ID: 1036005514

View in Genome Browser
Species Human (GRCh38)
Location 8:4657439-4657461
Sequence TCACGCACTCTTGGCATTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036005512_1036005514 -1 Left 1036005512 8:4657417-4657439 CCTCTCTGTCTCTCTTTCTCACT 0: 2
1: 13
2: 308
3: 3735
4: 10222
Right 1036005514 8:4657439-4657461 TCACGCACTCTTGGCATTCATGG No data
1036005511_1036005514 0 Left 1036005511 8:4657416-4657438 CCCTCTCTGTCTCTCTTTCTCAC 0: 2
1: 16
2: 310
3: 3249
4: 9235
Right 1036005514 8:4657439-4657461 TCACGCACTCTTGGCATTCATGG No data
1036005510_1036005514 4 Left 1036005510 8:4657412-4657434 CCTTCCCTCTCTGTCTCTCTTTC 0: 2
1: 127
2: 1182
3: 5895
4: 15823
Right 1036005514 8:4657439-4657461 TCACGCACTCTTGGCATTCATGG No data
1036005507_1036005514 30 Left 1036005507 8:4657386-4657408 CCTTTCTTTCTTATTCATGTCCA 0: 1
1: 2
2: 2
3: 54
4: 675
Right 1036005514 8:4657439-4657461 TCACGCACTCTTGGCATTCATGG No data
1036005508_1036005514 10 Left 1036005508 8:4657406-4657428 CCATTCCCTTCCCTCTCTGTCTC 0: 1
1: 6
2: 94
3: 711
4: 4710
Right 1036005514 8:4657439-4657461 TCACGCACTCTTGGCATTCATGG No data
1036005509_1036005514 5 Left 1036005509 8:4657411-4657433 CCCTTCCCTCTCTGTCTCTCTTT 0: 1
1: 16
2: 316
3: 2727
4: 11575
Right 1036005514 8:4657439-4657461 TCACGCACTCTTGGCATTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036005514 Original CRISPR TCACGCACTCTTGGCATTCA TGG Intronic
No off target data available for this crispr