ID: 1036020739

View in Genome Browser
Species Human (GRCh38)
Location 8:4842591-4842613
Sequence GCACCCGGGTTCCCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1036020739_1036020744 18 Left 1036020739 8:4842591-4842613 CCTGCTGCAGGGAACCCGGGTGC 0: 1
1: 0
2: 2
3: 18
4: 194
Right 1036020744 8:4842632-4842654 TCAGTAGTGTTCTTCTCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1036020739 Original CRISPR GCACCCGGGTTCCCTGCAGC AGG (reversed) Intronic
900485144 1:2919228-2919250 AGAGCCGGCTTCCCTGCAGCTGG + Intergenic
900589660 1:3454030-3454052 TCACACGGGTTCCCAGCAGGCGG + Intergenic
900612534 1:3550270-3550292 CCACCCGGGTGCCCACCAGCGGG + Intronic
901627306 1:10631509-10631531 GCTCCAGGGGTCCCTCCAGCAGG - Intergenic
901820973 1:11829313-11829335 GCACTGGGGTTACCTGGAGCTGG - Exonic
902577856 1:17389612-17389634 GCTCCTGGATTCCCTGAAGCCGG - Intronic
905010656 1:34744966-34744988 GCACCAGTGTGCCCAGCAGCTGG + Intronic
905223742 1:36466386-36466408 GGACCCGGATCCCCTGCAGGAGG + Exonic
905258722 1:36702587-36702609 GCACCCTGGTTCCCTGACGCTGG + Intergenic
908774233 1:67624989-67625011 ACTCCCAGCTTCCCTGCAGCTGG - Intergenic
910758166 1:90712404-90712426 GCACCAGGGGCCGCTGCAGCTGG + Exonic
912381242 1:109249400-109249422 GCGCCAGGATTCCCTCCAGCAGG - Intergenic
914821470 1:151107603-151107625 GCACCCGGGTTCACCGCGCCCGG + Intronic
918342911 1:183582018-183582040 GCCCCCTCGTTCCCTGCTGCAGG + Intronic
919865679 1:201781218-201781240 CCACCCTGGTTCCCTGAAGAAGG + Exonic
920834967 1:209502314-209502336 ACACCCTGCTTCCCTGGAGCTGG - Intergenic
921800636 1:219399067-219399089 GCACCCTTGTTGGCTGCAGCAGG + Intergenic
1063070397 10:2657160-2657182 GCAGCCTGGGTCCCTGCGGCAGG - Intergenic
1063666124 10:8061816-8061838 GCACCAGGGTGCCCAGGAGCCGG + Intronic
1069686967 10:70324631-70324653 TCAGCCGGGTTCCCAGCAGAGGG - Intronic
1070952588 10:80443030-80443052 GCACCCGCTTTCCCAGGAGCTGG - Intergenic
1071961869 10:90814971-90814993 GGACCTGGGTTCCCAGCAGGAGG - Intronic
1073301545 10:102473975-102473997 GCAGCCAGGTGCCCAGCAGCGGG - Exonic
1074182748 10:111078038-111078060 GCCCATGGGCTCCCTGCAGCCGG + Exonic
1075475769 10:122732170-122732192 GCACAGAGGTTCCCTGCACCTGG - Intergenic
1075568145 10:123519631-123519653 ACTCCCTGGTTCCCCGCAGCAGG - Intergenic
1075608477 10:123833284-123833306 GCACATGGGTTCCCTACACCAGG - Intronic
1076066898 10:127455951-127455973 GCACACTGCTTCACTGCAGCTGG + Intergenic
1076497176 10:130904840-130904862 GCAGCTGGCTTCCCTGCTGCTGG + Intergenic
1076530835 10:131143251-131143273 GCACCCAGGGTCCCTGCAGGCGG + Intronic
