ID: 1036016686

View in Genome Browser
Species Human (GRCh38)
Location 8:4793157-4793179
Sequence TCCATGATCAAGGACATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036016686 Original CRISPR TCCATGATCAAGGACATTGA AGG (reversed) Intronic
902359198 1:15932901-15932923 TCCATCATCAATGACATTTCTGG + Exonic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906328194 1:44861980-44862002 TCCAGGATCAAGGACTTTACTGG + Intronic
909688247 1:78375230-78375252 TCCAAGATCAGGCACATTCAGGG + Intronic
911781355 1:101883549-101883571 GACATTATCAAGGACATTAAGGG - Intronic
923336718 1:232977264-232977286 GGCATGAACAAGGACAATGAAGG - Intronic
923346347 1:233056841-233056863 TCCATGATCCAGGATCTAGAAGG - Intronic
1063296435 10:4811351-4811373 TCCATTAACAAGGACACTGATGG - Intronic
1067333025 10:45339264-45339286 GCCATGATCAAGGACTTGAAAGG + Intergenic
1068118797 10:52763253-52763275 TTCCTGACCAAGGACACTGAAGG + Intergenic
1071172880 10:82888326-82888348 TCCATGATCAAATATGTTGAGGG + Intronic
1071536924 10:86441109-86441131 TCTAGGAGCAAGGGCATTGAGGG - Intronic
1071921666 10:90357206-90357228 TCCATCATCAAGGAGGTTGTTGG + Intergenic
1072156060 10:92724767-92724789 TCAAATATCAAGGAAATTGAAGG - Intergenic
1072272497 10:93790425-93790447 GCGATGATAAAGGACTTTGACGG + Intronic
1079529292 11:21430102-21430124 TCCATAAGCAAGTACATGGAAGG + Intronic
1081053928 11:38384836-38384858 TCCATCTTCAAGGAAATTCAAGG - Intergenic
1081356124 11:42116568-42116590 TGCATGGTCAAGGACTTGGATGG - Intergenic
1082201343 11:49373373-49373395 TACATGATCATGGAAAGTGAAGG + Intergenic
1082663471 11:55945030-55945052 TCCATGATCCATGAGATTGTTGG + Intergenic
1085103161 11:73818811-73818833 TTAATGAACAAGAACATTGAAGG + Intronic
1086974956 11:93120994-93121016 TCCCTCATCAGTGACATTGAAGG + Intergenic
1093780935 12:23136594-23136616 TTAATGATCAGTGACATTGAGGG + Intergenic
1094392434 12:29966116-29966138 TCCAAGATTAATGACATTTATGG - Intergenic
1094738822 12:33265119-33265141 GCCATCATCATGGACCTTGATGG + Intergenic
1095296341 12:40531461-40531483 TCCATAAGCCAGGACACTGAAGG - Intronic
1099137580 12:78927239-78927261 TCCAGCATCAAGGACAGAGATGG - Intronic
1101712951 12:107285761-107285783 TGCATAATCAAGGAGATGGATGG + Intergenic
1101733658 12:107446680-107446702 TCCAGGATTAAGGACTTTGCTGG - Intronic
1102432257 12:112892757-112892779 GCCATGAGTAAGGACAGTGATGG - Intronic
1103569035 12:121831953-121831975 TTCAAGATCAAGGAAATTGGTGG + Exonic
1105293652 13:19070692-19070714 TCCATGTTCAAAGCCAGTGATGG + Intergenic
1106865384 13:33958851-33958873 TCCATGATCTAGGACATGCCTGG + Intronic
1107599988 13:42003552-42003574 TCCATAATCAAGAACATAAAAGG + Intergenic
1114874289 14:26696545-26696567 TCCAAGATCAAGGTCTTGGAAGG + Intergenic
1115607301 14:35016557-35016579 TCCCTGAAGAAGGACATTTAAGG - Intronic
1116128246 14:40817673-40817695 TCCTTGAACAAGGTTATTGATGG - Intergenic
1119805274 14:77478231-77478253 TGCATGATCAAGGTGAGTGAGGG - Exonic
1120758639 14:88266849-88266871 TCCATGATGCAGGTCAGTGACGG - Intronic
1126352710 15:47761777-47761799 TAAATGATTAATGACATTGAAGG + Intronic
1129114901 15:73359905-73359927 TCCATGAACAGGGGCATTAATGG + Intronic
1131624710 15:94105045-94105067 TCCCTGACCAAGTATATTGAGGG - Intergenic
1133525455 16:6601000-6601022 TCCCTGAGAAAGGACATAGAAGG + Intronic
1133922132 16:10162862-10162884 TCCATGAACCAGGACAGGGATGG + Intronic
1135947774 16:26880089-26880111 TGAATGACCAAGGCCATTGATGG - Intergenic
