ID: 1036007337

View in Genome Browser
Species Human (GRCh38)
Location 8:4681103-4681125
Sequence TGCTTTCATCTTCGTTAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 163}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036007337_1036007338 -5 Left 1036007337 8:4681103-4681125 CCTGATTAACGAAGATGAAAGCA 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1036007338 8:4681121-4681143 AAGCAAACAATTTTTGACATAGG No data
1036007337_1036007339 4 Left 1036007337 8:4681103-4681125 CCTGATTAACGAAGATGAAAGCA 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1036007339 8:4681130-4681152 ATTTTTGACATAGGCATGAATGG No data
1036007337_1036007340 26 Left 1036007337 8:4681103-4681125 CCTGATTAACGAAGATGAAAGCA 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1036007340 8:4681152-4681174 GCCAACAATACTTCTTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036007337 Original CRISPR TGCTTTCATCTTCGTTAATC AGG (reversed) Intronic
901082634 1:6592235-6592257 TGCTTTAACCTTCTTTAACCAGG + Exonic
902948168 1:19858938-19858960 TGCTTTCATCTTAGAAAATGTGG - Intergenic
907135250 1:52134511-52134533 TTCTTTTATTTTCTTTAATCTGG - Intergenic
907953001 1:59202314-59202336 TCCTTTCATCCTCATTAAACTGG + Intergenic
909270321 1:73615954-73615976 TTCTTTTTTCTTAGTTAATCTGG + Intergenic
910947795 1:92613098-92613120 TGCTTTCATCTGTGTGGATCAGG + Intronic
913376356 1:118156910-118156932 TGCTGTCATGTTCCATAATCTGG + Intronic
915808075 1:158876217-158876239 TGCTCTCATTTTCCTTACTCGGG + Intergenic
915813927 1:158947318-158947340 TGTATTCATCTTCCTTTATCTGG - Intronic
916492070 1:165310793-165310815 TGCTTTCATCTGCATTGCTCAGG + Intronic
918175603 1:182041596-182041618 TTCTTTAATCTCCTTTAATCTGG + Intergenic
919569857 1:199234482-199234504 TGTTTTCATTTTCATTCATCAGG - Intergenic
921043103 1:211453154-211453176 TGCTTTCTTCTTAGGTAATCTGG - Intergenic
1064561857 10:16601497-16601519 TCCTTTTTTCTTCTTTAATCAGG + Intronic
1065072240 10:22037719-22037741 TACTTTGATCTCCTTTAATCTGG + Intergenic
1065477047 10:26150257-26150279 TGCTTGCATCTTTGTTTATGAGG + Intronic
1066140185 10:32497279-32497301 CCCTTTCTTCTTCATTAATCTGG + Intronic
1066401832 10:35084320-35084342 TGCTTTAAGCTTTGTTATTCTGG - Intronic
1071777486 10:88805401-88805423 TGCTTTCAGCTCCTTGAATCTGG - Intronic
1072185694 10:93036410-93036432 TGCTTTCATATTGGTAAATATGG + Intronic
1072746568 10:97943715-97943737 TGCTTCCATTTTCGTAAATATGG + Intronic
1073561322 10:104499215-104499237 TGCTTGCATCTGCATTACTCTGG - Intergenic
1074131794 10:110585657-110585679 TTCTTTTATCTGCTTTAATCTGG + Intronic
1076417607 10:130302326-130302348 TTCTTTCAGTTTTGTTAATCTGG + Intergenic