1076915284 10:133420309-133420331 GCAACTGGGGTCCCTGGAGCTGG - Exonic
1080120211 11:28668163-28668185 GCATCCTGGTTCCCTGCCTCTGG + Intergenic
1080553624 11:33396150-33396172 GCACCCATGTTCCGGGCAGCAGG + Intergenic
1083618331 11:64036921-64036943 CAACCACGGTTCCCTGCAGCTGG - Intronic
1083677164 11:64332548-64332570 GCTCCGGGGCTGCCTGCAGCAGG + Intergenic
1083679144 11:64343289-64343311 CCAGCCGGGTTCGCAGCAGCAGG - Exonic
1083770510 11:64864382-64864404 GCACCCGGACTCCCTGCAGCTGG + Intronic
1084529631 11:69719237-69719259 GCTCCCGGGGTGCCTGGAGCTGG - Intergenic
1085539461 11:77253512-77253534 GTACCCTGCTTCCCTGGAGCTGG - Intronic
1088877363 11:113947078-113947100 GCACCTGGGTTCTCTCCAGTGGG - Intergenic
1089370860 11:117955847-117955869 ACACTCTGGTTCCCTACAGCTGG - Intergenic
1091657031 12:2353501-2353523 GCCCTGGGGCTCCCTGCAGCAGG + Intronic
1095954032 12:47796366-47796388 GCTCCCGGGTCTCCTGCACCAGG - Intronic
1101433262 12:104644501-104644523 ACACCTGGGCTCCCTGCAGCTGG + Intronic
1102097302 12:110250652-110250674 GCACTGGGGATCCCTGCAGGAGG - Intergenic
1103465236 12:121137146-121137168 GCAACCGGGTTCGCTGGAGTAGG + Intronic
1103918856 12:124389251-124389273 GCAGCCGTGTCCCCCGCAGCCGG + Intronic
1104845621 12:131845328-131845350 GCACCTGGTGTCCCTGCAGCCGG + Exonic
1104959347 12:132480864-132480886 GCCCCAGGCTTCCCTGCAGCTGG + Intergenic
1104961691 12:132491001-132491023 GCACCCAGGGTCCCTGGAACGGG - Intronic
1105708547 13:22983425-22983447 GGTCCTGGGTTCCCTGCTGCTGG - Intergenic
1111911019 13:94311981-94312003 GCTCCAGGTTTTCCTGCAGCTGG + Intronic
1112384865 13:98930322-98930344 GCAGCTGTGTGCCCTGCAGCTGG + Intronic
1112561851 13:100522175-100522197 GACCCAGGGTTCCTTGCAGCGGG + Intronic
1113018944 13:105860199-105860221 TCACCAGGCTTCCTTGCAGCGGG - Intergenic
1114635023 14:24182478-24182500 GCCCCAGGGACCCCTGCAGCTGG - Intronic
1116803401 14:49466882-49466904 GCACCGTGATTCCCTGGAGCAGG - Intergenic
1118813192 14:69290399-69290421 GAACCCAGGCTGCCTGCAGCTGG + Intronic
1119407785 14:74409558-74409580 GGACCCAGGGTCCCTGCAGCTGG - Exonic
1122024801 14:98867923-98867945 GCACCCAGAATGCCTGCAGCAGG + Intergenic
1122149450 14:99717124-99717146 GGACCTGGGTTCCCAGCTGCAGG - Intronic
1122249517 14:100428068-100428090 GAAGCCAGGTTCCCTGCAGCAGG + Intronic
1122281389 14:100624472-100624494 GCACCGGGTCTCCCTGAAGCAGG - Intergenic
1122876166 14:104666364-104666386 GCTCCCAGCTCCCCTGCAGCAGG + Intergenic
1131367472 15:91853178-91853200 GCACCCGGGTTCCCGAGCGCCGG + Intergenic
1132317353 15:100899677-100899699 GCACCCTTGACCCCTGCAGCTGG - Intronic