1146994376 17:37305693-37305715 TCCATGCTCAATGGCATTGTTGG - Intronic
1148904517 17:50903687-50903709 TCCATGAGCAGGGACTTTGAGGG + Intergenic
1149349365 17:55771714-55771736 TTCATAAACAAGGACATTGAGGG - Intronic
1151858975 17:76744784-76744806 TCCATGGGCAAGGAAATAGAAGG + Intronic
1152979751 18:265871-265893 AACATTATCAAGGACCTTGAGGG - Intronic
1155722851 18:29040829-29040851 TCTATGATAATGGACATTAAAGG + Intergenic
1157426809 18:47591313-47591335 TCCATGACCATGGAAATGGAAGG - Intergenic
1163174916 19:15557497-15557519 TCCCTCCTCAAGGACATGGAAGG + Intergenic
1165135878 19:33668340-33668362 TCCATGATGAAGGCCAGCGAAGG - Intronic
1168447180 19:56429812-56429834 TCCATTATCCAGGATATTAAAGG + Intronic
925766212 2:7238176-7238198 TTCCTGATCAATGACAGTGAAGG + Intergenic
926875319 2:17470227-17470249 TCAAAGATCAAGGACAGAGAGGG - Intergenic
927373213 2:22382086-22382108 TCAATGATCAAGCTTATTGAGGG - Intergenic
932635887 2:73387113-73387135 TCCATCATCACAGACAGTGAAGG + Intronic
935960962 2:108425080-108425102 GCTATGATCAAGCACATTGATGG - Intergenic
943792526 2:191949848-191949870 TCCAAGATCAAGGGAAATGATGG - Intronic
944273888 2:197813297-197813319 TGCAAGTTCAAGGACATTGATGG - Intronic
945364434 2:208934133-208934155 TTGATGATCAATGATATTGAGGG + Intergenic
1169308631 20:4516505-4516527 TCCATTATCAAAGACAAAGATGG - Intergenic
1170116812 20:12869280-12869302 GCCATGATGCAGGACATGGAAGG + Intergenic
1171878248 20:30598089-30598111 TCCATGTTCAAAGCCAGTGATGG + Intergenic
1172369458 20:34377011-34377033 TCCATCAACAAGGACACTGTTGG - Intronic
1178504825 21:33153892-33153914 TCCAAGAACAAGCACAGTGATGG - Intergenic
1178666256 21:34549670-34549692 TCCAAGATGGAGGACAATGATGG + Intronic
1184161384 22:42699506-42699528 CCCATGACCAAGGGCATTGAAGG - Intronic
1184196988 22:42936432-42936454 TCCATGAACAAGGGAACTGAAGG - Intronic
951066153 3:18267953-18267975 TCCCTGATCCATGACATGGAAGG - Intronic
951692376 3:25409881-25409903 TCCCTGATAAAGAACACTGAAGG - Intronic
955534420 3:59907905-59907927 TCCATCTTTAAGGCCATTGATGG + Intronic
958469691 3:94501420-94501442 TAAATGATCAAGGATAATGATGG + Intergenic
959132762 3:102378114-102378136 ACCATTATCAAGGCCATTAAAGG + Intronic
959377876 3:105607296-105607318 TCCATGTTCAAGGACAGGAAGGG + Intergenic
966307054 3:178548336-178548358 TCCATGATCAAGGTCATGCTTGG - Intronic
967073376 3:185981348-185981370 TCCCTGAGCAAGGACAGAGATGG + Intergenic
968351812 3:198063226-198063248 TCCCTGAACAAAGACACTGAAGG + Intergenic
969891460 4:10263949-10263971 TCCATGATCTGGGACACTGCTGG + Intergenic
972694920 4:41435664-41435686 TTGATGAGCAAGAACATTGAGGG + Intronic
974421811 4:61685455-61685477 TCTATGATAAAGAACAATGAAGG + Intronic
979340645 4:119519141-119519163 TGCATGACCAAAGACATTGGAGG + Intronic
979493565 4:121358754-121358776 GCCATGATCAAGGACATTTCTGG - Intronic
980391003 4:132146464-132146486 TCCAGTATCAAGGACCTTGGAGG + Intergenic
980707926 4:136523767-136523789 TACAAGATCAAGCATATTGATGG + Intergenic
982036108 4:151347642-151347664 ACCAAGTTCAAGGATATTGATGG - Intergenic
990159671 5:52923871-52923893 TCCATGAAGAAGGACAGAGATGG - Intronic
991075941 5:62538369-62538391 CCCATGATCAAGGGGATTGTAGG + Intronic
992014369 5:72560650-72560672 TCCAGTATCAAGGGCATTGGTGG + Intergenic
993946252 5:94120267-94120289 TCCAAGATCAAGGTCATGGCAGG + Intergenic
997716621 5:136047545-136047567 TCCATGTTCAAGGGCATTCAGGG - Intronic
998453190 5:142250460-142250482 TCCATGGTCACTGATATTGATGG + Intergenic