1076939831 10:133595907-133595929 TTCTTACATCTTTGTTCATCAGG + Intergenic
1077662777 11:4084329-4084351 TACTTTCAGATTCTTTAATCAGG + Intronic
1077795978 11:5492660-5492682 TTCCTACATCTTTGTTAATCAGG + Intronic
1080034228 11:27695504-27695526 TGCTTTCATCTTGGTTCCTTTGG - Intronic
1080258167 11:30316359-30316381 GGCTTTCATTTTAGTTATTCTGG - Intergenic
1080926837 11:36766356-36766378 TTTTCTCATCTTCGTTAATCTGG + Intergenic
1085278237 11:75313668-75313690 TCATTTCATCTCAGTTAATCCGG - Intronic
1085713185 11:78848706-78848728 ATCTTTCATCTCCCTTAATCTGG + Intronic
1086606076 11:88698021-88698043 TGCTATCATCATCTTTCATCAGG + Intronic
1086906845 11:92428261-92428283 TGTTTTCTTCTTTGTTAGTCTGG + Intronic
1088445729 11:109925605-109925627 TGTTTGCATCTATGTTAATCAGG - Intergenic
1089134511 11:116238496-116238518 TGCTCACATCTTCGTTAACATGG - Intergenic
1090689161 11:129159306-129159328 TCTTTTCTTCTTCATTAATCTGG - Intronic
1090714437 11:129417588-129417610 TGCTTTCATCTCTGCTATTCAGG - Intronic
1094409177 12:30150863-30150885 TGCTTTTCTCTTCATAAATCTGG + Intergenic
1096380384 12:51152364-51152386 CTCTTTCATCTCCTTTAATCTGG - Intronic
1097977665 12:65705810-65705832 TGCTTTCAGCTTCCTAAATGTGG + Intergenic
1101287070 12:103325762-103325784 TGTTTTCCTCCTCCTTAATCTGG + Intronic
1102731443 12:115114438-115114460 TGCTTTCTTCATCCTTAAACTGG + Intergenic
1104716470 12:131019505-131019527 AGCTTTCATCTTCATTGACCTGG - Intronic
1105471337 13:20697878-20697900 TGCTTTAGTCTTCCTTAATCTGG - Intergenic
1110145171 13:72181816-72181838 TGCTTTCCACTTCATTACTCTGG + Intergenic
1112485163 13:99813044-99813066 TAATTTCTTCTTCTTTAATCTGG + Intronic
1115048398 14:29026266-29026288 TCTTTTCTTCTTTGTTAATCTGG + Intergenic
1115302117 14:31896123-31896145 TGCTTTCATTTTCCTTTTTCTGG - Intergenic
1116408637 14:44596958-44596980 TGCTTTCATTTTCTTTCAACAGG + Intergenic
1123569099 15:21583747-21583769 TTCTTTCATCTATGTTCATCAGG + Intergenic
1123605209 15:22019068-22019090 TTCTTTCATCTATGTTCATCAGG + Intergenic
1125959012 15:43813129-43813151 TGGTTTCCTCTTCGACAATCTGG + Exonic
1130237713 15:82152275-82152297 TGCTTTGATCTTCTTTCATTTGG + Exonic
1131071047 15:89466197-89466219 TGCTTTCTTCTTCATTCCTCTGG + Intergenic
1202977453 15_KI270727v1_random:310837-310859 TTCTTTCATCTATGTTCATCAGG + Intergenic
1134844213 16:17426131-17426153 TCCTTTCTTCTTCTTTAATGTGG - Intronic
1135207167 16:20493163-20493185 TTCTTTCATCTTCATTATTGTGG - Intergenic
1135211718 16:20530469-20530491 TTCTTTCATCTTCATTATTGTGG + Intergenic
1144230924 17:13202873-13202895 TGCTTACAGGTTAGTTAATCAGG + Intergenic
1145832290 17:27926304-27926326 TTCTTTAATTTTCTTTAATCTGG - Intergenic
