45071385-45071407 AGCCTGGAACACACATTTCTGGG + Intergenic
1084758643 11:71254203-71254225 CCCCTGGAACACCCCTTCCTAGG + Intergenic
1084886475 11:72211571-72211593 CACATGGAACACCATATTTTGGG + Intergenic
1088688141 11:112302164-112302186 CATCTGGAACACTATTTGCTTGG + Intergenic
1092167110 12:6348988-6349010 CATCTGGAAGACCCATTCCTAGG + Exonic
1096089519 12:48889642-48889664 CACCTGGAGCCCCGCTTTCTGGG + Intergenic
1097916377 12:65024615-65024637 CATCTGCAACAACCTTTGCTAGG + Intergenic
1100706187 12:97202971-97202993 CACCTGCAACCACATTTTCTTGG + Intergenic
1101314486 12:103616665-103616687 CTCCTTGTACACCCATTTCTGGG + Intronic
1102589368 12:113945896-113945918 CAACTGGAACACACTATTCATGG - Exonic
1104140858 12:125984434-125984456 TACCTAGAACAACATTTTCTTGG + Intergenic
1104766923 12:131336065-131336087 CATCGGGAACAGCCTTTGCTAGG - Intergenic
1106077981 13:26476999-26477021 CACTTGGAACTCCCTTCTCTTGG + Intergenic
1110077530 13:71267471-71267493 CACGTTGAAAACCATTTTCTAGG + Intergenic
1111061510 13:83025235-83025257 CACCTAGAGCTCCCTATTCTAGG + Intergenic
1113583937 13:111449762-111449784 AACCTGGAACACCCTGAGCTGGG - Intergenic
1114591550 14:23869542-23869564 CCCCTTGACCTCCCTTTTCTTGG - Intergenic
1116995534 14:51319833-51319855 CACCTGGGACACAGTTTTATGGG - Intergenic
1118481609 14:66173196-66173218 AACCTGATACACCCTTTTCTTGG + Intergenic
1119037137 14:71240037-71240059 GACCTTAAACACCCTTCTCTGGG - Intergenic
1120502418 14:85313065-85313087 CACGAGGAACACAATTTTCTGGG - Intergenic
1121248875 14:92484642-92484664 CACTTGGAACACCCTGGCCTTGG + Intronic
1121484529 14:94304441-94304463 CACCTGGAGCAGCCTTTTCCTGG - Exonic
1123151412 14:106185305-106185327 GACCTGGAGCATCCTTTTCTTGG - Intergenic
1123160874 14:106276953-106276975 CACCTGGAGGATCCTCTTCTTGG - Intergenic
1123195280 14:106610166-106610188 GACCTGGAGCATCCTCTTCTTGG - Intergenic
1123223138 14:106874987-106875009 GACCTGGAGCATCCTCTTCTTGG - Intergenic
1123399814 15:19973188-19973210 GACCTGGAGCATCCTTTTCTTGG - Intergenic
1125196987 15:37058270-37058292 CACCTGCAACACACATTTATAGG + Intronic
1126734239 15:51715497-51715519 CACATGGACCTCCCTTTCCTGGG - Intronic
1127122409 15:55783021-55783043 CCCTTGGAAAAACCTTTTCTGGG - Intergenic
1129545539 15:76391178-76391200 CAACTAGAATACCCTTTGCTTGG + Intronic
1129851861 15:78798096-78798118 GAGCTGGAACACACCTTTCTGGG + Exonic
1132586573 16:708146-708168 CACCTGGAGCACCCTTCACCTGG + Intronic
1133433860 16:5762449-5762471 AACGTGGAACAACCTTTTGTGGG + Intergenic
1133686556 16:8170686-8170708 CACCAGGAACACCAAATTCTTGG - Intergenic
1134320706 16:13160142-13160164 CACCTGGAACTCTCTTCCCTAGG - Intronic
1134683323 16:16141728-16141750 CACCTCTAACATCCTTGTCTGGG + Exonic
1137708408 16:50550068-50550090 GACCTGGAAGACCCCTTACTTGG + Intronic
1142511104 17:393980-394002 CACCTGGAACACTCTTGCCCTGG - Intergenic
1143473962 17:7192566-7192588 CCCCTGCCTCACCCTTTTCTGGG - Intronic
1143658848 17:8312621-8312643 CACCTGGAGCACCGTTCTCCTGG - Exonic
1150095583 17:62371870-62371892 CACTTAGAACATCTTTTTCTGGG - Intronic
1150443436 17:65210243-65210265 CACAAGGAAGACCCTTTTGTTGG - Intronic
1152467192 17:80473071-80473093 CACCTGGCAAACACTTTCCTTGG + Intronic
1153364778 18:4243139-4243161 CACCTAAAACACCAGTTTCTTGG + Intronic
1153898686 18:9594570-9594592 CACCTATATCACACTTTTCTGGG - Intronic