1132364986 15:101251071-101251093 GCACCCGGGATGCCGGCCGCCGG + Intronic
1132663896 16:1073086-1073108 GCACACGGGGTGCCTGCAGATGG - Intergenic
1132915132 16:2340114-2340136 GCGCCCGGCATCCCTGCGGCCGG + Intronic
1133056400 16:3147551-3147573 GTACCCGGGCTCCCTGGAGAAGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1135585844 16:23670187-23670209 TCACCTTTGTTCCCTGCAGCAGG - Exonic
1136654335 16:31700857-31700879 GCGCCCGGGGTCCCAGCTGCCGG - Intergenic
1137271809 16:46907201-46907223 TCCCCCGGCTTCTCTGCAGCTGG - Intronic
1137585931 16:49664154-49664176 GAGCCCGGGTTCCCAGCACCCGG + Intronic
1139507114 16:67404344-67404366 GCACCAGCCTTCCCTTCAGCTGG + Intronic
1139776686 16:69320830-69320852 GCACCCGGGCTGCCAGCAGCAGG - Intronic
1142849505 17:2697567-2697589 GCACCGGGGGTCCCCGCCGCTGG - Intronic
1142849569 17:2697840-2697862 GCGCCCGCACTCCCTGCAGCTGG + Intronic
1144429964 17:15182142-15182164 ACACCAAGGTTCTCTGCAGCGGG - Intergenic
1144648619 17:16991772-16991794 CCACACGGGTTTCCTACAGCCGG - Intergenic
1144958426 17:19031428-19031450 TCACCCGGCTTCCCAGCATCTGG + Intronic
1144976732 17:19143096-19143118 TCACCCGGCTTCCCAGCATCTGG - Intronic
1146277044 17:31522737-31522759 GACCCCGGGTTTCCTGCAGGCGG + Intronic
1146905099 17:36613135-36613157 GCACCCCAGATCCCTGCTGCAGG + Intergenic
1148215931 17:45834053-45834075 GGACCCGGGGGCCCTGCAGCGGG + Intronic
1148608017 17:48944759-48944781 AGACCCGGGGTCCCGGCAGCCGG - Exonic
1152025067 17:77803493-77803515 GAGCCCAGGTTCCCTGTAGCTGG - Intergenic
1153871629 18:9326211-9326233 AGACCTGAGTTCCCTGCAGCAGG - Intergenic
1157276396 18:46313849-46313871 GCACATGGGCTGCCTGCAGCCGG - Intergenic
1157555911 18:48612794-48612816 CCACCTGGGCCCCCTGCAGCGGG + Intronic
1157619558 18:49008491-49008513 CCACCTGGGTCCCCTGCAGCAGG + Intergenic
1158404807 18:57151619-57151641 GCACCCTGGTTTCCTGCATGGGG - Intergenic
1160785271 19:897475-897497 GCACCTGGATTTCCTGCCGCCGG - Exonic
1160870337 19:1275064-1275086 AGTCCCGGGTTCCCTGTAGCAGG + Intergenic
1161843190 19:6694622-6694644 GCCACTGGGGTCCCTGCAGCAGG + Exonic
1162760313 19:12885105-12885127 GTCCCCGGGTCCCCTGCATCTGG + Intronic
1163362272 19:16854435-16854457 CCACCTGGGTACCCTCCAGCTGG + Intronic
1163602427 19:18257158-18257180 GGACCCTGGCTCCCTGCAGTGGG - Exonic
1163813658 19:19450424-19450446 GCACCAGCGTTCCCTGAAGAGGG - Intronic
1163851932 19:19669128-19669150 ACACCCGGGGTCCCGGCGGCTGG - Intronic
1167045172 19:47045450-47045472 GCACGCGGGCTTCCTGCCGCCGG + Exonic
1167391342 19:49196948-49196970 ACTCCCGGCTTCCCCGCAGCTGG + Intronic
925104980 2:1283314-1283336 GCACCCCGGTCCCAAGCAGCCGG - Intronic