1148045056 17:44738401-44738423 TGCTTTCATCTTCGATTTTGAGG - Exonic
1150004229 17:61459915-61459937 TGCTCTGATCTACGTTACTCAGG + Intronic
1150739140 17:67765574-67765596 TTCTTTCATCTGCTGTAATCGGG - Intergenic
1154945029 18:21154019-21154041 TGTTTGCATCTACGTTCATCAGG + Intergenic
1157230956 18:45915568-45915590 TGCTCTCATCTTTGGTAAGCTGG - Exonic
1157421619 18:47552174-47552196 TACTTTAATCTTGGTTAATCAGG - Intergenic
1157640797 18:49212183-49212205 TTCTTTCATCTTTTTTAATCTGG - Intronic
1158130362 18:54146282-54146304 TGCTTTCTTTTTCCTTAATATGG - Intergenic
1158743196 18:60167142-60167164 TGCTTTCTACTTCTTGAATCTGG + Intergenic
1158902359 18:61976139-61976161 TGCTTTCATTTTCATTTTTCTGG + Intergenic
1159821381 18:73149436-73149458 TTCTTTCAGCTTCCTGAATCTGG + Intergenic
927135962 2:20096724-20096746 GGCTTTCATCATCTTTTATCTGG + Intergenic
929062607 2:37938785-37938807 TCCTTTCTTCTTTATTAATCTGG + Intronic
929676746 2:43940848-43940870 TGCTGTCATCTCCATGAATCAGG + Intronic
930417675 2:51109348-51109370 TGCTTTGATCTTTGCTCATCAGG - Intergenic
1169960042 20:11149678-11149700 TCTTTTCTTCTTCATTAATCTGG + Intergenic
1170718676 20:18855668-18855690 TTCTTTCTTCTCCTTTAATCTGG + Intergenic
1170940338 20:20843489-20843511 TGCTTTCATATGCTTTAATTGGG + Intergenic
1173754233 20:45500735-45500757 TCCTTTAATCTTCTTTCATCTGG + Intergenic
1175044162 20:56088460-56088482 TGCCTCCATCTTCCTTACTCCGG + Intergenic
1177203447 21:17983551-17983573 GTTTTTCATCTTTGTTAATCAGG + Intronic
1177935101 21:27335287-27335309 TTTTTTCATCTACGTTCATCAGG - Intergenic
1178427028 21:32487092-32487114 TCCTTTCATCTTCATCATTCTGG - Intronic
1178827076 21:36025905-36025927 TGCTTTCAGCTTTGTTGATTGGG - Intergenic
1182408543 22:30160272-30160294 TTCTTTCATTTTCTTTAGTCAGG + Intronic
1183009755 22:34935172-34935194 TGCTTTCATCTGAGCTTATCTGG - Intergenic
949754052 3:7388782-7388804 TTCTTTTTTCTTTGTTAATCAGG + Intronic
952661067 3:35848035-35848057 TGTTTCCATCTTTGTTTATCTGG + Intergenic
953209769 3:40865458-40865480 TGCTTTCATTTGCTTTAATGTGG + Intergenic
955242577 3:57192059-57192081 TTTTTGCATCTTCGTTAATGAGG + Intergenic
957613530 3:82499054-82499076 TGTTTGCATCTTTGTTCATCAGG - Intergenic
958768622 3:98400370-98400392 TTCTCTCTTCTTGGTTAATCTGG - Intergenic
960182710 3:114600423-114600445 TGCTTTCTTTTTCTTTTATCTGG + Intronic
961668959 3:128513672-128513694 TGGTTTCTTCTTCATTGATCAGG + Intergenic
962098620 3:132317989-132318011 TCCTTTCACCTTTGTTTATCAGG + Intronic
963112233 3:141697237-141697259 TGCTTTTATCTTAATCAATCTGG - Intergenic
963916281 3:150861512-150861534 TGCCTGCATCTTCGCTATTCTGG - Intergenic
963976613 3:151487084-151487106 TCCTTTCTTCTTCATTAGTCTGG - Intergenic