1154317841 18:13319761-13319783 CCCCTGGAATGCCCTTTTCATGG - Intronic
1158387394 18:57011144-57011166 CACATACAACACCCTTATCTAGG - Intronic
1158410677 18:57203035-57203057 CACCTGGTACACTCTCTTCAAGG + Intergenic
1160070884 18:75626705-75626727 CAGCAGGAACAGCCCTTTCTAGG - Intergenic
1160472419 18:79148406-79148428 CACCTGGAATAACCTGTACTGGG - Intronic
1161289925 19:3488155-3488177 CACCTGGACAAGCCTTTTCGGGG + Intergenic
1161860865 19:6797294-6797316 CACCTGCTACTCCCTTTGCTTGG + Intronic
1163531049 19:17849087-17849109 CTCCTGGAGCACCCTTTCCCTGG - Intergenic
1165106105 19:33470461-33470483 CACCCGAAACACACTTTTCTAGG + Intronic
1165219891 19:34307000-34307022 CGCCTGGAATCCTCTTTTCTGGG - Intronic
1165332049 19:35145398-35145420 CACATGGAACACCAGATTCTGGG + Intronic
1165657594 19:37548283-37548305 CACCTGGAACTAGCTTTTCATGG - Intronic
925378213 2:3404103-3404125 CACCTGGAACCCCTTTGCCTGGG + Intronic
928214149 2:29347316-29347338 CACCTGGAAAACCAGATTCTAGG - Intronic
928998408 2:37322018-37322040 AACCTGGAAAACTCTTTACTGGG - Intronic
929458249 2:42081775-42081797 GAACTGGAACACCATTTTGTAGG - Intergenic
939896929 2:147802843-147802865 TTCCTGGAATACCCTTTTCTAGG - Intergenic
940594976 2:155779663-155779685 AACCTGGAATTCTCTTTTCTGGG + Intergenic
941355055 2:164481010-164481032 CCCTTGTAATACCCTTTTCTTGG - Intergenic
945549367 2:211200519-211200541 GTCTTTGAACACCCTTTTCTAGG - Intergenic
946522365 2:220480583-220480605 CAAGTGGAGCACTCTTTTCTAGG + Intergenic
948447057 2:238040969-238040991 GACCTCGACCACACTTTTCTGGG + Intronic
1170040635 20:12035893-12035915 ATCCTGGAAGATCCTTTTCTAGG + Intergenic
1170355449 20:15487587-15487609 CCACTGGACCACCCTTTTTTAGG + Intronic
1170574103 20:17649670-17649692 CACCTTGAATACCGTTTCCTGGG + Intronic
1174093023 20:48064670-48064692 GGCCTGGAACAGCCTGTTCTGGG - Intergenic
1174392863 20:50228705-50228727 TGCCTGGAACACCCTTTTAGTGG + Intergenic
1176146726 20:63568789-63568811 CACCTCGAACACCGTATTGTCGG + Exonic
1176983579 21:15410389-15410411 CACTTAGCACAACCTTTTCTAGG + Intergenic
1177457166 21:21355337-21355359 CCCCTGCAACCCCCTTTTCCCGG - Intronic
1180610696 22:17095836-17095858 CACCTGGACCCTCCTTCTCTGGG - Intronic
1183502088 22:38186655-38186677 CATCTGGAACACTCTTTTCCTGG - Intronic
950187587 3:10954594-10954616 CACTTGGGACATCCTTTGCTAGG + Intergenic
950467706 3:13165150-13165172 CACCTGGAGCACACATTGCTGGG - Intergenic
953066750 3:39480275-39480297 CACATGGCTCACCCTATTCTAGG + Intronic
953205130 3:40820370-40820392 CACATGGAAGACACTTTACTGGG - Intergenic
956646372 3:71461354-71461376 CTCCTTGAACACTCGTTTCTGGG - Intronic
959895025 3:111595533-111595555 TGCCAGGAACATCCTTTTCTTGG - Intronic
961901649 3:130218758-130218780 CTCCTGGAATGCCTTTTTCTTGG + Intergenic
962381248 3:134899848-134899870 CACCTGGAAAGCCCTTTTCCTGG - Intronic
962471696 3:135714773-135714795 CACCTGGAAGACCCCTCTGTAGG + Intergenic
968737684 4:2305725-2305747 CACCTTGAACACCGTTGTCCTGG - Intronic
970767757 4:19571310-19571332 CACGTGTAAGACCCTGTTCTTGG + Intergenic
970827192 4:20290140-20290162 CAGCTTGAACACAGTTTTCTGGG + Intronic
971422004 4:26481983-26482005 CATGCGGATCACCCTTTTCTTGG + Exonic
972526939 4:39923200-39923222 CACCTGGAATTCCAGTTTCTGGG + Intronic
973766269 4:54166036-54166058 CTCCTGGAACACCGTCTTCAAGG - Intronic
975059929 4:69985066-69985088 CTCCTGGAATATCCCTTTCTGGG - Intergenic
