ID: 1036001297

View in Genome Browser
Species Human (GRCh38)
Location 8:4608034-4608056
Sequence TCACCTGGAACACCCTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036001297_1036001303 -4 Left 1036001297 8:4608034-4608056 CCAGAAAAGGGTGTTCCAGGTGA 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1036001303 8:4608053-4608075 GTGAAGGCCCTGGGAGGAGATGG No data
1036001297_1036001305 3 Left 1036001297 8:4608034-4608056 CCAGAAAAGGGTGTTCCAGGTGA 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1036001305 8:4608060-4608082 CCCTGGGAGGAGATGGTGCTTGG No data
1036001297_1036001301 -10 Left 1036001297 8:4608034-4608056 CCAGAAAAGGGTGTTCCAGGTGA 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1036001301 8:4608047-4608069 TTCCAGGTGAAGGCCCTGGGAGG No data
1036001297_1036001307 26 Left 1036001297 8:4608034-4608056 CCAGAAAAGGGTGTTCCAGGTGA 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1036001307 8:4608083-4608105 TGTATTCGAAACCAACAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036001297 Original CRISPR TCACCTGGAACACCCTTTTC TGG (reversed) Intronic
901940689 1:12659406-12659428 TCACCTAGAAGGCTCTTTTCCGG - Intronic
902679915 1:18036074-18036096 TTGCCTGGAACTCCCTTTCCTGG - Intergenic
907050821 1:51329227-51329249 TCTCCTGGAAACCACTTTTCTGG + Intronic
910015024 1:82511645-82511667 CCATCTGTAACACACTTTTCTGG + Intergenic
910824758 1:91394153-91394175 TCATCAGGAACACTCTTCTCAGG + Exonic
915317783 1:155039307-155039329 CCACCTGCAACACCCCCTTCTGG - Intronic
915320357 1:155052759-155052781 TCACCTGAAGCACCTTTTTGAGG - Exonic
916887532 1:169084681-169084703 TCACCAGGAAGACCATCTTCTGG + Intergenic
917202387 1:172531835-172531857 TCACCCTGAACTGCCTTTTCTGG - Intergenic
917469553 1:175314721-175314743 TAACCTTTAACAGCCTTTTCAGG - Intergenic
917469650 1:175315537-175315559 TAACCTTTAACAGCCTTTTCAGG - Exonic
918404623 1:184199582-184199604 TCAAGTGGAACCTCCTTTTCTGG - Intergenic
920822493 1:209394131-209394153 TCACTTGGACCACACTTTTTTGG + Intergenic
924039542 1:239971009-239971031 TCCCTTGGATCTCCCTTTTCTGG - Intergenic
1064454134 10:15471081-15471103 TCACCTCTAACACCTTTCTCAGG + Intergenic
1073054198 10:100688628-100688650 CCACCTTGAGCCCCCTTTTCTGG - Intergenic
1074110525 10:110419620-110419642 TCACCTGGATCCCCCTCATCTGG + Intergenic
1077627097 11:3782083-3782105 TCATTTGGAACACCCTTTGGGGG - Exonic
1080051553 11:27863996-27864018 TCACCTGAAATAGGCTTTTCAGG - Intergenic
1086447911 11:86887533-86887555 GCACATGGAACACCCCTTTACGG + Intronic
1088778047 11:113105282-113105304 TCACCTTGCACTCCCTTATCTGG + Intronic
1089588227 11:119523409-119523431 TCACAGAGAACACCCTTTTAAGG - Intergenic
1091217576 11:133912462-133912484 TCACTTAGCACCCCCTTTTCTGG - Intronic
1093114140 12:15188748-15188770 TCAGCTGAAAAACCCTTTTAAGG - Intronic
1097788042 12:63782816-63782838 GTTTCTGGAACACCCTTTTCAGG + Intronic
1104594227 12:130109565-130109587 TCAGGTGAAACACCCTTTCCTGG - Intergenic
1106710325 13:32324273-32324295 TGACCTGGAACAACTCTTTCAGG - Intronic
1114773237 14:25452800-25452822 TCACCTGGAACACCATTCTAAGG + Intergenic
1118088029 14:62441281-62441303 TCATCTGGAACTCCAATTTCAGG + Intergenic
1118415923 14:65536830-65536852 CAACCTGGAAAACACTTTTCAGG - Intronic