964049128 3:152369898-152369920 TCTTTTCTTCTTCGTTAGTCTGG + Intronic
967636881 3:191812466-191812488 TTCTCTCTTCTTAGTTAATCTGG - Intergenic
970264767 4:14269820-14269842 TACTATCATCTTCCTTTATCAGG + Intergenic
976093071 4:81477191-81477213 TGTTTTCTTCTTAATTAATCTGG - Intronic
976888154 4:90011091-90011113 TTTTTACATCTACGTTAATCAGG - Intergenic
979052224 4:115949957-115949979 TTTTTGCATCTACGTTAATCAGG + Intergenic
979398615 4:120220078-120220100 TTTTTTCATCTTTGTTTATCAGG + Intergenic
979471440 4:121102749-121102771 TGTTTGCATCTGTGTTAATCAGG + Intergenic
980737660 4:136912280-136912302 TGCTTTTTTCCTTGTTAATCTGG + Intergenic
980743753 4:136988045-136988067 TGCCTTCATCCTAGTTACTCAGG + Intergenic
981593096 4:146387190-146387212 TTCTTGCATCTATGTTAATCAGG - Intronic
982523401 4:156448817-156448839 TGCTTTCATTTTAGGTAATTGGG + Intergenic
983965682 4:173807234-173807256 TGCTTTTATTTTACTTAATCTGG - Intergenic
984343876 4:178494872-178494894 TTTTTTCATCTACGTTCATCTGG - Intergenic
985149786 4:186934973-186934995 TGCTTTCATTTTCATTATCCAGG - Intergenic
985751434 5:1680134-1680156 TTCTTTTTTCTTGGTTAATCTGG + Intergenic
988195893 5:28005197-28005219 TGTTTTCTTCTTCATTAATCTGG - Intergenic
988551106 5:32201670-32201692 TTCTCTAATCTTCTTTAATCTGG - Intergenic
990422727 5:55652740-55652762 TTTTGTCATCTTCTTTAATCTGG - Intronic
992590549 5:78291706-78291728 CTCTTTAATCTTCTTTAATCTGG - Intronic
996251079 5:121333231-121333253 TGCTTTCATATGTGATAATCTGG + Intergenic
996280399 5:121723261-121723283 TGTTTTCTTCTTTATTAATCTGG + Intergenic
997171515 5:131726554-131726576 TCTTTTCTTCTTCATTAATCTGG + Intronic
999704856 5:154262885-154262907 GTCTTTCATTTTCTTTAATCTGG - Intronic
999970158 5:156850904-156850926 TGCTTTCTTGTTCCTGAATCCGG - Intergenic
1000264833 5:159625481-159625503 TTCTTTCATCTATGTTCATCAGG - Intergenic
1001167024 5:169378462-169378484 TTTTTGCATCTACGTTAATCAGG - Intergenic
1002764854 6:230474-230496 TGCTTTCCATTTCCTTAATCAGG + Intergenic
1004804556 6:19188467-19188489 TGATTTCTTTTTCCTTAATCTGG + Intergenic
1006208637 6:32373574-32373596 TGCTTTGATCGTCTTCAATCCGG - Intergenic
1007491712 6:42228286-42228308 GGCCTCCATCTTCATTAATCAGG - Exonic
1008367278 6:50697048-50697070 TGCTTTCTTAATAGTTAATCAGG - Intergenic
1008732767 6:54502584-54502606 TGTTTGCGTCTTTGTTAATCAGG - Intergenic
1009264411 6:61535043-61535065 TCCTTTCTTCTTTATTAATCTGG - Intergenic
1009989993 6:70830919-70830941 TGCTCTCTTCTTGATTAATCTGG + Intronic
1010988759 6:82455803-82455825 TTCTTTCATCTACGTTCATCAGG + Intergenic
1012754737 6:103213467-103213489 TGGTTTTATCTTTCTTAATCAGG - Intergenic
