ID: 1036012550

View in Genome Browser
Species Human (GRCh38)
Location 8:4743469-4743491
Sequence GACGCTCCGGTGTTTCTGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036012550 Original CRISPR GACGCTCCGGTGTTTCTGAC CGG (reversed) Intronic
902393178 1:16118152-16118174 GACACTCAGGTGTGTCTGTCTGG - Intergenic
1064741974 10:18443258-18443280 GACACTAGGGTGTTTCTCACTGG - Intronic
1069763574 10:70834180-70834202 CTCCCTCCGGTGATTCTGACAGG - Intronic
1077465646 11:2732589-2732611 GAGGCACCGGTGCTTCCGACGGG + Intronic
1092589906 12:9943314-9943336 GACGACCCGGTTTTTCTGAGGGG + Intergenic
1106170691 13:27285685-27285707 GGGGCTCCAGTCTTTCTGACAGG + Intergenic
1112244043 13:97712764-97712786 GAAGCTCAGCTGTTTGTGACTGG - Intergenic
1116731921 14:48633767-48633789 AACTCTCCTGTGTTTATGACTGG - Intergenic
1117585175 14:57194198-57194220 GACCCTCTGGAGTTTCTGTCAGG - Intergenic
1132259864 15:100414122-100414144 GATTCTCTGGTGTTTCTGTCAGG - Intronic
1143393876 17:6576631-6576653 CACGCTTCTGTGTTTCTGAGAGG - Intergenic
1145207374 17:20991814-20991836 GACGCTCCGGTTTTGCTTCCCGG + Intergenic
1159754519 18:72348052-72348074 GGCACTCCTGTGTTTCTGCCCGG - Intergenic
1168169153 19:54574795-54574817 GACCCTCCAGTGTGTCTCACAGG + Exonic
949077207 2:242068245-242068267 GAAGCACCAGTGTTTCGGACAGG - Intergenic
1174355687 20:49996371-49996393 GACCACACGGTGTTTCTGACAGG - Intergenic
1181465171 22:23107019-23107041 CACGCTCAGCTGTTTCTGGCAGG + Intronic
981937940 4:150254478-150254500 CACGCCCCTGTGCTTCTGACAGG + Intronic
996836737 5:127801976-127801998 GAAGCTCAGCTGTTTGTGACTGG + Intergenic
1015908625 6:138144350-138144372 GATGCTCAGGTGTTTCTTTCTGG + Intergenic
1018959952 6:168441142-168441164 GAAGCTCCGGGGTATTTGACAGG + Exonic
1023883338 7:44334094-44334116 CTCGCTCCGTTGTTTCTGCCAGG - Intronic
1034203321 7:149295699-149295721 GAGGCTCAGGTGTTTGGGACTGG - Intronic
1035179969 7:157082127-157082149 GTCCCTCCGGTGTCTCTTACAGG - Intergenic
1036012550 8:4743469-4743491 GACGCTCCGGTGTTTCTGACCGG - Intronic
1199609689 X:149601890-149601912 GACACTCCAGTGTTACTGGCGGG - Intronic
1199629427 X:149767462-149767484 GACACTCCAGTGTTACTGGCGGG + Intergenic