1121311035 14:92935066-92935088 TGCCCTGGAACATCCTTTGCAGG + Exonic
1126557428 15:50004524-50004546 ACACCTGGAACACAAGTTTCTGG - Intronic
1126734240 15:51715498-51715520 TCACATGGACCTCCCTTTCCTGG - Intronic
1129079208 15:73024383-73024405 ACACCTGAAGCACCCTTTTAAGG + Intergenic
1130989620 15:88868513-88868535 CCTCCTTGAAAACCCTTTTCTGG + Intronic
1131072197 15:89472904-89472926 TCACCAGGGACACCCTTGCCTGG - Intronic
1131342439 15:91615045-91615067 TTTCCTGGAACACTCTTTTATGG - Intergenic
1131899512 15:97072381-97072403 TCACCTGGAACCCCGTATTCTGG - Intergenic
1132586599 16:708225-708247 TCCCCTGGAGCACCCCTTCCTGG + Intronic
1132586776 16:709023-709045 TCACCTGGAAAACCCTCATCTGG + Intronic
1134683322 16:16141727-16141749 TCACCTCTAACATCCTTGTCTGG + Exonic
1137588777 16:49680757-49680779 GCACCTGGATCACCCTTGGCAGG + Intronic
1139389886 16:66600696-66600718 TTACCAGGAACACCTTATTCAGG + Intergenic
1143473964 17:7192567-7192589 TCCCCTGCCTCACCCTTTTCTGG - Intronic
1145815316 17:27791215-27791237 TCACATGGAAGGCCCTTTACAGG - Intronic
1146885654 17:36469171-36469193 TCACTTGGACCACCCCTTGCAGG + Intergenic
1147749330 17:42719117-42719139 TCATCTGGGACACCATTCTCAGG + Exonic
1148731560 17:49839883-49839905 TCAGCTGGAACACACGTTCCAGG - Exonic
1149387823 17:56159209-56159231 TCACATGGAATATCATTTTCTGG - Intronic
1152743841 17:82030336-82030358 TCACCTCGGCCACCCTTTCCTGG - Exonic
1153357615 18:4155130-4155152 CTGCCTGGAACACCCTTCTCTGG - Intronic
1153883154 18:9438160-9438182 TCACCAGGAGCCCCCTCTTCAGG - Intergenic
1158123604 18:54078030-54078052 GAACCTGGAACATCCTTTTCTGG + Intergenic
1158733044 18:60046865-60046887 TTTCGTGGAACCCCCTTTTCTGG + Intergenic
1158977912 18:62728901-62728923 ACACATGGAACCCCCTTCTCAGG - Intronic
1161289924 19:3488154-3488176 CCACCTGGACAAGCCTTTTCGGG + Intergenic
1161781941 19:6298658-6298680 ACACCTGGCACACCCTTGGCAGG + Intergenic
1164832874 19:31335980-31336002 TGAGCTGGGACACCGTTTTCAGG - Intronic
1165906174 19:39196267-39196289 TCACCTGGGACACCCCCTTGGGG - Intergenic
927630477 2:24769478-24769500 TCAGCTGGAACAGCTCTTTCTGG - Exonic
929086417 2:38171946-38171968 TATCATGGAACACCCTTCTCAGG - Intergenic
930773865 2:55153989-55154011 TCAAATGGCAAACCCTTTTCAGG + Intergenic
930898951 2:56480682-56480704 TCAGCTGGAAGACCCATTCCAGG - Intergenic
935950905 2:108327689-108327711 TCAACTTCAACACCCTTTCCTGG + Intergenic
935981946 2:108636250-108636272 TCACTGGGAACAGCCTTCTCTGG - Intronic
938977597 2:136494683-136494705 TCAGCTTCACCACCCTTTTCTGG - Intergenic
947834829 2:233167641-233167663 TCACCTGGCTCAACCTTGTCAGG - Intronic
948037690 2:234872594-234872616 TCACATGGGACACCCCTTGCAGG - Intergenic
948447056 2:238040968-238040990 TGACCTCGACCACACTTTTCTGG + Intronic
1168984430 20:2035936-2035958 TCACCTTGAACATCCCTTACAGG - Intergenic
1169854754 20:10090669-10090691 TCACCTTGAACACCATACTCAGG + Intergenic
1171984497 20:31650230-31650252 TCAACTGGAACACCACTTTGTGG + Intergenic
1172179799 20:32995714-32995736 TCTCCTGGTACAACCTTATCAGG + Exonic
1175537659 20:59726010-59726032 GCACATGGTACACCCTGTTCTGG - Intronic
1180207702 21:46272231-46272253 GCACCTGGAACTCCCTCTCCTGG + Intronic
1180610697 22:17095837-17095859 TCACCTGGACCCTCCTTCTCTGG - Intronic