1014064567 6:117110292-117110314 TGCTTTCATGTCCCTTAATCAGG + Intergenic
1020759633 7:12252699-12252721 TGTTTTCTTCTTCATTATTCTGG - Intergenic
1021691849 7:23238181-23238203 CTCTTTCGTCTTCTTTAATCTGG - Intronic
1022396360 7:29990584-29990606 TGTTTTGATTTTTGTTAATCTGG - Intergenic
1022573258 7:31473774-31473796 TGCTTCCTTCTTCCTTAAACAGG + Intergenic
1024778527 7:52817610-52817632 TCCTTTTATCTTCATGAATCTGG - Intergenic
1027831642 7:83184361-83184383 TTTTTTCATCTACGTTCATCAGG + Intergenic
1028798936 7:94938575-94938597 TTCTGTCATCTTCCTTAATGTGG + Intronic
1028945849 7:96579512-96579534 TCCTTTCCTCTTTGTAAATCTGG - Intronic
1030422483 7:109325555-109325577 AGCTTTCATCTTCATTATTATGG - Intergenic
1030428753 7:109415062-109415084 TCCTTTTATCTTGATTAATCTGG - Intergenic
1030705335 7:112686940-112686962 TTTTTTCTTCTTCATTAATCTGG + Intergenic
1030958945 7:115890584-115890606 TGTTTTCTTCTTTGTTAGTCTGG - Intergenic
1031801324 7:126249575-126249597 TGTTTTCAACTTGGTTTATCAGG + Intergenic
1032227517 7:130044974-130044996 TGCTTTATTCTCCTTTAATCTGG - Intronic
1036007337 8:4681103-4681125 TGCTTTCATCTTCGTTAATCAGG - Intronic
1036474631 8:9081978-9082000 TGCCTTCATCTTAGTCCATCTGG + Intronic
1036479341 8:9124452-9124474 TTTTTTCATCTTCTTTCATCAGG - Intergenic
1038500868 8:28042481-28042503 TGATTTCATCTTTGTTACTTCGG + Intronic
1038659927 8:29488227-29488249 TCCTTTGATCTTGGCTAATCTGG + Intergenic
1043215962 8:77588374-77588396 CTCTTTAATCTTCTTTAATCTGG - Intergenic
1045170121 8:99656489-99656511 TCCTTTAATCTTAGTTTATCTGG + Intronic
1052717443 9:32134050-32134072 GTCTTTCATCTCCTTTAATCGGG + Intergenic
1056506971 9:87266723-87266745 TGCTATTGTCTTTGTTAATCAGG - Intergenic
1058564707 9:106270094-106270116 TGCTGTCATCTTCTTTAGTTTGG - Intergenic
1058690567 9:107517016-107517038 TTGTTTCATCTTCATTAACCTGG + Intergenic
1060356279 9:122911523-122911545 TGCTTTCCTCTTCTTTAACATGG + Exonic
1188151055 X:26675996-26676018 TGCTTCCATCTTATTTCATCTGG + Intergenic
1188613141 X:32124245-32124267 TGATTTCCTCTTCCTTAATCTGG - Intronic
1190802803 X:53807694-53807716 TGTTTTTTTCTTAGTTAATCTGG - Intergenic
1192989925 X:76439850-76439872 TTTTTGCATCTACGTTAATCAGG + Intergenic
1193690726 X:84638585-84638607 TTTTTGCATCTACGTTAATCTGG - Intergenic
1193827804 X:86247763-86247785 TTTTTCCATCTACGTTAATCAGG - Intronic
1193840391 X:86401756-86401778 TTCTTTCATCTATGTTCATCGGG - Intronic
1195457187 X:105082363-105082385 TATTTTCTTCTTTGTTAATCTGG + Intronic
1196680217 X:118462736-118462758 TGCTTTAATCTCCTTTAATCTGG - Intergenic
1198680455 X:139176289-139176311 TCTTTTCTTCTTCTTTAATCTGG + Intronic
1201866518 Y:18661410-18661432 TGCTTTCATCTTCTTTTTTAAGG - Intergenic