925196934 2:1933211-1933233 TCACCTGGGTTCTCTGCAGAAGG - Intronic
925340235 2:3131055-3131077 GCCCCCGGGGTCCCTCCAGCTGG - Intergenic
925880227 2:8346003-8346025 TCACACAGGTTCCCTGCAGTTGG - Intergenic
927575750 2:24200693-24200715 GCACCTGGCCTCCCTGCAGAAGG + Intronic
928412568 2:31066295-31066317 GCACCTGGGTGCTCTACAGCTGG - Intronic
931872922 2:66481102-66481124 GCATCCTGATCCCCTGCAGCAGG + Intronic
932415702 2:71572758-71572780 GCATGGGGGTTCCCTGGAGCAGG + Intronic
933277932 2:80302958-80302980 GCACCTGCAGTCCCTGCAGCTGG - Exonic
936340783 2:111630874-111630896 GTAACCGGGTTCCCTGCAGGTGG - Intergenic
936519026 2:113200263-113200285 GCACCCAGGATCCCTGAAGCAGG - Intronic
937093977 2:119224045-119224067 GAACCCGGTTTCTCTGCCGCCGG - Intronic
937217903 2:120324225-120324247 ACACCAGGCTTCCCTCCAGCAGG - Intergenic
937253736 2:120540550-120540572 GCAACCCTGTTCCCTGGAGCTGG + Intergenic
938554894 2:132415963-132415985 GCAGCCGCTTTCCCGGCAGCGGG - Intergenic
941896979 2:170639029-170639051 GCCCCAGGGTCCCCTGCTGCAGG + Intronic
943475831 2:188354010-188354032 GTACCCTGCTTCCCTGGAGCTGG + Intronic
948638847 2:239360442-239360464 GCACCCTGCCTTCCTGCAGCAGG + Intronic
948746116 2:240095553-240095575 GCACCAGGGGCCCCTGCACCCGG - Intergenic
948987379 2:241533625-241533647 GCACAGGGGCACCCTGCAGCTGG - Intergenic
1172987124 20:39000684-39000706 GCTCCTGGGTTTCCTGGAGCAGG + Intronic
1174139151 20:48400666-48400688 GCTCCCGGGTGACCTGCAGCTGG - Intergenic
1175159239 20:56995676-56995698 GCCCACGTGTTCCCTGCCGCTGG + Intergenic
1176147087 20:63570366-63570388 GCACCTGCGTGACCTGCAGCAGG - Intronic
1176366943 21:6039124-6039146 ACCCCCGGGGCCCCTGCAGCAGG + Intergenic
1178526221 21:33331504-33331526 GTACCCCGCTTCCCTGGAGCTGG + Intronic
1179756575 21:43499422-43499444 ACCCCCGGGGCCCCTGCAGCAGG - Intergenic
1179822234 21:43943634-43943656 GCACCTCGGTTCCCTGCGCCTGG + Intronic
1180979280 22:19871214-19871236 GCAGCTCGGCTCCCTGCAGCCGG + Intergenic
1182773705 22:32815278-32815300 GCACATGGGTTCCCTGCACTGGG - Intronic
1183903199 22:41021709-41021731 TCTCCCGGTTTCCCTGCCGCAGG + Intergenic
1184528371 22:45038985-45039007 GCTCCTGGGCTCCCTTCAGCAGG - Intergenic
1184768359 22:46584211-46584233 GAACCCGGGCTCCCTGCAGAAGG - Intronic
1184841982 22:47057388-47057410 CCACCCTGGTTCCCTGCACCTGG - Intronic
1184876166 22:47277127-47277149 GCTCCCCTGTTCCCTGCTGCCGG + Intergenic
1185085402 22:48738100-48738122 GCAGCCAGGCTCACTGCAGCAGG - Intronic
950630102 3:14276625-14276647 GCAGCTGGAGTCCCTGCAGCTGG + Intergenic