1000003424 5:157162051-157162073 TCCATGTTCAGGGGCATTCAGGG + Exonic
1000129434 5:158281356-158281378 ACCATCATCAATGACTTTGAGGG + Intergenic
1002895140 6:1374648-1374670 TCCATGATCATGGTAAATGAGGG - Intergenic
1003394374 6:5740721-5740743 CACATTATCCAGGACATTGAAGG + Intronic
1004597241 6:17111811-17111833 TCCAAGATCAAGGCAATGGAAGG + Intronic
1004708067 6:18142910-18142932 TCCCTGAGCAAGGAGAGTGATGG - Intronic
1004805252 6:19197179-19197201 TCCATGATCTAGGATAATGAAGG + Intergenic
1004911706 6:20291929-20291951 TCCATGTTTAAGGAGGTTGAAGG + Intergenic
1005469411 6:26147304-26147326 TCCATGATTCAGGAATTTGAGGG - Intergenic
1008608881 6:53167538-53167560 TCCATTCTCAAGGACCTTAATGG - Intergenic
1009341994 6:62567344-62567366 TCCATTATCTGGCACATTGAAGG - Intergenic
1009545762 6:65018252-65018274 TCCATGATCAAGGTCTTGGCAGG + Intronic
1013789181 6:113816378-113816400 TACATGCTGAAGGAAATTGAGGG + Intergenic
1013823396 6:114182631-114182653 TCCATGAACAAAGACAGTAAAGG + Intronic
1020631364 7:10644126-10644148 TCCATGAACCTGGACATTGTGGG + Intergenic
1021971604 7:25970589-25970611 TCCACGATCAAGGCTATGGAAGG + Intergenic
1023379768 7:39595237-39595259 TCCAAGGTTAAGGACATTGCTGG + Intronic
1023756904 7:43427819-43427841 TCCATCATCAAAGCCATTGATGG + Intronic
1028364566 7:90012510-90012532 TCTATGACCGATGACATTGAAGG + Intergenic
1029306619 7:99624446-99624468 TCCATGATTAAAGACACTGAGGG + Intronic
1030674535 7:112370697-112370719 TCTATGATGAAGCCCATTGAAGG - Intergenic
1030770575 7:113469990-113470012 TCCATGATCAAGGTCCTGAAAGG - Intergenic
1031295686 7:120000061-120000083 TCCATTATCAAATACATTAAAGG + Intergenic
1032171553 7:129588694-129588716 TCTATGATTCTGGACATTGAAGG - Intergenic
1032670769 7:134080562-134080584 TCAGTGATCAAGGAGAATGACGG + Intergenic
1032720757 7:134549319-134549341 TCCATGCTCCAGGACACTGGAGG + Intronic
1033985979 7:147226108-147226130 AACATGCTCAAAGACATTGAGGG - Intronic
1036016686 8:4793157-4793179 TCCATGATCAAGGACATTGAAGG - Intronic
1037030824 8:14102467-14102489 TCCATGATCAAGGATCTGGTGGG + Exonic
1037243297 8:16802959-16802981 TCCTTGGTTAAGGACATAGAGGG + Intergenic
1037401266 8:18497435-18497457 TCCATGACCAATCACATGGAGGG + Intergenic
1044704217 8:94993062-94993084 TCCAAGATCAAGGTGTTTGAAGG + Intronic
1045425156 8:102058905-102058927 TCCATCTTCAAAGACAGTGACGG - Intronic
1047376634 8:124304222-124304244 TGCTTTATTAAGGACATTGAAGG - Intergenic
1048563975 8:135574467-135574489 TCCACGATCATTGACATTGTTGG - Intronic
1052101093 9:24447064-24447086 TCCCTGATGTAGGACAGTGAAGG + Intergenic
1054702765 9:68430566-68430588 TCCAGGCCCAAGGACATTAAAGG + Intronic
1055024922 9:71709380-71709402 TCCATATTCCATGACATTGATGG - Exonic
1056343388 9:85663085-85663107 TCCCTGATTGAGGACATAGAGGG + Intronic
1057266778 9:93622540-93622562 TCCATGTTCAAAGCCAGTGATGG - Intronic
1057989685 9:99755686-99755708 TCCAAGATCAAGAACAGGGAAGG + Intergenic
1058347496 9:103981180-103981202 TCCAGGATCAAGGAACTTGCAGG - Intergenic
1197018359 X:121655212-121655234 TTCCTCATCAAGGACCTTGAAGG - Intergenic
1197238858 X:124100725-124100747 ACCAAGATCAAGTGCATTGAGGG + Exonic
1198482852 X:137056782-137056804 TCCTTGATCAGGGACATCCAGGG + Intergenic
1198885041 X:141326409-141326431 AACATAATCAAGGACATTTATGG + Intergenic
1198886594 X:141345093-141345115 TTCATAAACAAGGACACTGAGGG + Intergenic
1198916148 X:141674430-141674452 TCCATTATCAAGGAGTTTCAAGG + Intronic