ID: 1036007338

View in Genome Browser
Species Human (GRCh38)
Location 8:4681121-4681143
Sequence AAGCAAACAATTTTTGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036007337_1036007338 -5 Left 1036007337 8:4681103-4681125 CCTGATTAACGAAGATGAAAGCA 0: 1
1: 0
2: 0
3: 10
4: 163
Right 1036007338 8:4681121-4681143 AAGCAAACAATTTTTGACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036007338 Original CRISPR AAGCAAACAATTTTTGACAT AGG Intronic
No off target data available for this crispr