953030729 3:39178114-39178136 GCACGGGGGTGCCCTGCTGCGGG - Intergenic
953363374 3:42321041-42321063 GCACCCGGCTTCCCCGCCACTGG - Intergenic
953929518 3:46998988-46999010 GCACCAGGGAACCGTGCAGCAGG - Exonic
955747168 3:62151563-62151585 GCACCCGGGATCCTTGAAGGTGG + Intronic
960586122 3:119322870-119322892 GCACCCGGGACCCCCGCGGCCGG - Intronic
962199579 3:133390358-133390380 GGACCTGGTTTCCCTGCAGTGGG - Intronic
964720390 3:159763911-159763933 GGACCCGGGCTCCCAGCCGCGGG + Intronic
966851953 3:184170154-184170176 GCACCCGGGCTTCCCGGAGCTGG + Exonic
967147786 3:186620679-186620701 GCACCTGGACTCCCTCCAGCTGG + Exonic
968463792 4:739587-739609 GCACCCAGGTCCACTGCCGCAGG - Intronic
968940368 4:3634493-3634515 CAACCCGTGGTCCCTGCAGCAGG + Intergenic
969592142 4:8127963-8127985 GCACCAGGGTTCCCTGAAATGGG + Intronic
969895827 4:10303570-10303592 CTACCTGGGTTCCCTGCAGAGGG + Intergenic
972341358 4:38155131-38155153 GGACCCGGGGGCACTGCAGCGGG - Intergenic
973889057 4:55351196-55351218 GTACCTGTGTTCCCTGCTGCTGG - Intronic
975072456 4:70158694-70158716 GCAACAGGGGCCCCTGCAGCAGG - Exonic
975578508 4:75886356-75886378 GCACCCGGTTTCCCAGGAGGAGG - Intronic
982351204 4:154416994-154417016 GCGTCCGTGATCCCTGCAGCTGG - Intronic
983904568 4:173169590-173169612 GCACCCCGGCTCCCCGCCGCCGG - Intronic
985552297 5:539879-539901 GCACCGGGGCTCCCTGCAGCGGG + Intergenic
986167488 5:5287923-5287945 GCATCCAGGTTCGCTGCAGGAGG + Intronic
986215738 5:5717213-5717235 GCACACAGGTTACATGCAGCAGG - Intergenic
990310273 5:54531102-54531124 GCACCCTGGCTCCCTGAGGCAGG + Intronic
992300008 5:75368394-75368416 GCACGCAGATTCCCTGCTGCTGG + Intergenic
997625764 5:135329602-135329624 GCACCCGGGATCCCCACATCAGG - Intronic
1000040187 5:157479563-157479585 GCTCCTGTCTTCCCTGCAGCAGG - Exonic
1002201737 5:177532629-177532651 GCACCCGGGATCCCTGATGATGG + Exonic
1003570131 6:7250549-7250571 GCACAGGGGTCCCCAGCAGCAGG - Exonic
1010379140 6:75206304-75206326 GCAGCCGGGTTCCCTGCCAAGGG + Intergenic
1013453772 6:110311080-110311102 GGCCCCGGGTTCCCAGCACCAGG - Intronic
1013616398 6:111847132-111847154 GGCCCCTGGTTCCCAGCAGCTGG + Intronic
1013810531 6:114039863-114039885 GCACCTGGATTCACTGCTGCTGG + Intergenic
1016873433 6:148840838-148840860 GCACCCGGGTGTCCAGCTGCTGG - Intronic
1018895447 6:168013358-168013380 GGGCCCGGGATCCATGCAGCTGG + Intronic
1019648279 7:2142494-2142516 TCACGCGGGTTCTCTGCTGCCGG + Intronic
1019925047 7:4186356-4186378 GCACGAGGGGTCCCAGCAGCCGG - Intronic
1023812949 7:43926505-43926527 CCGCCCGGGTCCCCGGCAGCGGG + Exonic
1024993689 7:55255096-55255118 GGAGCCGGGTTCCCTGCCGGTGG + Intronic
