ID: 1036001301

View in Genome Browser
Species Human (GRCh38)
Location 8:4608047-4608069
Sequence TTCCAGGTGAAGGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036001294_1036001301 -4 Left 1036001294 8:4608028-4608050 CCTTGCCCAGAAAAGGGTGTTCC 0: 1
1: 0
2: 0
3: 13
4: 199
Right 1036001301 8:4608047-4608069 TTCCAGGTGAAGGCCCTGGGAGG No data
1036001296_1036001301 -9 Left 1036001296 8:4608033-4608055 CCCAGAAAAGGGTGTTCCAGGTG 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1036001301 8:4608047-4608069 TTCCAGGTGAAGGCCCTGGGAGG No data
1036001297_1036001301 -10 Left 1036001297 8:4608034-4608056 CCAGAAAAGGGTGTTCCAGGTGA 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1036001301 8:4608047-4608069 TTCCAGGTGAAGGCCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036001301 Original CRISPR TTCCAGGTGAAGGCCCTGGG AGG Intronic
No off target data available for this crispr