976608147 4:87001871-87001893 AACCTTGAGCACCCTTCTCTTGG + Intronic
981003144 4:139847498-139847520 AAACTGGAACACTGTTTTCTGGG + Intronic
986674732 5:10173758-10173780 CACCTGCAACACCCTGACCTGGG - Intergenic
992956472 5:81914741-81914763 TGCCTAGAACACTCTTTTCTTGG - Intergenic
993302727 5:86232130-86232152 CAACTGAAACACACTTTCCTGGG - Intergenic
997965601 5:138353245-138353267 CTCCTGGGCGACCCTTTTCTCGG + Intronic
998628078 5:143868254-143868276 CACCTGGAACCCTGCTTTCTAGG - Intergenic
1007351317 6:41275603-41275625 AATCTTCAACACCCTTTTCTGGG + Exonic
1014986168 6:128013136-128013158 TTCTTGGAACACCCTTTTCCTGG + Intronic
1015145322 6:129978591-129978613 CCCCTGGAACACCCTTTAGGTGG + Intergenic
1015489034 6:133804623-133804645 CATCTGGGACACCGCTTTCTTGG - Intergenic
1017753475 6:157510342-157510364 CATCTGGAACATTCTTTTCAGGG - Intronic
1020734094 7:11924820-11924842 CACGTGGAACATACTGTTCTAGG - Intergenic
1024038178 7:45526378-45526400 CACCAGGATCACCCATTTCCAGG - Intergenic
1024787256 7:52922494-52922516 CAGATCTAACACCCTTTTCTGGG - Intergenic
1027201562 7:76067108-76067130 AACCTGGAACCCCCTTTTGATGG - Exonic
1027225987 7:76243961-76243983 CACCTGGAGGTCCCTTGTCTGGG - Intronic
1028265470 7:88718706-88718728 GACCAGGAAGACCCTTTTCTTGG + Intergenic
1031577853 7:123437799-123437821 CACCTGGAGCACACTTACCTAGG + Intergenic
1033665923 7:143440417-143440439 CACCTGGAAGACTCTTCCCTTGG + Intergenic
1036001296 8:4608033-4608055 CACCTGGAACACCCTTTTCTGGG - Intronic
1038146703 8:24904125-24904147 CACCTGGAAGATTCTTTCCTTGG + Intergenic
1039288114 8:36064687-36064709 CACCTAGATCATCCTTATCTTGG - Intergenic
1040622874 8:49109147-49109169 CACCTGGGACACACTTTTTCAGG + Intergenic
1042045872 8:64651013-64651035 CACCTCAAACACACTTTTATAGG - Intronic
1049841392 8:144775100-144775122 CACCTGGAACTCACTGTGCTGGG - Intronic
1050245056 9:3680718-3680740 CACCTGAAAAACTCTTCTCTGGG - Intergenic
1050418162 9:5435869-5435891 CACCTGGAACCCCATTAGCTGGG - Intronic
1050707657 9:8421599-8421621 CACCTGTATCACCCTAATCTTGG + Intronic
1056686127 9:88761742-88761764 CACCTGGACCAGCCTTTTTCAGG - Intergenic
1057488088 9:95501893-95501915 CACCTGGATCTCACCTTTCTGGG - Intronic
1059685742 9:116633969-116633991 CACGTGTAACATCCTTTCCTGGG - Intronic
1060011086 9:120043326-120043348 CACCCTGAACACCCCTTTCCTGG - Intergenic
1060561129 9:124544597-124544619 AACCTGGAGCACTCTTTTCCTGG - Intronic
1062149522 9:135010449-135010471 CACCTGGCAGTCCCTTTTCATGG - Intergenic
1062475415 9:136724319-136724341 TTACTGGAACACCTTTTTCTTGG - Intergenic
1062659425 9:137621050-137621072 CACCTGCAACTCCATCTTCTTGG - Intronic
1187231897 X:17431395-17431417 CATCTGGAACTGCCTTTCCTAGG + Intronic
1188460218 X:30416899-30416921 TACCAGGAACACCATATTCTGGG + Intergenic
1190327066 X:49213011-49213033 CTCCTGTATCACCTTTTTCTTGG - Intronic
1191716896 X:64199986-64200008 CACCAGGAAAGCCCATTTCTAGG - Intronic
1195658699 X:107357585-107357607 TGCCTGGAATACCCTTTCCTAGG + Intergenic
1196432257 X:115639095-115639117 CACCTGTAAAGCCCTTTTCAGGG + Intronic
1196609046 X:117690130-117690152 CACCAGGAACAGACTTTTCTTGG - Intergenic
1199083064 X:143597816-143597838 CACCTGCAATACCCATTTCATGG - Intergenic
1199760989 X:150903897-150903919 CACCTAGAGCAGCATTTTCTGGG - Intergenic
1199853298 X:151740390-151740412 CACCTGGAGCACCTCTCTCTAGG + Intronic