1026904155 7:74053276-74053298 GCACCTGGGATCCCAGCACCTGG - Exonic
1028984475 7:96998872-96998894 GGCCCCTGGTTCCCTGCAGACGG + Intergenic
1031484634 7:122311932-122311954 GCAGCCCGGGTCCCCGCAGCTGG - Intergenic
1034852535 7:154508361-154508383 GGACTGGGGTTCCCTCCAGCTGG + Intronic
1035041040 7:155927359-155927381 GCTCCCAGGGTCCCTGCAGGAGG - Intergenic
1035182041 7:157096591-157096613 CCACCAGGGTTCCCTGCTCCTGG - Intergenic
1035729777 8:1845875-1845897 TGCCCAGGGTTCCCTGCAGCAGG + Intronic
1036020739 8:4842591-4842613 GCACCCGGGTTCCCTGCAGCAGG - Intronic
1037919202 8:22792301-22792323 GCATTAGGGTTCCCTGCTGCAGG + Intronic
1040531884 8:48272570-48272592 GCAGCTGGGTGCCCTGCAGGTGG + Intergenic
1042253062 8:66775388-66775410 GCCCCCGGGGTCCCTCCACCTGG - Intronic
1048577090 8:135701414-135701436 GCACCCTGCTTCCCTGGAGCTGG - Intergenic
1049229972 8:141476890-141476912 GCACCCGCTGTCCCTTCAGCTGG + Intergenic
1051523877 9:18020716-18020738 TCACCCGGGTTCCTTGGAACAGG + Intergenic
1059426716 9:114225802-114225824 GTCCCCCGGGTCCCTGCAGCCGG + Intronic
1060105438 9:120870059-120870081 GCAGCCAGGCTCCCGGCAGCTGG - Intronic
1060726402 9:126008766-126008788 GGAGCAGTGTTCCCTGCAGCTGG + Intergenic
1061943954 9:133898106-133898128 GCATCCGGGTACCCTGAGGCTGG + Intronic
1062044382 9:134418298-134418320 GGACCCAGGTCCCCAGCAGCAGG - Intronic
1062210184 9:135359413-135359435 GATCCCGGTGTCCCTGCAGCTGG - Intergenic
1062296030 9:135827482-135827504 TCAGCCAGGGTCCCTGCAGCAGG + Exonic
1062406618 9:136399858-136399880 GCACGCGGGCGCCCTGCAGCCGG + Intergenic
1062416585 9:136454238-136454260 GCCCCCGGGGCCCCTGGAGCCGG - Exonic
1203760772 EBV:12351-12373 GCACCCGAGGTCCCAGCACCCGG + Intergenic
1203761701 EBV:15423-15445 GCACCCGAGGTCCCAGCACCCGG + Intergenic
1203762630 EBV:18495-18517 GCACCCGAGGTCCCAGCACCCGG + Intergenic
1203763559 EBV:21567-21589 GCACCCGAGGTCCCAGCACCCGG + Intergenic
1203764488 EBV:24639-24661 GCACCCGAGGTCCCAGCACCCGG + Intergenic
1203765417 EBV:27711-27733 GCACCCGAGGTCCCAGCACCCGG + Intergenic
1203766346 EBV:30783-30805 GCACCCGAGGTCCCAGCACCCGG + Intergenic
1203767275 EBV:33855-33877 GCACCCGAGGTCCCAGCACCCGG + Intergenic
1203787631 EBV:136694-136716 GCACCCGGGTCCCCGCCCGCGGG - Intergenic
1189646274 X:43136067-43136089 TCACCCACATTCCCTGCAGCTGG + Intergenic
1194517407 X:94871838-94871860 GCACTCGGCTTGCCTTCAGCAGG + Intergenic
1194810250 X:98380261-98380283 GCCCCAGGGTGCCCAGCAGCAGG - Intergenic
1197293090 X:124684482-124684504 GCACCAGGGTTCCCTGGGGTGGG - Intronic
1200207007 X:154323783-154323805 GAACCCGGGTTCCCTGGCCCTGG + Intronic