1184956105 22:47887394-47887416 TCTCCTGGAGCCCCCTTCTCAGG + Intergenic
956646373 3:71461355-71461377 TCTCCTTGAACACTCGTTTCTGG - Intronic
957196293 3:77072409-77072431 TCACCTGAAAAACCAGTTTCAGG + Intronic
966571372 3:181447446-181447468 CCACCTAGAGCACCCTTTTCAGG - Intergenic
966988837 3:185207664-185207686 TCAGCTGGTGCACTCTTTTCTGG - Intronic
967613146 3:191532526-191532548 TCACCAGGAAAACCCATTTCTGG - Intergenic
975657117 4:76652684-76652706 TAACCTGGAATACCCTCTCCAGG - Intronic
977915121 4:102583609-102583631 ACTCCTAGAACACCCTTTTAAGG - Intronic
978962856 4:114705244-114705266 TCACATGGAACAGCCTGCTCTGG - Intergenic
981003143 4:139847497-139847519 TAAACTGGAACACTGTTTTCTGG + Intronic
982316457 4:154036913-154036935 TCACTTGGCACAGCCTTTTTAGG + Intergenic
984212082 4:176862149-176862171 TCACCTGAAAAACCCATATCTGG - Intergenic
986674733 5:10173759-10173781 TCACCTGCAACACCCTGACCTGG - Intergenic
997751921 5:136354954-136354976 TCTCCTGGGACACGTTTTTCAGG - Intronic
999156296 5:149459863-149459885 TCAACTGGACCACCCTTTTCCGG + Intergenic
1008101936 6:47401191-47401213 TCACTTGGAATACTTTTTTCTGG - Intergenic
1014168890 6:118256013-118256035 TCATCTGGAACAAACTTTTTTGG - Intronic
1015600710 6:134908192-134908214 TCACCTGGAGCAGGCTTTCCAGG - Intergenic
1016268951 6:142265976-142265998 TCATCTAGAACACTCTTCTCTGG + Intergenic
1017256755 6:152342054-152342076 CCACCTCGAACTCCCTTCTCTGG + Intronic
1017753476 6:157510343-157510365 GCATCTGGAACATTCTTTTCAGG - Intronic
1018488962 6:164272258-164272280 TTACCTGGAATACCCTTTCTAGG + Intergenic
1019307428 7:342495-342517 TCACCTCGAACACCTGTTTCTGG - Intergenic
1025212203 7:57026178-57026200 TTACTTGGAACACCCTTGGCTGG - Intergenic
1025659751 7:63550650-63550672 TTACTTGGAACACCCTTGGCTGG + Intergenic
1027225988 7:76243962-76243984 TCACCTGGAGGTCCCTTGTCTGG - Intronic
1033704856 7:143876526-143876548 TCACATGGAACAGCATCTTCGGG + Exonic
1036001297 8:4608034-4608056 TCACCTGGAACACCCTTTTCTGG - Intronic
1038122325 8:24631357-24631379 TCACCTCCAACACCCTCATCAGG - Intergenic
1039115241 8:34085324-34085346 TCTCCTGGAGAACCCATTTCAGG + Intergenic
1039595276 8:38786153-38786175 CCACCTGGAACACCTTATCCAGG + Intronic
1041575702 8:59392535-59392557 TCACCTGGCATATCCTTCTCAGG - Intergenic
1049302142 8:141877119-141877141 TCCCATTGAACACCCTTCTCTGG - Intergenic
1050418163 9:5435870-5435892 TCACCTGGAACCCCATTAGCTGG - Intronic
1052210524 9:25897673-25897695 TGATCTGGACCATCCTTTTCAGG + Intergenic
1057488089 9:95501894-95501916 TCACCTGGATCTCACCTTTCTGG - Intronic
1057863256 9:98658830-98658852 TCACCCAGAAGACCCTTATCTGG + Intronic
1058795492 9:108494141-108494163 ATACCTGGACCACCCTTTTCTGG - Intergenic
1059395451 9:114031537-114031559 TCACCTGGTCCACCCTGCTCCGG - Intronic
1059437311 9:114284510-114284532 CCAGCTGGAACACCCCTTTGGGG + Intronic
1059685743 9:116633970-116633992 TCACGTGTAACATCCTTTCCTGG - Intronic
1186321124 X:8426517-8426539 TCACCAGGAACTCACTTTTCTGG + Intergenic
1187610558 X:20938914-20938936 TGGCCTGGAACTCACTTTTCAGG + Intergenic
1193324613 X:80165155-80165177 TTACCTGTAACCTCCTTTTCAGG - Intergenic
1196432256 X:115639094-115639116 TCACCTGTAAAGCCCTTTTCAGG + Intronic
1199760990 X:150903898-150903920 TCACCTAGAGCAGCATTTTCTGG - Intergenic